CN110013486A - Application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation - Google Patents
Application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation Download PDFInfo
- Publication number
- CN110013486A CN110013486A CN201910239791.6A CN201910239791A CN110013486A CN 110013486 A CN110013486 A CN 110013486A CN 201910239791 A CN201910239791 A CN 201910239791A CN 110013486 A CN110013486 A CN 110013486A
- Authority
- CN
- China
- Prior art keywords
- mir
- mmu
- drug
- mouse
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/52—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an inorganic compound, e.g. an inorganic ion that is complexed with the active ingredient
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/18—Feminine contraceptives
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Gynecology & Obstetrics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Inorganic Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Micrornas --- application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation.The present invention, which by microrna expression composes Microarray Experiments and bioinformatics method and filters out regulation uterus, to hold stage and the Microrna that plays a crucial role in implantation site: mmu-miR-183-5p, tests prove that mmu-miR-183-5p has highly significant inhibiting effect to embryo nidation, it prompts it to can be used as contraceptive use, new approach is provided for new medicament screen.
Description
(1) technical field
The present invention relates to application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation.
(2) background technique
MiR-183 family is made of tri- kinds of miRNA of miR-96, miR-182 and miR-183, in structure there is height to protect
Keeping property.It is inquired by miRBase and compares discovery, miR-183-5p has well-conserved, the miR- of source of people in different plant species
The consistency of 183-5p and the miR-183-5p of source of mouse have reached 100%.The family in digestive system, urogenital system, exhale
Abnormal expression in the kinds of tumors such as desorption system.Reported research confirms that miR-183 can promote the migration of cell, invasion, divide
Change, proliferation, also affects the generation of capilary indirectly.And during embryo nidation, migration, differentiation, proliferation, micro- blood also occurs
Pipe such as forms at the physiology courses, will do it mutual intrusion, cell proliferation and differentiation between endometrial epithelial cell and embryo, and embryo is grown
It supports layer and invades endometrial epithelium, Angiogenesis.Although having confirmed that miR-183 in the migration, differentiation, increasing of tumour cell
It grows, the effect during capilary is formed, but document there is no to confirm its effect during embryo nidation.
(3) summary of the invention
It is an object of the present invention to provide application of the mmu-miR-183-5p in the drug for inhibiting embryo nidation.
The technical solution adopted by the present invention is that:
Application of the Microrna mmu-miR-183-5p in the drug that preparation inhibits embryo nidation.
Specifically, the mmu-miR-183-5p sequence is as follows:
5’-UAUGGCACUGGUAGAAUUCACU-3’。
Preferably, the mmu-miR-183-5p is used to prepare institute through the more stable double-strand tiny RNA that molecular modification obtains
Drug is stated, specifically, the molecular modification are as follows: 4 alkali before 3 ends base UAU and 3' before whole base methylations end modification+5'
The end thio-modification+3' is carried out between base CACU carries out cholesterol modification.Compared with unmodified double-strand tiny RNA, after modification
RNA and cell membrane affinity it is higher, cell transfection assays transfection reagent dosage substantially reduces, be particularly suitable for animal body in interference
Experiment, and there is higher stability and inhibitory effect in vivo experiment, it can be using systemic injection or locally injecting etc.
Various ways administration, it is easy to operate.
Further, the drug is contraceptive.
Specifically, injection preparation is made in the drug, the work of inhibition embryo nidation is reached by being injected into receptor uterus
With.
Beneficial effect of the present invention is mainly reflected in: the present invention provides mmu-miR-183-5p in the medicine for inhibiting embryo nidation
Application in object prompts it that can make tests prove that mmu-miR-183-5p has highly significant inhibiting effect to embryo nidation
For contraceptive use, new approach is provided for new medicament screen.
(4) Detailed description of the invention
Fig. 1 is the variation tendency of mmu-miR-183-5p in D1, D4, D5IMS, D5IIS endometrium；
Fig. 2 is positional relationship of the miR-183 family on people/mouse chromosome；
Fig. 3 is the vaginal smear result in mouse difference heat stage: A: proestrum；B: oestrus；C: heat later period；D:
Dioestrus；
Fig. 4 is the variation that qPCR method verifies differential expression mmu-miR-183-5p；
Fig. 5 is the variation of mmu-miR-183-5p in false pregnancy model；
Fig. 6 is the relative amount histogram of mmu-miR-183-5p in delay model and delay activation model；
Fig. 7 is the influence after injecting mmu-miR-183-5p to mice embryonic implantation number；A is injection mmu-miR-183-5p
Experimental group, left side are injection DEPC water control, and right side is injection mmu-miR-183-5p agomir；B is control group, left side note
It penetrates DEPC water to compare, right side injection Negative Control is compareed.
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
Embodiment 1:
One, tiny RNA is sequenced
1. materials
ICR mouse species are mated in the female rat of 17 points of selection heats at night with public affairs mouse, and the next morning 9 examines item by item bolt,
If there is white plugs in female rat introitus, it was demonstrated that female rat has been become pregnant, and pregnancy D1 days is denoted as.
First day (D1) is collected after gestation, the 4th day (D4), the 5th day implantation site (D5IMS) and non-implantation site
(D5IIS) endometrial tissue: collection method is, in corresponding number of days, 10 AM is put to death small by disconnected cervical approach humanity
Mouse is carried out disinfection using 75% alcohol, then takes out the uterine tissue of mouse, is removed the fat and blood vessel being adhered, is washed away attached
Blood, pass through squeeze stripping method separating mouse endometrium.Respectively first day (D1), the 4th day after acquisition gestation
(D4), the endometrial tissue in the 5th day implantation site (D5IMS) and non-implantation site (D5IIS).
2. organizing miRNA extracting
MiRNA extraction procedure step: (TIANGEN kit；The method for higher to the purity requirement of miRNA, such as
It is used when studying miRNA chip, miRNA clone.)
(1) sample treatment: group is woven in liquid nitrogen and is ground.Every 30~50mg animal tissue or 100mg plant tissue add
1mL lysate MZ carries out homogenized with Syrup-homogenizing instrument./ 10th of lysate MZ volume are not to be exceeded in sample volume.
(2) homogenised sample is being placed at room temperature for 5min, so that nucleic acid-protein compound is kept completely separate.
(3) 4 DEG C of 12,000rpm (~13,400 × g) are centrifuged 5min, take supernatant, be transferred to one it is new without RNase from
In heart pipe.
(4) 200 μ L chloroforms are added, covers pipe lid, acutely vibrates 15sec, be placed at room temperature for 5min.
(5) 4 DEG C of 12,000rpm (~13,400 × g) are centrifuged 15min, and sample can be divided into three layers: the organic phase of yellow, in
Interbed and colourless water phase, for RNA mainly in water phase, the volume of water phase is about the 50% of lysate MZ reagent used.Water phase
It is transferred in new pipe, carries out next step operation.
(6) volume for measuring transfer liquid is slowly added to the dehydrated alcohol of 0.43 times of transfer liquid product (such as: the transfer of 500 μ L
Liquid adds 215 μ L dehydrated alcohols), mix (at this time it is possible that precipitating).Obtained solution and precipitating are transferred to together to absorption
In column miRspin, room temperature 12,000rpm (~13,400 × g) is centrifuged 30sec, if once cannot be by complete soln and mixture
It is added into adsorption column miRspin, is please transferred in two times, discarded after centrifugation to adsorption column miRspin, retain efflux.
(7) volume for measuring efflux, is slowly added to 0.75 times of effluent volume of dehydrated alcohol (such as: the outflow of 700 μ L
Liquid adds 525 μ L dehydrated alcohols), mix (at this time it is possible that precipitating).Obtained solution and precipitating are transferred to adsorption column together
In miRelute, room temperature 12,000rpm (~13,400 × g) is centrifuged 30sec, if cannot once add complete soln and mixture
Enter in adsorption column miRelute, be please transferred in two times, efflux is discarded after centrifugation, retains adsorption column miRelute.
(8) 500 μ L protein liquid removal MRD (please first check whether and ethyl alcohol has been added), room are added into adsorption column miRelute
Temperature stands 2min, room temperature 12, and 000rpm (~13,400 × g) is centrifuged 30sec, abandons waste liquid.
(9) 500 μ L rinsing liquid RW (please first check whether and ethyl alcohol has been added) are added into adsorption column miRelute, room temperature is quiet
2min, room temperature 12 are set, 000rpm (~13,400 × g) is centrifuged 30sec, abandons waste liquid.
(10) repetitive operation step 9.
(11) adsorption column miRelute is put into 2ml collecting pipe, room temperature 12,000rpm (~13,400 × g) centrifugation
1min removes residual liquid.Adsorption column miRelute is being placed at room temperature for a moment after centrifugation, or is being placed on superclean bench and divulges information
For a moment, sufficiently to dry.
(12) adsorption column miRelute is transferred in a new RNase-Free 1.5mL centrifuge tube, adds 20 μ L
RNase-Free ddH2O, is placed at room temperature for 2min, room temperature 12, and 000rpm (~13,400 × g) is centrifuged 2min.
3. tiny RNA sequencing and interpretation of result
Send biotech firm carry out tiny RNA sequencing, gestation after first day (D1), the 4th day (D4), the 5th day implantation site
(D5IMS) it is repeated with each three biologies of the endometrial tissue miRNA in non-implantation site (D5IIS).By to sequencing result
Analysis, finds out the miRNA to play a crucial role in implantation window phase.The results show that during embryo nidation, mmu-miR-183-
5p has highly significant difference before and after implantation.
The absolute quantitation of mmu-miR-183-5p reads item number the result is shown in Figure 1 in mouse tissue miRNA sequencing result.
D1 and D4, D5IMS have the difference of conspicuousness, D4 and D5IMS and D5IMS and D5IIS to have as the result is shown
As a result the difference of conspicuousness illustrates that mmu-miR-183-5p is played a key role during embryo nidation.
Correlation analysis is repeated to the biology in the sample each group of sent to sequencing, analyzes data result such as 1 institute of table
Show, as the result is shown first day (D1) after gestation, the 4th day (D4), the 5th day implantation site (D5IMS) and non-implantation site
(D5IIS) difference between three biology repetitions of endometrial tissue miRNA each group is smaller, and the consistency of sample is higher,
Sequencing result is reliable and stable.
Correlation coefficient analysis between sample sets is sequenced in table 1
Two, mmu-miR-183-5p biological information brief introduction
MiR-183-5p is located on No. 7 chromosomes in people, and in mouse, mmu-miR-183-5p is located at No. 6
On chromosome.The specific location of miR-183 family on chromosome is referring to fig. 2.
MiR-183 has conservative between different plant species.And there are two 5' sequences for miR-183 tool.mmu-mir-183-5p
Sequence are as follows: 5'-UAUGGCACUGGUAGAAUUCACU-3'；The sequence of mmu-miR-183-5p.2 is 5'-AUGGCAC
UGGUAGAAUUCACUG-3'；The sequence of mmu-miR-183-3p are as follows: 5'-GUGAAUUACCGAAGGGCCAUAA-3'.mmu-
Be staggered a base before and after between 5' sections of miR-183 of two sequences, but the two seed sequence is consistent, closes both in miRBase
It and is one.
In fluorescent quantitative PCR experiment, according to the design of primers principle of miRNA, the amplimer sequence of mmu-miR-183-5p
It is classified as: 5'-GACTATGGCACTGGTAGATTTCACTG-3'.The primer can simultaneously specificity amplify mmu-miR-
183-5p and mmu-miR-183-5p.2.
Three, gestation after first day to the 7th day miR-183-5p variation
In order to further determine in the changing rule of first half period of gestation mmu-miR-183-5p, research range is expanded into gestation
The first seven day afterwards carries out relative quantification to mmu-miR-183-5p by the method for fluorescent quantitation, studies variation tendency.
1. materials
(1) mouse vagina smear determines the oestrous cycle
The production of vagina mucus smear: ICR mouse species clamp mouse root of the tail, the back of the hand with right hand little finger and the third finger
Press through back of mice, then with thumb and index finger hold with a firm grip mouse neck back side and ear skin to complete the regular worker of mouse
Make.Liquid-transfering gun is seated pipette tips, draws 10 μ L physiological saline, squeezes into inside mouse vagina, and aspirated for several times, after mixing well back and forth
Glass slide center is dripped to, it is uniformly spreadable, it spontaneously dries in air.Then dried glass slide is put into 95% alcohol solid
Determine 15min, hematoxylin dyes 15~30min, and tap water rinses 2min, eosin stains 1min, the clean remaining dye of distilled water flushing
Material, mounting microscopy.Continuous detection 14 days, finds out the picture difference criteria of oestrus and dioestrus, smear results are detailed in Fig. 3.
The feature of proestrum vaginal smear has core epithelial cell to account for the overwhelming majority, leucocyte and angle to be in irregular shape or tadpole shape
Matter epithelial cell is seldom (Fig. 3 A)；The feature of oestrus vaginal smear is almost sheet entirely, seedless keratinocyte (figure
3B)；Heat later period vaginal smear feature is a small amount of seedless keratinized epithelium, and leucocyte is in the great majority (Fig. 3 C)；Between heat
Phase vaginal smear feature has a large amount of leucocytes (Fig. 3 D) in smear for epithelial cell is few and shrinkage.
(2) endometrial tissue in mouse pregnancy early period and oestrus, dioestrus is collected
ICR mouse species are mated in the female rat of 17 points of selection heats at night with public affairs mouse, and the next morning 9 examines item by item bolt,
If there is white plugs in female rat introitus, it was demonstrated that female rat has been become pregnant, and pregnancy D1 days is denoted as.
First day (D1), second day (D2), third day (D3), the 4th day (D4), the 5th day implantation site after collection gestation
(D5IMS), non-implantation site (D5IIS), the 6th day (D6), the 7th day (D7), the intrauterine in oestrus (F) and dioestrus (J)
Membrane tissue: collection method is, in corresponding number of days, 10 AM puts to death mouse by disconnected cervical approach humanity, uses 75% wine
Essence carries out disinfection, and then takes out the uterine tissue of mouse, removes the fat and blood vessel being adhered, washes away the blood of attachment, by squeezing
Press the endometrium of stripping method separating mouse.Corresponding endometrial tissue is obtained respectively.
2. organizing miRNA extracting
Extracting method is as previously described.(TIANGEN)
3.miRNA is inverted to cDNA (TIANGEN)
Operating procedure
(1) preparation of reverse transcription system
Defrosting 2 × miRNA RT Reaction Buffer is simultaneously mixed, and miRNA RT Enzyme Mix is put in standby in ice
With the interior following reagent of addition of the reaction tube of pre-cooling RNase Free to 20 μ L of total volume (is eventually adding miRNA RT on ice
Enzyme Mix).Configuration proportion is shown in Table 2.
The preparation (20 μ L) of 2 reverse transcription system of table
| Reagent component | Volume | Final concentration |
| Total RNA* | - | Up to 2 μ g |
| 2×miRNA Reaction Buffer | 10μL | 1× |
| miRNA RT Enzyme Mix | 2μL | - |
| RNase-Free ddH2O | It mends to 20 μ L | - |
(2) reverse transcription program
Pipettor mixes gently the reaction solution of above-mentioned preparation, and the program of according to the form below 3 carries out the reverse transcription reaction of miRNA:
3 reverse transcription reaction program of table
The cDNA reaction solution of synthesis can be placed in -20 DEG C of preservations；Downstream fluorogenic quantitative detection can also directly be carried out.Into
When the fluorogenic quantitative detection of row downstream, for the inhibition for avoiding reverse transcription system from reacting quantitative PCR, most suitable Ct value (15-30 is obtained
Between), it is used after cDNA reaction solution being diluted 10-1000 times.
4. the opposite variation of fluorogenic quantitative detection D1-D7 and mouse oestrus and dioestrus mmu-miR-183-5p become
Gesture.
Operating procedure:
(1) room temperature melt 2 × miRcute Plus miRNA PreMix, 50 × ROX Reference Dye and
Reverse Primer。
(2) please 2 × miRcute Plus miRNA PreMix is turned upside down when using and is gently uniformly mixed, has been avoided
Bubble, and used after gentle centrifugation.If (reagent does not mix, and reactivity worth can be declined, and not use oscillator
It mixes.)
(3) be placed on ice reagent, and prepare reaction system by table 4: (fluorescent quantitation instrument used is ABI company Step
One plus PCR System fluorescent quantitation instrument.)
4 quantitative fluorescent PCR of table prepares reaction system
When PCR response procedures are arranged, quantitative PCR reaction is carried out using 5 program of table:
5 quantitative fluorescent PCR response procedures of table
The variation tendency result of first day to the 7th day mmu-miR-183-5p is shown in Fig. 4 after gestation.The results show that in embryo
In implantation process, the relative amount of mmu-miR-183-5p is gradually decreased, and has within first day the difference of conspicuousness with gestation, and
The content of the mmu-miR-183-5p of bed window phase (D4-D5) significantly reduces, and compared with the content in oestrus, reduces degree extremely
Significantly.As a result illustrate during embryo nidation, mmu-miR-183-5p has great importance.Four, false pregnancy model is verified
The action function of mmu-miR-183-5p
1. vasoligation preparation ligatures public mouse
(1) anesthesia of male mouse: 6 weeks or more male mouse are anaesthetized using yellow Jackets, with PBS yellow Jackets with 2mg/
ML dissolution, is injected intraperitoneally by weight 0.1mL/10g.
(2) it is cut skin along ventrimeson cropping with 70% alcohol disinfecting abdominal operation position: picking up skin with blunt tweezers
Skin makes it away from stomach wall.Along ventrimeson opening in place.Note that keep scissors to be lifted up.
(3) it cuts body wall: clamping body wall with pincet, lift, make it away from intestinal tube.It is light in ventrimeson with ophthalmology scissors again
The notch of 1 centimeter length of light pruning.It is careful not to touching and hurts following intestinal tube.
(4) side testis is pushed into abdominal cavity from scrotum by the white adipose pad for finding testis.Incision of abdominal wall is clamped with pincet
One edge finds the white adipose pad for investing testis.
(5) take out testis, clamp fat-body with blunt tweezers, it gently pulls out to notch, followed by testis, vas deferens etc. also by
It pulls out.Testis directly cannot be touched or be operated, testis can only be kept mobile and positioning by operating fat-body.
(6) vasectomy: carefully identification testis and epididymis pick up the effective pincet of semen deposition below cauda epididymidis, use
Suture ligatures at the both ends of the semen deposition pipeline section picked up, then cuts in the intermediate region in two ligation portions.It (can also be with scorching hot
Pincet blows vas deferens, or removes one section of vas deferens).
(7) it resets: after having ligatured, gently affecting fat-body, testis etc. is made to return abdominal cavity.The other side is ligatured according to the above method
Vas deferens.
(8) suture: the surgical operation suturing edge of a knife sprinkles appropriate antibiotic.
(9) postoperative care: postoperative hero mouse will conscientiously nurse, and improve environment temperature.It is generally postoperative just to make after two weeks
With.
2. the preparation of pseudopregnant mouse model
The mouse in oestrus and the public mouse of ligation are mated, ICR mouse species, in the female rat and public affairs of 17 points of selection heats at night
Mouse is mated, and the next morning 9 examines item by item bolt, if white plugs occurs in female rat introitus, it was demonstrated that female rat has been become pregnant, note
Do pregnancy D1 days.It takes false pregnancy first day (D1) and the endometrium of false pregnancy the 4th day (D4) carries out the opposite of mmu-miR-183-5p
It is quantitative, as a result as shown in Figure 5.
In false pregnancy model, in the presence of no embryo, compared with gestation first day, the 4th day endometrium
Significantly reducing equally occurs in middle mmu-miR-183-5p.This is the results show that the mmu-miR-183-5p in first half period of gestation is reduced
It is that the parent that uterus itself carries out to receive the attachment of embryo is adjusted, is not directly dependent upon with embryo's presence or absence, works as embryo
In the presence of tire, the reduction level of mmu-miR-183-5p is more significant.
Five, the action function of delay implantation model and the implantation activation model verifying mmu-miR-183-5p that is delayed
The 4th day morning of normal pregnancy imposes Bilateral oophorectomy operation to pregnant female mice.Then respectively at gestation the 5th day
And the 6th day morning 8:00 to ovariectomized pregnant mouse subcutaneous injection progesterone (progsterone, P4, Sigma Co., USA,
1mg/0.1mL/ is only).Gestation the 7th day by these mouse be divided into two groups: one 17 beta estradiols of group injection (17 β-estradiol,
E2, Sigma Co., USA, 25ng/0.1mL/ is only) and P4 (1mg/0.1mL/ is only), it is delayed nidation activation group；Another group is only infused
P4 (1mg/0.1mL/ is only) is penetrated, is delayed nidation group.After last time injection for 24 hours, cervical dislocation puts to death mouse.Delayed nidation
Group draws materials side uterus, and other side uterus normal saline flushing, microscopy of being subject to sees the embryo of delayed nidation.Postpone
1% chicago blue of mouse tail vein injection (0.1mL/ only) of bed activation group checks after 5min, has blue to see on uterus
Subject to bed point.Delayed nidation group and delayed nidation activation group uterus extract RNA are taken respectively, is inverted to cDNA, and it is fixed to carry out fluorescence
Measure PCR.Quantitative result is as shown in Fig. 6, table 6.
The fluorescent quantitation data result of mmu-miR-183-5p in 6 delay model of table and delay activation model
Delay model and delay activation model result show that, in embryo nidation, implantation event is to lead to mmu-miR-
The immediate cause that 183-5p is reduced.Compared with the implantation model that is delayed, when activation embryo carries out implantation, mmu-miR-183-5p is reduced
It is extremely significant.Directly demonstrate mmu-miR-183-5p and embryo nidation have it is closely related.
Six, miR-183-5p is as inhibiting the drug of embryo nidation to carry out effect in Mice Body and probe into
Mmu-miR-183-5p is added in living body pregnant mouse body, is probed into after injection mmu-miR-183-5p to Development of Mouse Embryos
The influence of tire implantation number.Specific experiment step are as follows: the mmu-miR-183-5p according to the downward expression obtained from miRBase is mature
Body nucleotide sequence, 5 ' -3 ' sequences are UAUGGCACUGGUAGAAUUCACU, mark (whole base first by methylated base
Baseization modification), thio-modification (carrying out thio-modification between 4 bases before 3 bases and the end 3' before the end 5') and cholesterol modification
The more stable double-strand tiny RNA that (end 3' carry out cholesterol modification) obtains, at pregnant D3 days, what side intrauterine injection synthesized
Mmu-miR-183-5p agomir 10nmol (5 μ L), another 5 μ L DEPC water of side injection is as control, by simulating endogenous
Mmu-miR-183-5p adjust the biological function of target gene, observe the influence to embryo nidation site and quantity.In D7
It when put to death mouse check implantation number of sites variation, as a result as shown in Figure 7.
Injection is the results show that compared with the control group, after injecting mmu-miR-183-5p, the embryo nidation point in cornua uteri
Number is substantially reduced, it is seen that mmu-miR-183-5p has highly significant inhibiting effect to embryo nidation, it is prompted to can be used as contraception
Drug uses.
Sequence table
<110>Zhejiang University
<120>application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 1
uauggcacug guagaauuca cu 22
<210> 2
<211> 22
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 2
uauggcacug guagaauuca cu 22
<210> 3
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gactatggca ctggtagatt tcactg 26
Claims (5)
1. application of the Microrna mmu-miR-183-5p in the drug that preparation inhibits embryo nidation.
2. application as described in claim 1, it is characterised in that the mmu-miR-183-5p sequence is as follows: 5 '-
UAUGGCACUGGUAGAAUUCACU-3’。
3. application as described in claim 1, it is characterised in that the mmu-miR-183-5p is used to prepare after molecular modification
The drug, the modification are as follows: one, whole base methylation modifications；Two, 4 bases before 3 ends base UAU and 3' before the end 5'
Thio-modification is carried out between CACU；Three, the end 3' carries out cholesterol modification.
4. application as described in claim 1, it is characterised in that the drug is contraceptive.
5. application as claimed in claim 2 or claim 3, it is characterised in that injection preparation is made in the drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910239791.6A CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910239791.6A CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110013486A true CN110013486A (en) | 2019-07-16 |
| CN110013486B CN110013486B (en) | 2021-08-17 |
Family
ID=67190117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910239791.6A Active CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110013486B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102333891A (en) * | 2009-01-20 | 2012-01-25 | 利兰·斯坦福青年大学托管委员会 | Single cell gene expression for diagnosis, prognosis and identification of drug targets |
| WO2014125277A1 (en) * | 2013-02-12 | 2014-08-21 | Reneuron Limited | Method of producing microparticles |
| WO2015044890A2 (en) * | 2013-09-26 | 2015-04-02 | Friedrich Miescher Institute For Biomedical Research | Tools and methods using mirna 182, 96 and/or 183 for treating pathologies |
| US20160333427A1 (en) * | 2015-05-15 | 2016-11-17 | Wisconsin Alumni Research Foundation | Non-invasive assays for embryo quality |
| CN107532181A (en) * | 2015-03-16 | 2018-01-02 | 米拉根医疗股份有限公司 | MIRNA analogies are treating the purposes in feeling sufferer with them |
-
2019
- 2019-03-27 CN CN201910239791.6A patent/CN110013486B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102333891A (en) * | 2009-01-20 | 2012-01-25 | 利兰·斯坦福青年大学托管委员会 | Single cell gene expression for diagnosis, prognosis and identification of drug targets |
| WO2014125277A1 (en) * | 2013-02-12 | 2014-08-21 | Reneuron Limited | Method of producing microparticles |
| WO2015044890A2 (en) * | 2013-09-26 | 2015-04-02 | Friedrich Miescher Institute For Biomedical Research | Tools and methods using mirna 182, 96 and/or 183 for treating pathologies |
| CN107532181A (en) * | 2015-03-16 | 2018-01-02 | 米拉根医疗股份有限公司 | MIRNA analogies are treating the purposes in feeling sufferer with them |
| US20160333427A1 (en) * | 2015-05-15 | 2016-11-17 | Wisconsin Alumni Research Foundation | Non-invasive assays for embryo quality |
Non-Patent Citations (4)
| Title |
|---|
| CAO D. ET AL: "MiR-183 impeded embryo implantation by regulating Hbegf and Lamc1 in mouse uterus", 《THERIOGENOLOGY》 * |
| ESTELLA C. ET AL: "miRNA Signature and Dicer Requirement during Human Endometrial Stromal Decidualization In Vitro", 《PLOS ONE》 * |
| 林玉仪 等: "microRNA调控女性生殖功能的研究进展", 《生理科学进展》 * |
| 焦保华 主编: "《神经胶质瘤 基础与临床》", 31 July 2006, 科学技术文献出版社 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110013486B (en) | 2021-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107043787B (en) | A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 | |
| Rosenlund et al. | A comparison between open and percutaneous needle biopsies in men with azoospermia. | |
| Schoolcraft et al. | Blastocyst culture and transfer increases the efficiency of oocyte donation | |
| Manor et al. | Fertilization and early embryology: Undocumented embryos: do not trash them, FISH them | |
| CN104498599B (en) | One group of microsporidian molecule universal detector primer and kit thereof | |
| CN109777837A (en) | A method of the systemic knock-out mice model of lethal gene is constructed using CRISPR/Cas9 system | |
| von Wolff et al. | Intravaginal and intracervical application of seminal plasma in in vitro fertilization or intracytoplasmic sperm injection treatment cycles—a double-blind, placebo-controlled, randomized pilot study | |
| RU2408014C2 (en) | Method for prediction of preterm delivery of infectious genesis | |
| RU2334233C1 (en) | Method for forecasting preterm labour in presence of urogenital infection | |
| Hook et al. | Guinea pig and mouse models for genital herpes infection | |
| CN110038024A (en) | Application of the mmu-miR-192-5p in the drug that preparation inhibits embryo nidation | |
| CN110038026A (en) | Application of the mmu-miR-218-5p in the drug that preparation inhibits embryo nidation | |
| CN110013486A (en) | Application of the mmu-miR-183-5p in the drug that preparation inhibits embryo nidation | |
| CN110251528A (en) | Application of the mmu-miR-375-3p in the drug that preparation inhibits embryo nidation | |
| CN108866241A (en) | It is a kind of for detecting the kit of border disease | |
| CN109593845A (en) | Purposes of the miRNA as the marker of diagnosis of endometriosis | |
| Mendes et al. | Follicular response and oocyte production following variations in ovarian stimulation in goats | |
| CN110613730B (en) | Application of mmu-miR-335-3p in preparation of medicine for inhibiting embryo implantation | |
| CN106967813A (en) | A kind of kit and its detection method for Diagnosis of Endometriosis | |
| CN113549637A (en) | Mouse PHEX gene SNP locus and application thereof | |
| Tournaye | Gamete source and manipulation | |
| CN110317900A (en) | A kind of the multiple RT-PCR primer sets and detection method of quick detection CSFV, GETV, JEV | |
| Huang et al. | Generation of cynomolgus monkey fetuses with intracytoplasmic sperm injection based on the MII-stage oocytes acquired by personalized superovulation protocol | |
| Chamani et al. | Trigger day follicle-stimulating hormone (FSH)“boost” increases costs but does not improve outcomes in patients undergoing IVF with preimplantation genetic testing for aneuploidy (PGT-A) | |
| Evered | Normal cervical cytology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |