CN110013486B - Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation - Google Patents
Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation Download PDFInfo
- Publication number
- CN110013486B CN110013486B CN201910239791.6A CN201910239791A CN110013486B CN 110013486 B CN110013486 B CN 110013486B CN 201910239791 A CN201910239791 A CN 201910239791A CN 110013486 B CN110013486 B CN 110013486B
- Authority
- CN
- China
- Prior art keywords
- mir
- mmu
- implantation
- preparation
- mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/52—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an inorganic compound, e.g. an inorganic ion that is complexed with the active ingredient
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/18—Feminine contraceptives
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Botany (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Gynecology & Obstetrics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Inorganic Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of micro RNA-mmu-miR-183-5 p in preparation of a medicament for inhibiting embryo implantation. The invention screens out micro RNA which regulates and controls uterine receptivity stage and plays a key role at implantation sites through micro RNA expression profile microarray experiments and bioinformatics methods: the test proves that the mmu-miR-183-5p has extremely obvious inhibition effect on embryo implantation, which indicates that the mmu-miR-183-5p can be used as a contraceptive drug and provides a new approach for new drug screening.
Description
(I) technical field
The invention relates to application of mmu-miR-183-5p in preparation of a medicine for inhibiting embryo implantation.
(II) background of the invention
The miR-183 family is composed of three miRNAs of miR-96, miR-182 and miR-183, and has high conservative property in structure. MiRBase query comparison shows that miR-183-5p has high conservation in different species, and the consistency of human miR-183-5p and mouse miR-183-5p reaches 100%. The family expresses abnormally in a plurality of tumors of the digestive system, the urogenital system, the respiratory system and the like. Reported researches prove that miR-183 can promote migration, invasion, differentiation and proliferation of cells and also indirectly influence the generation of micro-vessels. In addition, physiological processes such as migration, differentiation, proliferation, and formation of microvessels also occur during implantation of the embryo, and thus, the endometrial epithelial cells and the embryo invade each other, the cells proliferate and differentiate, and the embryonic trophoblast invades the endometrial epithelium, so that microvessels are generated. Although the role of miR-183 in migration, differentiation, proliferation and microvascular formation of tumor cells has been demonstrated, no document has yet demonstrated its role in embryo implantation.
Disclosure of the invention
The invention aims to provide application of mmu-miR-183-5p in a medicament for inhibiting embryo implantation.
The technical scheme adopted by the invention is as follows:
application of micro RNA mmu-miR-183-5p in preparation of drugs for inhibiting embryo implantation.
Specifically, the sequence of mmu-miR-183-5p is as follows:
5’-UAUGGCACUGGUAGAAUUCACU-3’。
preferably, the more stable double-stranded small RNA obtained by molecular modification of mmu-miR-183-5p is used for preparing the drug, specifically, the molecular modification is as follows: all bases are modified by methylation, the positions between the first 3 bases UAU at the 5' end and the first 4 bases CACU at the 3' end are modified by thio, and the 3' end is modified by cholesterol. Compared with unmodified double-stranded small RNA, the modified RNA has higher affinity with cell membranes, the dosage of a transfection reagent in a cell transfection experiment is obviously reduced, the modified RNA is particularly suitable for in vivo interference experiments of animals, has higher stability and inhibition effect in vivo experiments, can be administered by adopting various modes such as systemic injection or local injection, and is simple and convenient to operate.
Further, the medicament is a contraceptive medicament.
Specifically, the medicine is prepared into an injection preparation, and the effect of inhibiting embryo implantation is achieved by injecting the injection preparation into a receptor uterus.
The invention has the following beneficial effects: the invention provides application of mmu-miR-183-5p in a medicament for inhibiting embryo implantation, and experiments prove that the mmu-miR-183-5p has extremely remarkable inhibitory action on embryo implantation, so that the medicament can be used as a contraceptive medicament and provides a new way for new medicament screening.
(IV) description of the drawings
FIG. 1 shows the trend of mmu-miR-183-5p in endometrium of D1, D4, D5IMS, and D5 IIS;
FIG. 2 shows the position relationship of miR-183 family on human/mouse chromosome;
FIG. 3 is the results of vaginal smears at different stages of oestrus in mice: a: in the early estrus stage; b: an estrus period; c: in the anaphase of estrus; d: a rest period;
FIG. 4 is a variation of differential expression mmu-miR-183-5p verified by qPCR;
FIG. 5 is a graph showing the change in mmu-miR-183-5p in a pseudopregnancy model;
FIG. 6 is a histogram of the relative content of mmu-miR-183-5p in the delayed model and the delayed activation model;
FIG. 7 is a graph showing the effect on implantation number of mouse embryos after mmu-miR-183-5p injection; a is an experimental group for injecting mmu-miR-183-5p, the left side is an DEPC water injection control, and the right side is an mmu-miR-183-5p agomir injection; b is a Control group, DEPC water is injected on the left side to serve as a Control, and Negative Control is injected on the right side to serve as a Control.
(V) detailed description of the preferred embodiments
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
example 1:
one, small RNA sequencing
1. Taking materials
ICR mouse strain, selecting female mouse and male mouse in heat at 17 o 'clock in the evening, closing the female mouse and male mouse, and testing suppository at 9 o' clock in the next morning, if white suppository appears at vaginal opening of the female mouse, it is proved that the female mouse is already pregnant, and it is recorded as pregnant D1 days.
Endometrial tissue collected on the first day of pregnancy (D1), the fourth day (D4), the fifth day at the implantation site (D5IMS) and at the non-implantation site (D5 IIS): the collection method comprises the steps of killing mice by a cervical amputation method in ten am within the corresponding days, sterilizing the mice with 75% alcohol, taking out uterine tissues of the mice, removing adherent fat and blood vessels, washing off attached blood, and separating endometrium of the mice by a squeeze exfoliation method. Endometrial tissue was obtained at the first day of pregnancy (D1), the fourth day (D4), the fifth day at the implantation site (D5IMS) and at the non-implantation site (D5IIS), respectively.
2. Tissue miRNA extraction
And (3) miRNA extraction operation steps: (TIANGEN kit; the method is used for requiring high purity of miRNA, such as the miRNA chip and the miRNA clone research)
(1) Sample treatment: the tissue was ground in liquid nitrogen. Adding 1mL of lysate MZ into 30-50 mg of animal tissue or 100mg of plant tissue, and homogenizing with a homogenizer. The sample volume should not exceed one tenth of the volume of the lysate MZ.
(2) The homogenate was left at room temperature for 5min to allow complete separation of the nucleic acid protein complex.
(3) Centrifugation was carried out at 12,000rpm (. about.13,400 Xg) at 4 ℃ for 5min, and the supernatant was removed and transferred to a new RNase-free centrifuge tube.
(4) Add 200. mu.L chloroform, cover the tube, shake vigorously for 15sec, and let stand at room temperature for 5 min.
(5) After centrifugation at 12,000rpm (13,400 Xg) for 15min at 4 ℃, the sample will separate into three layers: yellow organic phase, intermediate layer and colorless aqueous phase, RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 50% of the lysate MZ reagent used. The aqueous phase was transferred to a new tube and subjected to the next step.
(6) The volume of the transfer solution is measured, and anhydrous ethanol (for example, 500. mu.L of the transfer solution and 215. mu.L of anhydrous ethanol) which is 0.43 times of the volume of the transfer solution is slowly added to the transfer solution, and the mixture is mixed (in this case, precipitation may occur). The resulting solution was transferred to the adsorption column miRspin together with the precipitate and centrifuged at room temperature at 12,000rpm (-13,400 xg) for 30sec, if the entire solution and mixture could not be added to the adsorption column miRspin at one time, the transfer was done in two portions, the column miRspin was discarded after centrifugation and the effluent was retained.
(7) Measuring the volume of the effluent, slowly adding anhydrous ethanol (e.g. adding 525 μ L anhydrous ethanol to 700 μ L effluent) 0.75 times the volume of the effluent, and mixing (precipitation may occur). The resulting solution and precipitate were transferred to adsorption column miRelute together and centrifuged at room temperature at 12,000rpm (-13,400 xg) for 30sec, if the whole solution and mixture could not be added to adsorption column miRelute at one time, the transfer was done in two portions, the effluent was discarded after centrifugation, and the adsorption column miRelute was retained.
(8) To the adsorption column miRelute was added 500. mu.L of deproteinized solution MRD (please check whether ethanol was added or not), allowed to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13,400 Xg) at room temperature for 30sec, and the waste liquid was discarded.
(9) To the adsorption column miRelute was added 500. mu.L of the rinsing solution RW (please check whether ethanol was added or not), and the mixture was allowed to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13,400 Xg) at room temperature for 30sec, and the waste solution was discarded.
(10) Operation 9 is repeated.
(11) The adsorption column, mirelulite, was placed in a 2ml collection tube and centrifuged at 12,000rpm (-13,400 Xg) for 1min at room temperature to remove residual liquid. After centrifugation, the adsorption column miRelute is placed at room temperature for a moment or placed on a clean bench for ventilation for a moment so as to be fully dried.
(12) Transferring the adsorption column miRelute into a new RNase-Free 1.5mL centrifuge tube, adding 20 μ L RNase-Free ddH2O, left at room temperature for 2min, and centrifuged at room temperature for 2min at 12,000rpm (. about.13,400 Xg).
3. Sequencing and result analysis of small RNA
The miRNA is sent to an organism company for small RNA sequencing, and the miRNA in endometrial tissue at the implantation site (D5IMS) and the non-implantation site (D5IIS) are repeated three organisms respectively on the first day (D1), the fourth day (D4), the fifth day after pregnancy. Through analysis of sequencing results, mirnas that play a key role in the implantation window stage were found. The results show that mmu-miR-183-5p has extremely remarkable difference before and after implantation in the embryo implantation process.
The result of absolute quantitative readout of mmu-miR-183-5p in the miRNA sequencing result of the mouse tissue is shown in figure 1.
The results show that D1 has significant difference with D4 and D5IMS, D4 has significant difference with D5IMS, and D5IMS has significant difference with D5IIS, and the results show that mmu-miR-183-5p plays a key role in the implantation process of embryos.
Correlation analysis is carried out on the biological repeats in each group of samples sent for sequencing, the analysis data results are shown in table 1, the results show that the difference between the three biological repeats of each group of the miRNA in the endometrial tissue at the implantation site (D5IMS) and the non-implantation site (D5IIS) on the first day (D1), the fourth day (D4), the fifth day after pregnancy is small, the sample consistency is high, and the sequencing result is stable and reliable.
TABLE 1 analysis of correlation coefficients between sequencing sample groups
Brief introduction of second, mmu-miR-183-5p bioinformation
miR-183-5p is located on chromosome 7 in humans, and mmu-miR-183-5p is located on chromosome 6 in mice. Specific locations of the miR-183 family on the chromosome are shown in FIG. 2.
miR-183 is conserved among different species. And miR-183 has two 5' sequences. The sequence of mmu-mir-183-5p is: 5'-UAUGGCACUGGUAGAAUUCACU-3', respectively; the sequence of mmu-miR-183-5p.2 is 5'-AUGGCAC UGGUAGAAUUCACUG-3'; the sequence of mmu-miR-183-3p is as follows: 5'-GUGAAUUACCGAAGGGCCAUAA-3' are provided. Two sequences of the mmu-miR-1835' segment are staggered by one base back and forth, but the seed sequences of the two sequences are consistent, and the two sequences are combined into one in miRBase.
In a fluorescent quantitative PCR experiment, according to the design principle of a miRNA primer, the amplification primer sequence of mmu-miR-183-5p is as follows: 5'-GACTATGGCACTGGTAGATTTCACTG-3' are provided. The primer can simultaneously and specifically amplify mmu-miR-183-5p and mmu-miR-183-5 p.2.
Third, change of miR-183-5p from first day to seventh day after pregnancy
In order to further determine the change rule of mmu-miR-183-5p in the early pregnancy, the research range is expanded to the first seven days after pregnancy, relative quantification is carried out on mmu-miR-183-5p by a fluorescence quantification method, and the change trend is researched.
1. Taking materials
(1) Determination of estrus cycle by mouse vaginal smear
Preparing a vaginal mucus smear: the ICR mouse strain is characterized in that the tail root of the mouse is clamped by a thumb and a ring finger of a right hand, the back of the hand presses the back of the mouse, and then the skin of the back side of the neck and the skin of the ear of the mouse are tightly held by the thumb and the forefinger to complete the fixation of the mouse. And inserting a pipette head tightly, sucking 10 mu L of physiological saline, injecting into the vagina of the mouse, sucking back and forth for a plurality of times, fully and uniformly mixing, dripping into the center of a glass slide, uniformly coating, and naturally drying in the air. And then, placing the dried glass slide into 95% alcohol for fixation for 15min, staining with hematoxylin for 15-30 min, washing with tap water for 2min, staining with eosin for 1min, washing with distilled water to remove residual dye, and sealing for microscopic examination. The detection is carried out for 14 days continuously, the picture difference standard of the estrus and the estrus is found, and the smear result is shown in figure 3 in detail. The prenatal vaginal smear is characterized by an irregular or tadpole-like shape with the majority of nucleated epithelial cells, and few leukocytes and keratinized epithelial cells (fig. 3A); the estrous vaginal smear is almost entirely characterized by lamellar, anucleated keratinocytes (fig. 3B); the post-oestrus vaginal smear is characterized by a small number of anucleated keratinized epithelial cells with the majority of leukocytes (fig. 3C); the estrus vaginal smear is characterized by a low and shrunken epithelium and a high number of white blood cells in the smear (FIG. 3D).
(2) Endometrial tissue collection at the pre-gestation period, the oestrus period and the oestrus interval of mice
ICR mouse strain, selecting female mouse and male mouse in heat at 17 o 'clock in the evening, closing the female mouse and male mouse, and testing suppository at 9 o' clock in the next morning, if white suppository appears at vaginal opening of the female mouse, it is proved that the female mouse is already pregnant, and it is recorded as pregnant D1 days.
Endometrial tissue collected on day one (D1), day two (D2), day three (D3), day four (D4), day five implantation site (D5IMS), non-implantation site (D5IIS), day six (D6), day seven (D7), estrus (F) and estrus (J) after pregnancy: the collection method comprises the steps of killing mice by a cervical amputation method in ten am within the corresponding days, sterilizing the mice with 75% alcohol, taking out uterine tissues of the mice, removing adherent fat and blood vessels, washing off attached blood, and separating endometrium of the mice by a squeeze exfoliation method. Corresponding endometrial tissues were obtained separately.
2. Tissue miRNA extraction
The extraction method is as described above. (TIANGEN)
Reverse transcription of miRNA into cDNA (TIANGEN)
Procedure for the preparation of the
(1) Preparation of reverse transcription System
Thawing 2 x miRNA RT Reaction Buffer and mixing, placing miRNA RT Enzyme Mix in ice for later use, adding the following reagents into a Reaction tube of ice precooled RNase Free to a total volume of 20 μ L (finally adding miRNA RT Enzyme Mix). The formulation ratios are shown in Table 2.
TABLE 2 preparation of reverse transcription System (20. mu.L)
| Reagent composition | Volume of | Final concentration | |
| Total RNA* | - | Up to 2 mug | |
| 2×miRNA | 10μL | 1× | |
| miRNA RT Enzyme Mix | 2μL | - | |
| RNase-Free ddH2O | Make up to 20 mu L | - |
(2) Reverse transcription procedure
And (3) lightly mixing the prepared reaction solution by using a liquid transfer device, and carrying out the reverse transcription reaction of the miRNA according to the following program 3:
TABLE 3 reverse transcription reaction procedure
The synthesized cDNA reaction solution can be stored at the temperature of minus 20 ℃; downstream fluorescent quantitative detection can also be directly carried out. When downstream fluorescence quantitative detection is carried out, in order to avoid the inhibition of a reverse transcription system on quantitative PCR reaction and obtain an optimal Ct value (between 15 and 30), cDNA reaction solution can be diluted by 10 to 1000 times for use.
4. And (3) carrying out fluorescence quantitative detection on the relative change trends of D1-D7 and the relative change trends of the mouse oestrus and the relative change trend of mmu-miR-183-5p during the oestrus.
The method comprises the following operation steps:
(1) 2 × miRcute Plus miRNA Premix, 50 × ROX Reference Dye and Reverse Primer were thawed at room temperature.
(2) When in use, the 2 XmiRcute Plus miRNA Premix is gently and uniformly mixed by turning upside down to avoid foaming, and is used after being slightly centrifuged. (if the reagents are not mixed, the reactivity is reduced and no oscillator is used for mixing.)
(3) The reagents were placed on ice and the reaction system was formulated as per table 4: (the fluorescence quantitative analyzer used was a Step one plus PCR System fluorescence quantitative analyzer manufactured by ABI.)
TABLE 4 fluorescent quantitative PCR preparation reaction System
When the PCR reaction program was set up, quantitative PCR reactions were performed using the program of table 5:
TABLE 5 fluorescent quantitative PCR reaction procedure
The trend of mmu-miR-183-5p from the first day to the seventh day after pregnancy is shown in FIG. 4. The results show that during the implantation of the embryo, the relative content of mmu-miR-183-5p is gradually reduced, which is significantly different from that of the first day of pregnancy, and the content of mmu-miR-183-5p in the implantation window period (D4-D5) is significantly reduced, and the reduction degree is extremely significant compared with that of the estrus. The result shows that mmu-miR-183-5p has important significance in the process of embryo implantation. Fourthly, verifying the action function of mmu-miR-183-5p by a pseudopregnant model
1. Preparation of ligated male mouse for vasectomy
(1) Anesthesia of the male mouse: male mice over 6 weeks were anesthetized with pentobarbital sodium, which was dissolved in PBS at 2mg/mL and injected intraperitoneally at a weight of 0.1mL/10 g.
(2) The abdominal surgical site was disinfected with 70% alcohol, the hair was clipped along the abdominal midline, and the skin was incised: the skin was lifted off the abdominal wall with blunt forceps. Open at the appropriate location along the ventral midline. Note that the scissors are kept raised upward.
(3) Cutting the body wall: the body wall was grasped with small forceps and lifted away from the bowel. A 1 cm long incision was gently cut at the midline of the abdomen with an ophthalmic scissors. Care should be taken not to touch the underlying bowel.
(4) Find the white fat pad of the testis, push one side testis into the abdominal cavity from the scrotum. The margin of the abdominal wall incision was grasped with small forceps and a white fat pad attached to the testis was found.
(5) The testis was removed, the fat was grasped with blunt forceps, and gently pulled out of the incision, followed by the testis, vas deferens, etc. The testicles cannot be touched or manipulated directly, but only by manipulating the fat mass to move and position the testicles.
(6) Ligation of vas deferens: carefully identify the testis and epididymis, grasp the vas deferens under the epididymis cauda with a pair of tweezers, ligate the two ends of the grasped vas deferens with sutures, and then cut off the middle area of the two ligated parts. (burning tweezers may also be used to blow the vas deferens or to remove a section of the vas deferens).
(7) Resetting: after ligation, the fat body was gently pulled to return the testis to the abdominal cavity. The vas deferens on the other side was ligated as described above.
(8) And (3) sewing: the incision is sutured in the surgical operation, and a proper amount of antibiotics is scattered.
(9) And (3) postoperative care: the post-operative male rat needs careful care to raise the ambient temperature. Generally, the medicine can be used after two weeks after operation.
2. Preparation of pseudopregnant mouse model
Combining the mice in the estrus with the ligated male mice and ICR mice strains, selecting the female mice in the estrus and the male mice at 17 pm for combination, testing the suppository at 9 am the next day, if white suppository-shaped objects appear at the vaginal orifice of the female mice, proving that the female mice are pregnant, and recording as pregnancy D1 days. Relative quantification of mmu-miR-183-5p was performed on the endometrium on the first day of pseudopregnancy (D1) and the fourth day of pseudopregnancy (D4), and the results are shown in FIG. 5.
In the pseudopregnant model, in the absence of embryos, a significant decrease in mmu-miR-183-5p also occurred in the endometrium on day four compared to the first day of pregnancy. The results demonstrate that the reduction of mmu-miR-183-5p in the early stage of pregnancy is maternal regulation of uterus itself to accept attachment of an embryo, and has no direct relation with the existence of an embryo, and the reduction level of mmu-miR-183-5p is more remarkable in the presence of an embryo.
Fifthly, verifying the action function of mmu-miR-183-5p by using a delayed implantation model and a delayed implantation activation model
In the morning of day 4 of normal pregnancy, pregnant females were subjected to bilateral ovariectomy. Thereafter, ovariectomized pregnant mice were subcutaneously injected with progesterone (progsterone, P4, Sigma, USA, 1mg/0.1 mL/mouse) at 8:00 am on days 5 and 6 of pregnancy, respectively. These mice were divided into two groups on day 7 of gestation: one group was injected with 17 β -estradiol (17 β -estradiol, E2, Sigma, usa, 25ng/0.1 mL/mouse) and P4(1mg/0.1 mL/mouse), as a delayed-implantation activated group; the other group was injected with P4(1mg/0.1 mL/mouse), as a delayed bed group. After the last 24h injection, the mice were sacrificed by cervical dislocation. One uterus of the delayed implantation group is sampled, and the other uterus is washed with normal saline, based on the observation of the delayed implantation embryo by microscopy. Mice in the delayed implantation activation group were injected intravenously with 1% Chicago blue (0.1 mL/mouse) at the tail and examined 5min later to see blue implantation sites on the uterus. Respectively taking the uterus of the delayed implantation group and the delayed implantation activating group to extract RNA, inverting the RNA into cDNA, and performing fluorescence quantitative PCR. The quantitative results are shown in FIG. 6 and Table 6.
TABLE 6 results of quantitative fluorescence data of mmu-miR-183-5p in delayed activation model and delayed activation model
The results of the time delay model and the time delay activation model show that the implantation event is a direct cause of reduction of mmu-miR-183-5p during embryo implantation. Compared with a delayed implantation model, when the embryo is activated to perform implantation, the decrease of mmu-miR-183-5p is extremely obvious. Directly proves that mmu-miR-183-5p is closely related to embryo implantation.
Effects of miR-183-5p serving as drug for inhibiting embryo implantation in mice
The mmu-miR-183-5p is added into a living pregnant mouse, and the influence of the injected mmu-miR-183-5p on the implantation number of the mouse embryo is researched. The specific experimental steps are as follows: according to the nucleotide sequence of a mmu-miR-183-5p mature body obtained from miRBase, the 5' -3' sequence is UAUGGCACUGGUAGAAUUCACU, and the more stable double-stranded small RNA is obtained through methylation base labeling (all base methylation modification), thio modification (thio modification is carried out between the first 3 bases at the 5' end and the first 4 bases at the 3' end) and cholesterol modification (cholesterol modification is carried out at the 3' end), when pregnancy D3 days, the synthetic mmu-miR-183-5p agomir 10nmol (5 mu L) is injected at one side of the uterine horn, 5 mu L DEPC water is injected at the other side of the uterine horn as a control, the biological function of a target gene is regulated by simulating endogenous mmu-miR-183-5p, and the influence on the implantation sites and the number of embryos is observed. Mice sacrificed on day D7 to check for changes in bed position and the results are shown in figure 7.
The injection result proves that compared with a control group, the number of embryo nidation points in the uterine horn is obviously reduced after the mmu-miR-183-5p is injected, and the mmu-miR-183-5p has extremely obvious inhibition effect on the embryo nidation, thereby prompting that the medicament can be used as a contraceptive medicament.
Sequence listing
<110> Zhejiang university
Application of <120> mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
uauggcacug guagaauuca cu 22
<210> 2
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
uauggcacug guagaauuca cu 22
<210> 3
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gactatggca ctggtagatt tcactg 26
Claims (4)
1. The application of the micro RNA mmu-miR-183-5p in the preparation of the medicine for inhibiting embryo implantation comprises the following sequence: 5'-UAUGGCACUGGUAGAAUUCACU-3' are provided.
2. The use according to claim 1, characterized in that said mmu-miR-183-5p is molecularly modified for the preparation of said medicament by: methylation modification of all bases; secondly, carrying out thio modification between the first 3 bases UAU of the 5 'end and the first 4 bases CACU of the 3' end; and thirdly, carrying out cholesterol modification on the 3' end.
3. The use according to claim 1, wherein the medicament is a contraceptive medicament.
4. The use according to claim 3, wherein the medicament is formulated for injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910239791.6A CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910239791.6A CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110013486A CN110013486A (en) | 2019-07-16 |
| CN110013486B true CN110013486B (en) | 2021-08-17 |
Family
ID=67190117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910239791.6A Active CN110013486B (en) | 2019-03-27 | 2019-03-27 | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110013486B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102333891A (en) * | 2009-01-20 | 2012-01-25 | 利兰·斯坦福青年大学托管委员会 | Single cell gene expression for diagnosis, prognosis and identification of drug targets |
| WO2014125277A1 (en) * | 2013-02-12 | 2014-08-21 | Reneuron Limited | Method of producing microparticles |
| WO2015044890A2 (en) * | 2013-09-26 | 2015-04-02 | Friedrich Miescher Institute For Biomedical Research | Tools and methods using mirna 182, 96 and/or 183 for treating pathologies |
| US20160333427A1 (en) * | 2015-05-15 | 2016-11-17 | Wisconsin Alumni Research Foundation | Non-invasive assays for embryo quality |
| CN107532181A (en) * | 2015-03-16 | 2018-01-02 | 米拉根医疗股份有限公司 | MIRNA analogies are treating the purposes in feeling sufferer with them |
-
2019
- 2019-03-27 CN CN201910239791.6A patent/CN110013486B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102333891A (en) * | 2009-01-20 | 2012-01-25 | 利兰·斯坦福青年大学托管委员会 | Single cell gene expression for diagnosis, prognosis and identification of drug targets |
| WO2014125277A1 (en) * | 2013-02-12 | 2014-08-21 | Reneuron Limited | Method of producing microparticles |
| WO2015044890A2 (en) * | 2013-09-26 | 2015-04-02 | Friedrich Miescher Institute For Biomedical Research | Tools and methods using mirna 182, 96 and/or 183 for treating pathologies |
| CN107532181A (en) * | 2015-03-16 | 2018-01-02 | 米拉根医疗股份有限公司 | MIRNA analogies are treating the purposes in feeling sufferer with them |
| US20160333427A1 (en) * | 2015-05-15 | 2016-11-17 | Wisconsin Alumni Research Foundation | Non-invasive assays for embryo quality |
Non-Patent Citations (3)
| Title |
|---|
| microRNA调控女性生殖功能的研究进展;林玉仪 等;《生理科学进展》;20141231;第45卷(第3期);第230-234页 * |
| MiR-183 impeded embryo implantation by regulating Hbegf and Lamc1 in mouse uterus;Cao D. et al;《Theriogenology》;20200908;第158卷;第218-226页 * |
| miRNA Signature and Dicer Requirement during Human Endometrial Stromal Decidualization In Vitro;Estella C. et al;《PLoS ONE》;20120720;第7卷(第7期);第1页摘要、左栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110013486A (en) | 2019-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107043787B (en) | A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 | |
| Xi et al. | Electroacupuncture Improves Pregnancy Outcomes in Rats with Thin Endometrium by Promoting the Expression of Pinopode‐Related Molecules | |
| Detti et al. | Endometrial morphology and modulation of hormone receptors during ovarian stimulation for assisted reproductive technology cycles | |
| CN110038026B (en) | Application of mmu-miR-218-5p in preparation of medicine for inhibiting embryo implantation | |
| von Wolff et al. | Intravaginal and intracervical application of seminal plasma in in vitro fertilization or intracytoplasmic sperm injection treatment cycles—a double-blind, placebo-controlled, randomized pilot study | |
| CN110038024B (en) | Application of mmu-miR-192-5p in preparation of medicine for inhibiting embryo implantation | |
| Arias-Álvarez et al. | Ovarian response and embryo gene expression patterns after nonsuperovulatory gonadotropin stimulation in primiparous rabbits does | |
| CN110013486B (en) | Application of mmu-miR-183-5p in preparation of medicine for inhibiting embryo implantation | |
| Kocur et al. | Assessing male gamete genome integrity to ameliorate poor assisted reproductive technology clinical outcome | |
| CN110251528B (en) | Application of mmu-miR-375-3p in preparation of medicine for inhibiting embryo implantation | |
| CN110613730B (en) | Application of mmu-miR-335-3p in preparation of medicine for inhibiting embryo implantation | |
| Fedorka et al. | The effect of cysteine-rich secretory protein-3 and lactoferrin on endometrial cytokine mRNA expression after breeding in the horse | |
| Woo et al. | Simulated childbirth injuries in an inbred rat strain | |
| Stapleton et al. | Gender affects macrophage cytokine and prostaglandin E2 production and PGE2 receptor expression after trauma1 | |
| CN113827611A (en) | Application of seaweed extract GV971 in preparation of medicine for treating polycystic ovarian syndrome | |
| Ariga et al. | Non-surgical (laparoscopic) uterine flushing and egg recovery technique in the squirrel monkey (Saimiri sciureus) | |
| Vicdan et al. | The effect of retained embryos on pregnancy outcome in an in vitro fertilization and embryo transfer program | |
| Huang et al. | Generation of cynomolgus monkey fetuses with intracytoplasmic sperm injection based on the MII-stage oocytes acquired by personalized superovulation protocol | |
| Malaivijitnond et al. | Female long‐tailed macaques with scrotum‐like structure | |
| CN110317900A (en) | A kind of the multiple RT-PCR primer sets and detection method of quick detection CSFV, GETV, JEV | |
| Orihuela et al. | Mating effects on female reproductive organs: the paradigm of estrogen signaling pathways in the oviduct | |
| Kilicdag et al. | How effective are ultra-low dose oral contraceptive pills for treatment of benign ovarian cysts? | |
| RU2789591C1 (en) | Method for modeling juvenile endometriosis using a xenograft model | |
| CN109200289B (en) | FAM134B treats the purposes in pyemic drug in preparation | |
| Flannigan et al. | Male infertility: Evaluation and treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |