CN110007080B

CN110007080B - Rabies virus antibody quantitative detection kit and preparation method and detection method thereof

Info

Publication number: CN110007080B
Application number: CN201910291423.6A
Authority: CN
Inventors: 刘伟; 石晶; 殷玉和; 夏振强; 王慧慧; 崔玉梅; 丁秋雨; 赵玉环; 刘洪运; 王倩
Original assignee: Changchun Sr Biological Technology Co ltd
Current assignee: Changchun Sr Biological Technology Co ltd
Priority date: 2019-04-12
Filing date: 2019-04-12
Publication date: 2022-09-23
Anticipated expiration: 2039-04-12
Also published as: CN110007080A

Abstract

The invention discloses a rabies virus antibody quantitative detection kit, a preparation method and a detection method thereof, belongs to the technical field of antibody detection kits, and solves the problems of low antibody detection accuracy and potential safety hazard in the prior art. The kit comprises an immunochromatography detection test strip and a sample diluent, wherein the immunochromatography detection test strip sequentially comprises from one end to the other end: a sample pad coated with rabies virus antigen, a marking pad coated with monoclonal antibody of anti-rabies virus antigen, a nitrocellulose membrane coated with a detection line and a quality control line, and a water absorption pad, which are mutually overlapped and stuck on the upper surface of the back plate. The method adopts a competition method to detect the rabies virus antibody in the blood, and is matched with a strip reading device, so that the real antibody value in the blood sample can be directly displayed according to a standard curve, and the detection accuracy and sensitivity are improved.

Description

Rabies virus antibody quantitative detection kit and preparation method and detection method thereof

Technical Field

The invention relates to the technical field of antibody detection kits, in particular to a rabies virus antibody quantitative detection kit, a preparation method and a detection method thereof.

Background

Rabies is commonly called as mad dog disease and is the only acute infectious disease with 100 percent of fatality rate of human beings so far. Rabies is widely distributed worldwide. The number of the death caused by the rabies is estimated to be 4-7 ten thousand every year all over the world, in recent years, the epidemic situation of the rabies in China always tends to rise, and the number of the death is the first of 37 legal reports of infectious diseases in China. In 1996, the number of reported rabies cases in the country was once lower and is 159 cases, in 2004, the number of reported rabies cases in the country increased to 2660 cases, and in 2010, 3300 cases of rabies cases officially released in China and diagnosed with effectiveness. Many species of mammals are involved in the transmission of rabies, and dogs are the most prominent storage and transmission hosts of rabies among the families developing China. The most common way that humans are infected with rabies is by biting, scratching, licking skin or mucosal lesions of dogs, cats, wild carnivores, and vermin-and blood-feeding bats infected with rabies virus.

Rabies vaccine is a key factor in the control of human and animal rabies. The World Health Organization (WHO) rabies expert Committee considers that a neutralizing antibody titer in serum of 0.5 International units (IU/ml) or more, which effectively binds rabies virus, is sufficiently protective, and that multiple doses of booster immunization must be given if the neutralizing antibody titer is <0.5IU/ml until the antibody is up to specification. The rabies virus G protein is the only protein for inducing the organism to generate virus neutralizing antibody, so the method for detecting the titer of the neutralizing antibody in serum by using the rabies virus G protein is the most scientific and direct method.

According to the registration and query results of CFDA medical instruments, two products approved by the existing human rabies virus antibody (IgG) detection kit exist, and the application range is that the human rabies virus IgG antibody in human serum is qualitatively detected; the rabies virus antibody detection kit for animals does not have a product of approval at present. Therefore, the existing rabies virus antibody detection product is only used for qualitative detection, and the existing quantitative detection kit has certain technical difficulty and technical barrier. However, the qualitative detection of the antibody has great disadvantages, the detection result is not accurate enough, even if the detection result shows positive, the neutralizing antibody in the serum does not necessarily reach a titer of more than or equal to 0.5 international unit (IU/ml), the protection is not enough, the risk of rabies infection is increased, and great potential safety hazard exists.

Disclosure of Invention

The invention aims at the technical problems and provides a rabies virus antibody quantitative detection kit, a preparation method and a detection method thereof. The kit can be used for digitally representing the antibody titer by analyzing the color development intensity of the detection line and utilizing a regression equation after an organism receives rabies vaccine inoculation through detection of whole blood or serum, can quickly and accurately detect specific values of rabies antibody levels in blood, and definitely determines whether the antibody levels reach 0.5IU levels or not, so that the immunity level of the rabies vaccine is monitored, the immunity effect is prompted, the immunity of the rabies vaccine is really evaluated to achieve immunity protection, the safety of dogs and human beings is guaranteed, and the kit has a very good application prospect.

In order to achieve the above purpose, the invention provides the following technical scheme:

a rabies virus antibody quantitative determination kit comprises an immunochromatography detection test strip and a sample diluent;

the immunochromatography detection test strip comprises from one end to the other end in sequence: a sample pad coated with rabies virus antigen, a labeling pad coated with monoclonal antibody against rabies virus antigen, a nitrocellulose membrane coated with a detection line and a quality control line, and a water absorption pad, which are mutually overlapped and attached to the upper surface of the back plate;

the rabies virus antigen coated by the sample pad is rabies virus-like particles, the detection line is coated with a monoclonal antibody resisting the rabies virus antigen, the quality control line is coated with staphylococcus aureus protein A, and the monoclonal antibody resisting the rabies virus antigen coated by the marking pad is marked by colloidal gold or fluorescent microspheres;

the sample diluent contains 15mmol/L borax, 0.5% NaCl, 0.2% Tween-20 and 0.1% NaN ₃ pH 8.4.

The protein concentration of the rabies virus antigen coated on the sample pad is 0.5-2.0 g/L.

The marking pad is a gold-labeled pad or a fluorescent pad prepared by spraying a monoclonal antibody of the rabies virus antigen marked by colloidal gold or fluorescent microspheres on glass fiber. Specifically, the protein concentration of the monoclonal antibody of the anti-rabies virus antigen coated by the gold-labeled pad is 50 mug/ml; the protein concentration of the monoclonal antibody against the rabies virus antigen coated on the fluorescent pad is 0.01mg-0.05mg/ml, preferably 0.02 mg/ml.

The Immune colloidal gold technology (Immune colloidal gold technology) is a novel Immune labeling technology which applies colloidal gold as a tracer marker to antigen and antibody, has the characteristics of convenient and quick use, reaction completion within 15-20 minutes, convenience for basic level and field use, low cost, stable marker and the like. The fluorescent microsphere is prepared by copolymerizing time-resolved fluorescent dye and styrene. Therefore, the fluorescent microsphere has the advantages of very stable fluorescence intensity, no leakage and dissociation of dye, strong fluorescence signal, small influence of external environment and the like. The distribution of the fluorescent microspheres on the test strip can be acquired by a fluorescence detector, so that a sensitive and stable quantitative detection result is realized, and the fluorescent microspheres are an ideal marker for immunofluorescence quantitative chromatography. The two markers can be used freely according to different clinical conditions.

The protein concentration of the monoclonal antibody of the anti-rabies virus antigen coated by the detection line is

1.0-2.0g/L。

The protein concentration of the quality control line coated staphylococcus aureus protein A is 1.0-2.0 g/L.

The rabies virus antigen is a rabies virus-like particle, and basic assembly elements of the rabies virus antigen comprise rabies virus G protein and rabies virus M protein. Wherein, the amino acid sequence of the G protein is shown as SEQ ID NO.7, and the amino acid sequence of the M protein is shown as SEQ ID NO. 8. The nucleotide sequence of the coding G protein is shown as SEQ ID NO.1, and the nucleotide sequence of the coding M protein is shown as SEQ ID NO. 2. Wherein, the nucleotide sequence of the F primer of the G protein is shown as SEQ ID NO.3, and the nucleotide sequence of the R primer of the G protein is shown as SEQ ID NO. 4. The nucleotide sequence of the F primer of the M protein is shown as SEQ ID NO.5, and the nucleotide sequence of the R primer of the M protein is shown as SEQ ID NO. 5.

The rabies virus antigen is a virus-like particle expressed by rabies virus CTN-1 strain glycoprotein through a Bac-to-Bac baculovirus-Sf 9 insect cell expression system. Specifically, the rabies virus-like particles are constructed and prepared by the following steps:

(1) construction of recombinant baculovirus pFB1-CTNG and pFB1-CTNM plasmids: introducing the genes of the rabies virus CTN-1 strain G and M into an insect cell (Sf9 cell) expression vector pFastBac1(pFB1), transforming escherichia coli DH10Bac competent cells, and extracting positive plasmids, namely recombinant baculovirus pFB1-CTNG and pFB1-CTNM plasmids;

(2) rescue of recombinant baculovirus: transfecting insect cells (Sf9 cells) by using recombinant baculovirus pFB1-CTNG and pFB1-CTNM plasmids, and rescuing to obtain recombinant baculovirus;

(3) preparation of rabies virus-like particles: the obtained recombinant baculoviruses rpFB1-CTNG and rpFB1-CTNM were expressed as MOI ═ 3: 2 proportion co-infecting insect cells, and harvesting supernatant after 4-5 days to obtain the rabies virus-like particles. After cell disruption by a cell homogenizer, virus-like particles are purified by a sucrose density gradient centrifugation method.

The preparation process of the monoclonal antibody against the rabies virus-like particles is as follows:

(1) immunizing Balb/c mice with purified rabies virus-like particles at 0.1mg/ml at 0d, 7d and 21d respectively, and taking spleen cells and myeloma cells of the mice at 6 × 10 when the ELISA titer of the serum of the mice reaches more than 1:10000 ⁷ :1×10 ⁷ Fusing according to the proportion, and screening hybridoma cells by using HAT selective culture medium; respectively selecting specific antigens of the positive clones by using the rabies virus-like particles as sensitive antigens to finally obtain monoclonal cell strains of the anti-rabies virus-like particles;

(2) and (2) precipitating the monoclonal antibody of the rabies virus-like particles prepared in the step (1) by saturated ammonium sulfate, and purifying to prepare the purified monoclonal antibody of the anti-rabies virus-like particles.

When the fluorescent microspheres are adopted to mark the antibody, the preparation method of the rabies virus antibody quantitative detection kit provided by the invention comprises the following steps:

s1, sample pad preparation: preparing and purifying rabies virus antigen, diluting the purified rabies virus antigen to 0.5-2.0mg/ml by using 20mM sodium tetraborate solution containing 2% of Tween-20, and spraying the diluted rabies virus antigen on a glass cellulose membrane to be used as a sample pad;

s2, preparing a marking pad: dispersing the microsphere suspension with solid content of 1% by ultrasonic uniformly, and diluting by 10 times of ultrapure water; respectively adding an N-hydroxysuccinimide solution with the concentration of 50mg/ml and a 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride solution with the concentration of 50mg/ml according to the volume ratio of 1:25, uniformly mixing, and reacting for 0.5 hour at normal temperature; dispersing the reacted suspension evenly, adding the monoclonal antibody of the anti-rabies virus antigen according to the protein concentration of 0.01mg-0.05mg/ml, reacting for 1-2min, then carrying out ultrasonic treatment for 20-40 seconds, and then reacting for 1 hour; adding BSA to a final concentration of 0.50%, and blocking for 1-2 hours; centrifuging at 10000r/min for 15-20min, dissolving in 0.01M boric acid buffer solution containing 1% bovine serum, 4% sucrose, 0.5% casein, and pH 6.0, and spraying on glass fiber to obtain marking pad;

s3, coating a nitrocellulose membrane: detecting 1.0-2.0g/L monoclonal anti-rabies virus antigen coated by the line, wherein the coating solution is PBS containing 3% sucrose and pH7.2; the quality control line is coated with 1.0-2.0g/L SPA, and the coating solution is PBS containing 3% sucrose, and pH7.2;

s4, assembling test paper: a sample one-way chromatography assembly mode is adopted, a sample pad, a mark, a nitrocellulose membrane and a water absorption pad are sequentially stuck from one end to the other end of a back plate, and the back plate is cut into strips, sealed and stored at 4-30 ℃.

When the colloidal gold is adopted to mark the antibody, the preparation method of the rabies virus antibody quantitative detection kit provided by the invention comprises the following steps:

s2, preparing a marking pad: with 0.2mol/L K ₂ CO ₃ After the pH value of the 25-40nm colloidal gold solution is adjusted to 8.4, adding the purified monoclonal antibody of the anti-rabies virus antigen qualified by inspection into the colloidal gold solution according to the protein concentration of 50 mu g/ml, and continuously stirring for 30 minutes; adding 10% BSA to a final concentration of 1%, stirring for 30min, centrifuging at 10000r/min for 30min, sucking supernatant, collecting precipitate which is the primarily purified monoclonal antibody against rabies virus labeled with colloidal gold, and dissolving in a solution containing 3% BSA, 3% sucrose, 0.2% Tween-20 and 0.1% NaN ₃ 20mmol/L Tris-HCl solution, sprayed on glass fiber to be used as a marking pad;

s3, coating the nitrocellulose membrane: detecting 1.0-2.0g/L monoclonal anti-rabies virus antigen coated by the line, wherein the coating solution is PBS containing 3% sucrose and pH7.2; the quality control line is coated with 1.0-2.0g/L SPA, and the coating solution is PBS containing 3% sucrose, and pH7.2;

s4, assembling test paper: the sample one-way chromatography assembly mode is that a sample pad, a marking pad, a nitrocellulose membrane and a water absorption pad are sequentially stuck from one end to the other end of the back plate, and the sample is cut into strips, sealed and stored at 4-30 ℃;

wherein, the rabies virus antigen is a rabies virus-like particle.

The preparation method also comprises the following steps: standard positive sera with titers of 0.125IU, 0.25IU, 0.5IU, 1.0IU, 2IU and 4IU were prepared as standards.

When the fluorescent microspheres are adopted to mark the antibody, the detection method of the rabies virus antibody quantitative detection kit comprises the following steps:

(1) and (3) standard curve preparation: after the standard positive serum with the titer of 0.125IU, 0.25IU, 0.5IU, 1.0IU, 2IU and 4IU is detected, the function relation of y ═ ab + cx is carried out ^d )/(b+x ^d ) Performing four-parameter fitting to determine a detection standard curve, wherein y represents a reaction value, x represents concentration, a represents an asymptote estimated value on the curve, b represents the slope of the curve, c represents the corresponding dose when half of the maximum combination is performed, and d represents an asymptote estimated value under the curve;

(2) uniformly mixing a whole blood or serum sample to be detected and a sample diluent according to the ratio of 1: 50-1: 100v/v, namely if the sample to be detected is whole blood, taking 20 mu L of the sample to be detected, dissolving the sample to be detected in 1ml of the sample diluent, and sufficiently and uniformly mixing; if the sample to be detected is serum, dissolving 10 mu L of the sample to be detected in 1ml of sample diluent, and fully and uniformly mixing to obtain a sample treatment solution to be detected;

(3) taking 50-100 mu L of sample treatment liquid to be detected, adding the sample treatment liquid to a sample pad, standing at room temperature for 10-20 minutes, and judging the result, wherein the result judging method comprises the following steps:

rabies virus antibody positive: putting the test strip into a matched fluorescence detection instrument, wherein a green strip appears at a quality control line, reading a specific numerical value through standard curve comparison, and calculating the ratio of a T/C line, wherein the numerical value is more than or equal to 0.5 IU/ml;

rabies virus antibody negative: putting the test strip into a matched fluorescence detection instrument, respectively generating a green strip at a detection line and a quality control line, comparing through a standard curve, reading a specific numerical value, and calculating the ratio of a T/C line, wherein the numerical value is less than 0.5 IU/ml;

and (4) invalidation: and only the detection line is colored, and no obvious strip appears in the quality control line, so that the test strip is regarded as invalid.

When the colloidal gold is adopted to mark the antibody, the detection method of the rabies virus antibody quantitative detection kit comprises the following steps:

(1) and (3) standard curve preparation: after being detected by standard positive serum with the potency of 0.125IU, 0.25IU, 0.5IU, 1.0IU, 2IU and 4IU, the function formula is that y is ax ^b Performing regression fitting to determine a detection standard curve, wherein y represents an OD value, x represents concentration, a represents intercept, and b represents a regression coefficient;

(3) adding 50-100 mu L of sample treatment liquid to be detected onto a sample pad, standing at room temperature for 10-20 minutes, and judging the result, wherein the result judgment method comprises the following steps:

rabies virus antibody positive: a red strip appears at the position of the quality control line; visually observing the detection line, wherein a weaker line or even no color is generated, putting the test strip into a matched colloidal gold strip reading device, reading a specific numerical value through standard curve comparison, and calculating the ratio of the T/C line, wherein the numerical value is more than or equal to 0.5 IU/ml;

rabies virus antibody negative: a purple red strip appears at each of the detection line and the quality control line; the deeper the detection line is observed by naked eyes, which indicates that the rabies virus antibody is weaker, the test strip is put into a matched colloidal gold strip reading device, a specific value is read through standard curve comparison, and the ratio of the T/C line is calculated, wherein the value is less than 0.5 IU/ml;

Compared with the prior art, the invention has the following beneficial effects:

the rabies virus antibody quantitative detection kit provided by the invention uses the monoclonal antibody of the anti-rabies virus G protein and the neutralizing antibody in blood to compete for antigen during detection, a competition method is adopted to improve the detection sensitivity, the higher the antibody titer is, the lighter the color development is, even the color development is not generated, the lower the antibody titer is, the deeper the color development is, the more important people can be aroused, and meanwhile, by matching with a colloidal gold strip reading device or a fluorescence detection instrument, the real antibody value in a blood sample can be directly displayed according to a standard curve, and the detection accuracy is improved. The adopted marker antigen is rabies virus-like particles expressed by insect cells, is assembled only by G protein and M protein, has no nucleic acid component, and eliminates the biological potential safety hazard generated by adopting a complete virus as the marker antigen. Therefore, the invention provides a practical and effective detection means for rabies virus immune monitoring, and can fill the market blank of rabies virus antibody quantitative detection.

Drawings

In order to more clearly illustrate the embodiments of the present application or technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments described in the present invention, and other drawings can be obtained by those skilled in the art according to the drawings.

FIG. 1 is a top view of a colloidal gold immunochromatographic assay test strip provided in the present invention;

FIG. 2 is an assembly diagram of a colloidal gold immunochromatographic assay test strip provided in the present invention;

FIG. 3 is a diagram of PCR identification of recombinant baculovirus provided in example 1 of the present invention;

FIG. 4 is an indirect immunofluorescence map of rabies vims-like particles as provided in example 1 of the present invention;

FIG. 5 is an electron micrograph of rabies virus-like particles provided in example 1 of the present invention;

FIG. 6 is an SDS-PAGE pattern of rabies virus-like particles provided in example 1 of the present invention;

FIG. 7 is a immunoblot of rabies vims-like particles as provided in example 1 of the invention;

FIG. 8 is a standard curve of the quantitative rabies virus antibody detection kit provided in example 3 of the present invention;

FIG. 9 is a standard curve of the rabies virus antibody quantitative detection kit provided in example 4 of the present invention.

Detailed Description

In order to make those skilled in the art better understand the technical solution of the present invention, the present invention will be further described in detail with reference to the following embodiments. The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the practice are conventional means well known to those skilled in the art, and the starting materials used are commercially available. The donor plasmid pFastBac1 adopted by the invention is purchased from Invitrogen company, and the strains E.coli DH10Bac, the insect cell Sf9 and the rabies virus are provided by Changchun zhuoyi bio-corporation. The rabbit anti-RABV MP serum is self-made by Changchun Xinoco Biotechnology company Limited by the prior method; phusion ultra-fidelity DNA polymerase and T4DNA ligase were purchased from NEB company; restriction enzyme, protein molecule Marker was purchased from Thermo; DH5 alpha competent cell, DNA molecule Marker, BacPAK baculovirus rapid titer detect reagent box purchase from Takara company; the plasmid miniextraction kit, the DNA gel recovery kit and the genome extraction kit are all purchased from Axygen company; cell transfection Reagent cellfection ii Reagent was purchased from Invitrogen corporation; fetal bovine serum was produced by GIBCO.

Example 1 preparation and characterization of rabies Virus-like particles

(1) Extraction of viral genome

Rabies virus CTN-1 is inoculated to vero cells, virus liquid is collected after 2 days of inoculation, according to the BABV CTN-1 strain whole genome sequence information (Accession NO. HQ317918.1) of Genbank, specific amplification G and M gene primers are designed by using Primer5.0 software, and the primer sequences are shown in Table 1.

TABLE 1 rabies virus CTN-1 strain glycoprotein gene G and matrix protein M specific amplification primers

Serial number	Primer name	Sequence (5 '-3')	Cleavage site
				SEQ ID
3	CTNG-F	CCCGAATTCATGATTCCTCAAGCTCTGTTGTTTG	EcoR I
				SEQ ID
4	CTNG-R	TTTCTGCAGTTACAGCTTGGTCTCACCTCCG	Pst I
				SEQ ID
5	CTNM-F	CCCCTCGAGATGAACTTTCTACGCAAGATAGTGA	Xho I
				SEQ ID
6	CTNM-R	CCCGGTACCCTATTCTAGGAGCAGGGAAGAGTC	Kpn I

Underlined is the restriction endonuclease cut site sequence.

(2) Determination of target Gene of CTN-1 Strain

RABV CTN-1 strain virus RNA is extracted, cDNA is obtained through reverse transcription, the cDNA is used as a template, CTNG-F, CTNG-R and CTNM-F, CTNM-R are used as primers, and RABV CTN-1 strain G and M genes are respectively amplified by using super-fidelity DNA polymerase, wherein the sequence of the G gene is shown as SEQ ID NO.1, and the sequence of the M gene is shown as SEQ ID NO. 2. Carrying out double enzyme digestion on the target gene by using Pst I and EcoR I to obtain a G gene to obtain CTNG, and carrying out double enzyme digestion on an M gene by using Xho I and Kpn I to obtain CTNM; vector pFB1 was double-digested with Pst I and EcoR I, Xho I and Kpn I, respectively. The target product CTNG-PE is connected with pFB1-PE, and CTNM-XK is connected with pFB-1-XK respectively. Then transferring the two linked products into DH5 alpha competent cells respectively, selecting positive clones for sequencing analysis and identification.

(3) Construction of recombinant baculovirus expression plasmids BpFB1-CTNG and BpFB1-CTNM

Adding 1 mu L of recombinant plasmid into DH10Bac competent cells melted in an ice bath, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 45s, carrying out ice bath for 2min, adding 1mL of nonresistant LB culture medium, carrying out shake culture at 37 ℃ for 4h, taking 80 mu L of bacterial liquid, coating an LB plate (containing three antibiotics including kanamycin, gentamicin and tetracycline), carrying out culture at 37 ℃ for 48h, selecting white spot colonies, adding LB culture medium (the final concentrations of the three antibiotics including kanamycin, gentamicin and tetracycline are respectively 50 mu g/mL, 7 mu g/mL and 10 mu g/mL), and carrying out shake culture at 37 ℃ and 200rpm/min for 14 h. Recombinant bacmid DNA was extracted by alkaline lysis and named BpFB1-CTNG and BpFB1-CTNM, respectively. Plasmid DNA was extracted and PCR was performed to successfully amplify the G gene (1575bp) and M gene (609bp), the results are shown in FIG. 3, and the target fragment was recovered from the gel.

(4) Rescue and identification of recombinant baculovirus

Sf9 adherent cells were plated in 12-well plates and cultured at 27 ℃ in 10% Fetal Bovine Serum (FBS) TC-100 medium before transfection, and Sf9 cells were transferred to 6-well plates at 2ml/well (1.0X 10) using 1.5% FBS-TC-100 when the cell density reached 80% or more ⁶ cells/well), room temperature 30 min. Putting 8 mul of Cellffectin II Reagent into 100 mul of serum-free culture medium, uniformly mixing, and standing for 30min at room temperature; 1ug of recombinant baculovirus expression plasmids BpFB1-CTNG and BpFB1-CTNM were placed in 100. mu.l of serum-free cell culture medium, mixed uniformly and mixed with the transfection agent-culture medium complex to form recombinant bacmid DNA-lipid complex, cells were cultured in 6-well plates, cultured at 27 ℃, and the supernatant was extracted after 3-5 h to obtain P1 generation recombinant baculovirus, which were named rpFB1-CTNG and rpFB 1-CTNM. And infecting the normally growing Sf9 cells with the rescued P1 baculovirus, culturing for 3-4 days, taking supernatant, extracting DNA, and performing PCR identification by using CTNG-F, CTNG-R and CTNM-F, CTNM-R as primers, wherein the determination results of G gene and M gene sequences in rpFB1-CTNG and rpFB1-CTNM are correct.

(5) Assembly of rabies vims-like particles

Sf9 cells are cultured in a serum-free SF900II culture medium by shaking and suspending at 27 ℃, and are subcultured once in 3-4 days. Adjusting cell density to 2.0X 10 ⁶ cells/ml, after 12h of shake suspension culture at 27 ℃, recombinant baculoviruses rpFB1-CTNG and rpFB1-CTNM were mixed at MOI ═ 3: 2 proportion co-infecting Sf9 cells, after inoculation, shaking and suspending for 4-5 days at 27 ℃, and then collecting cell supernatant.

(6) Indirect immunofluorescence

The recombinant baculovirus is infected with Sf9 cells, cultured at 27 ℃ for 48h, and then the expression condition of the rabies virus-like particles is detected by an indirect immunofluorescence method, as shown in figure 4, a large amount of green fluorescence can be seen, which indicates that the rabies virus-like particles are expressed in a large amount.

(7) Content determination of rabies virus-like particles

And (4) harvesting the Sf9 cell culture solution mixture to obtain the rabies virus-like particles, and naming the rabies virus-like particles as CTNVLP. The titer of the recombinant baculovirus is determined by using a BacPAK baculovirus rapid titer detection kit, and the result shows that the titer of the rabies virus-like particles formed by assembling the recombinant baculovirus infected Sf9 cells reaches 2.3 multiplied by 10 ⁸ IFU/ml。

(8) Purification of rabies vims-like particles

Adding the virus-like particles into a centrifugal tube containing sucrose solution with the concentration of 20%, 30%, 40% and 55% by adopting a sucrose density gradient centrifugation method, centrifuging at 28000rpm for 90min, extracting virus bands with the concentration of between 40% and 55%, centrifuging at 21000rpm for 90min to remove sucrose, dissolving precipitates by using STE (1.7532g of NaCl, 0.05845g of EDTA, 0.24228g of Tris-base, using distilled water for fixing the volume to 200ml, adjusting the pH to 7.5 by using HCl after completely dissolving, and determining the concentration of CTNVLP to be 8.46mg/ml by using a BCA protein concentration kit.

(9) Identification of rabies virus-like particles

A. And identifying the CTNVLP form and size by using an electron microscope. And (3) dropwise adding CTNVLP into a channel special for an electron microscope, dyeing for 3min by using 1% phosphotungstic acid after 10min, and observing the electron microscope, wherein the result is shown in figure 5, and circular or oval rabies VLP with the size of 180-200 nm and obvious fiber protrusions can be observed through the electron microscope.

B、Western Bot

Transferring CTNVLP on a polyvinylidene fluoride membrane (PVDF membrane) after SDS-PAGE electrophoresis, washing the CTNVLP for 1 time by PBS, and sealing the PVDF membrane for 2 hours by a PBS solution containing 5% skimmed milk powder; washing the membrane with PBS for 3 times, adding rabies positive serum national standard substance diluted by 200 times of PBS, and standing overnight at 4 deg.C; washing the membrane with PBS for 3 times, adding horseradish peroxidase-labeled rabbit anti-canine IgG diluted by 10000 times of PBS, and incubating for 1 hour at 37 ℃; PBS wash 3 times; after the color developing solution is added, the band should appear in about 30 minutes, the membrane is washed by deionized water, the reaction is stopped, and the result is shown in figure 6 and figure 7, the GP (A is about 60kDa) and MP (B is about 25kDa) target protein bands can be seen, and after sequencing, the G protein amino acid sequence is shown as SEQ ID NO.7, and the M protein amino acid sequence is shown as SEQ ID NO. 8.

(10) Mouse immunization and challenge experiment

Experimental materials: the experimental animals are selected from commercial 6-8 week-old female BALB/c mice, and the immunogen adopts CTNVLP prepared in example 1. The Baby hamster kidney-21 cell (BHK-21) was passaged and stored by the animal virology and specialty animal epidemics research laboratory of the military veterinary institute of military medical research, military scientific institute. The RABV standard attack strain CVS-11 is passed and stored by animal virology and special animal epidemic disease and disease research laboratories of military veterinary research institute of military medical academy of sciences; the RABV street strain HuNPB3 is separated, identified, passaged and stored by animal virology and special animal epidemic pathology research laboratories of military veterinary research institute of military medical academy of sciences.

The experimental method comprises the following steps: experimental mice were randomly divided into 2 groups, a CTNVLP immunization group and a blank control group, respectively. The mice are injected with hind limb muscle for immunization, and the first immunization is followed by boosting immunization once every two weeks, and the immunization dose is 10 mu g/mouse.

And (3) detecting a neutralizing antibody: collecting blood of eyeball venous plexus at 1, 2, 4 and 6 weeks after first immunization, standing whole blood at 37 deg.C for 1h, standing overnight at 4 deg.C, centrifuging at 5000rpm for 15min at 4 deg.C, carefully sucking out serum, inactivating at 56 deg.C for 30min, packaging, and storing at-20 deg.C for use. The fluorescent antibody virus neutralization assay (FAVN) method was used to detect the titer of VNA in serum. The results showed that after one week of first immunization (week 1) in mice in the CTNVLP immunized group, RABV-specific VNA was detected in the sera of all immunized rabies VLP mice, when the VNA titers were low. Two weeks after the first immunization (week 2), the mean serum VNA titers of mice in the CTNVLP immunization group were 2.11IU/ml, respectively, at which time they received a boost. Two weeks after booster immunization (week 4), the CTNVLP immunized group mice exhibited an enhanced antibody response against RABV with a significant increase in serum VNA titers, respectively to 9.13 IU/ml. The serum VNA titers of the mice in the CTNVLP immunized group remained relatively stable until four weeks after the boost (week 6), with no significant drop. RABV-specific VNA was not detected in serum of placebo mice at all times.

And (3) attacking poison of mice: 6 weeks after prime (boost)Post4 weeks) and the forelimb intramuscular injection of RABV street strain HuNPB3 mouse brain passage toxin, 100 XIMLD ₅₀ A/only. The disease condition of rabies, such as reversed erection of the quilt, mania, hypokinesia, tremor, spasm, paralysis, etc. is observed and recorded within 21 days after the attack of toxin. When the infected mice showed typical rabies symptoms, they were sacrificed by ether anesthesia followed by cervical amputation. The experimental results show that after the challenge, the blank control group mice sequentially show rabies symptoms from the 5 th day after the challenge, paralyzed mice appear and are sacrificed humanely on the 7 th day after the challenge, all mice are sacrificed humanely due to paralysis by the 9 th day, and the survival rate of the mice is 0%. The mice in the CTNVLP immunization group did not show any clinical symptoms of rabies in the 21-day observation period, no death occurred at the end of the observation period, and the survival rate of the mice was 100%.

RABV Glycoprotein (GP) is the only structural protein for stimulating and inducing the body to produce Virus Neutralizing Antibody (VNA), RABV Matrix Protein (MP) determines the synthesis, budding and virus morphology maintenance of RABV, and MP has GP specific binding sites, which influence the conformation of GP on the surface of virus envelope. Therefore, the virus-like particle of the rabies virus prepared by using the CTN-1 strain rabies viruses GP and MP as basic assembly elements for constructing rabis VLP is a hollow particle only containing structural protein G and matrix protein M, circular or oval rabis VLP with obvious fiber process and the size of 180-200 nm can be observed by electron microscope, Western Blot analysis shows that the rabis VLP is composed of GP and MP, does not contain viral nucleic acid, cannot be autonomously replicated, has high safety, can be applied to the fields of antibody detection and the like, is the same or similar to real virus particles in form, displays antigen epitope in a correct conformation and highly repeated form, has good immunogenicity, induces and generates remarkably enhanced RABV specific body fluid and cellular immune reaction in a mouse, and protects immune animals from RABV infection.

Example 2 preparation and characterization of rabies virus G protein monoclonal antibody

(1) 5 female BALB/c mice with the age of 6-8 weeks are selected, and the purified rabies virus G protein virus-like particles and equivalent amount of Freund's complete adjuvant are injected into the miceThe emulsion is prepared, and 200 mu l of the emulsion is injected into each subcutaneous multipoint. Two weeks later, the mice were immunized with the rabies virus G protein virus-like particles and an equivalent amount of Freund's incomplete adjuvant emulsion in the same amount and method as the first immunization. The third immunization is carried out two weeks after the second immunization, and the immunization method and the virus injection amount are the same as the second immunization. After three-free two weeks, selecting serum ELISA titer reaches 1:10000 or more after tail-cutting blood collection, removing splenocytes and myeloma cells by 6 × 10 ⁷ 1X 10 pieces/ml ⁷ Fusing at a ratio of 6: 1; screening hybridoma cells by using HAT selective culture medium; screening hybridoma cells by using a fluorescent antibody virus neutralization assay (FAVN); inoculating the screened positive hybridoma cells into abdominal cavities of female BALB/c mice with the age of 8-10 weeks, wherein each female BALB/c mouse is 1 multiplied by 10 ⁶ And (4) cells. 10 days after inoculation, ascites was aspirated from the mice using a syringe.

(2) Centrifuging the ascites collected in the step (1) for 5 minutes at 2400r/min, collecting supernatant, and sequentially adding NaCl with the final concentration of 0.2mol/L and CaCl with the final concentration of 0.025mol/L ₂ And (3) solution. And (3) filtering by using filter paper, adding 100 times of volume of sterilized purified water, dialyzing the filtrate at 4 ℃ for 8-15 hours, and changing water for 1-2 times. Centrifuging the filtrate at 22000r/min for 30 minutes, and removing the supernatant; resuspend the pellet in 0.1mol/L Tris-HCl solution (pH 8.0) containing 1mol/L NaCl; repeating the dialysis and centrifugation for 1 time; and adjusting the concentration of the precipitated protein to 5-10 mg/ml to obtain the purified monoclonal antibody.

Example 3 preparation of rabies virus antibody quantitative determination kit (colloidal gold)

(1) Preparation of sample pad

The purified rabies virus-like particles prepared in example 1 were diluted to 1.0mg/ml with 20mM sodium tetraborate solution, containing 2% Tween-20, and sprayed on a glass cellulose membrane as a sample pad.

(2) Preparation of marking pad

With 0.2mol/L K ₂ CO ₃ Adjusting the pH value of the 25nm colloidal gold solution to 8.4, adding the purified rabies virus-like particle monoclonal antibody qualified by inspection into the colloidal gold solution under rapid stirring according to the protein concentration of 50 mu g/mlAnd stirring is continued for 30 minutes; adding 10% BSA to the solution until the final concentration is 1%, stirring the solution for 30 minutes, centrifuging the solution for 30 minutes at 10000r/min, carefully sucking the supernatant, and obtaining a precipitate which is the preliminarily purified gold-labeled rabies virus-like particle monoclonal antibody conjugate. The gold-labeled monoclonal antibody preservation solution is a 20mmol/L Tris-HCl solution, and contains 3% BSA, 3% sucrose, 0.2% Tween-20 and 0.1% NaN ₃ . The preservation solution containing the precipitate is sprayed on glass fiber to form a marking pad, and the optimal drying mode of the marking pad is freeze drying at 50 ℃ below zero.

(3) Nitrocellulose membrane coating

The detection line T is coated with 1.0g/L of monoclonal antibody of rabies virus antigen, the coating solution is PBS containing 3% sucrose, pH7.2; the quality control line C is coated with 1.5g/L SPA, and the coating solution is PBS containing 3% sucrose, and pH is 7.2.

(4) Test strip assembly

A sample one-way chromatography assembly mode is adopted, a sample pad 2 coated with rabies virus glycoprotein virus-like particles is sequentially arranged at a detection sample end on a back plate 1, a gold-labeled monoclonal antibody fiber pad corresponding to the rabies virus glycoprotein virus-like particles is adsorbed and is called a mark pad 3 for short, and a nitrocellulose membrane 4 contains a detection line 5 coated with a purified anti-rabies virus antigen monoclonal antibody solution, a quality control line 6 coated with SPA and a water absorption pad 7. The pasting and assembling are carried out according to the sequence of figure 2.

Specifically, the backplate is horizontally located the below of test paper strip, cellulose nitrate membrane pastes in the upper surface middle part of backplate, gold mark pad and water absorption pad paste respectively in the both sides of cellulose nitrate membrane, the gold mark pad is located the one side that is close to the detection line and covers the edge of cellulose nitrate membrane, the water absorption pad is located the one side that is close to the quality control line and covers the edge of cellulose nitrate membrane, the sample pad is located the opposite side of gold mark pad and covers the edge of gold mark pad.

Cutting into strips, sealing, and storing at 4-30 deg.C as shown in FIG. 1.

(5) Preparation of the Diluent

Contains 15mmol/L borax, 0.5% NaCl, 0.2% Tween-20, 0.1% NaN ₃ Aqueous solution adjusted to pH 8.4。

(6) Preparation of standards

The positive serum was diluted with diluent to standard with titers of 0.125IU, 0.25IU, 0.5IU, 1.0IU, 2IU and 4 IU.

Example 4 preparation of quantitative detection kit (fluorescent microsphere) for rabies virus antibody

The other steps are the same as example 3, except that the monoclonal antibody in step (2) is labeled with a fluorescent microsphere, the fluorescent microsphere is a fluorescent mismatch polystyrene microsphere containing rare earth europium element, the functional groups are carboxyl group and sulfonic group (carboxyl group content: 90umol/g), the refractive index is 1.59@589nm (25 ℃), and the density is 1.05g/cm ³ The average particle diameter: 200nm, solid content of 1% (10 mg microspheres in 1ml of suspension), fluorescence excitation wavelength of 360-365nm and emission wavelength of 610 nm.

The specific method comprises the following steps:

(1) activation of fluorescent microspheres

Firstly, ultrasonically dispersing purchased microsphere suspension (Bangs laboratories lnc., 1%, 0.196 mu m) by using an ultrasonic cleaner, and shaking up by hand, wherein the ultrasonic time is about 1min, so that the microspheres are uniformly dispersed;

100ul of microsphere suspension with solid content of 1% (same as above) was diluted 10 times with ultrapure water, i.e., 1000ul, and added into an EP tube;

weighing 50mg of N-hydroxysuccinimide (NHS) and dissolving the N-hydroxysuccinimide with 30-60% of ethanol to prepare a solution (solution A) with the concentration of 50 mg/ml;

weighing 50mg of 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) and dissolving the 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) with 30-60% ethanol to prepare a solution (solution B) with the concentration of 50 mg/ml;

40ul of the solution A is added into 1000ul of the microsphere suspension liquid and mixed evenly, then 40ul of the solution B is added into the microsphere suspension liquid and mixed evenly, and the reaction is carried out for 0.5 hour at normal temperature.

Ultrasonically treating the suspension after reaction (60HZ for 15-45min) by using ultrasonic waves to enable the microspheres on the tube wall to be re-suspended in the aqueous solution, and then centrifuging the microsphere suspension under the centrifugation conditions of 10000r/min and 20 min;

and (3) pouring out the supernatant, adding 1ml of ultrapure water, and then uniformly dispersing by using ultrasonic wave, otherwise, the microspheres after crosslinking the antibody are agglomerated, and the microspheres have poor running strips.

(2) Activated microsphere-labeled antibodies

Taking 1ml of activated microsphere suspension (solid content is 0.1%), performing ultrasonic dispersion uniformly, and then dropwise adding an antibody with the concentration of 0.01-0.05 mg/ml while stirring, wherein the optimal mark amount is generally 0.02 mg/ml;

after the antibody is added, the reaction lasts for about 1-2min, ultrasonic treatment is carried out on the mixture for about 30 seconds, and then the reaction lasts for 1 hour;

adding BSA (final concentration of 0.50%) for blocking for 1-2 hr;

centrifuging the sealed microspheres at the speed of 10000r/min for 15 min;

adding preservation solution (bovine serum 1%, sucrose 4%, casein 0.5%, 0.01M boric acid buffer solution, adjusting pH to 6.0) into the centrifuged microspheres to uniformly disperse the microspheres, spraying on glass fiber, and using as a marking pad, wherein the optimal drying mode of the marking pad is freeze drying at-50 ℃.

Example 5 comparison of the rabies virus antibody quantitative detection kit of the present invention with the fluorescent antibody virus neutralization assay (FAVN)

The rabies virus antibody quantitative detection kits prepared in the example 3 and the example 4 are respectively used, after the serum is detected by standard positive serum (from Chinese veterinary medicine inspection institute) with the titer of 0.125IU, 0.25IU, 0.5IU, 1.0IU, 2IU and 4IU, the serum is respectively passed through the functional relation of y ═ ax ^b (where y represents the reaction value, x represents the concentration, a represents the intercept, and b represents the regression coefficient) and the functional relationship y ═ ab + cx ^d )/(b+x ^d ) (where y represents the OD, x represents the concentration, a represents the estimate of the asymptote on the curve, b represents the slope of the curve, c represents the dose corresponding to half maximal binding, and d represents the estimate of the asymptote under the curve.) A regression fit and a four parameter fit were performed to determine a test standard curve, which may be stored in two-dimensional code or u-disk format as described in FIGS. 8 and 9.

By adopting an international standard method for detecting the titer of the neutralizing antibody in serum, namely a fluorescent antibody virus neutralization test method, and the kit prepared in the embodiment 3 and the embodiment 4, 50 parts of canine serum samples, 5 parts of canine rabies virus antibody negative serum, 2 parts of canine distemper virus antibody positive serum, 2 parts of canine parvovirus antibody positive serum, 2 parts of canine adenovirus antibody positive serum and canine parvovirus antibody positive reference serum (19.2IU) with different dilutions are detected at the same time, and the detection results are shown in Table 2.

TABLE 2 comparison of the test results of the kit of the invention and FAVN

The kit disclosed by the invention can be used for competing antigen by using the monoclonal antibody of the anti-rabies virus G protein and the neutralizing antibody in blood, and can be matched with colloidal gold strip reading equipment or a fluorescence detection instrument to directly display the real antibody value in a blood sample according to a standard curve, so that the detection accuracy and sensitivity are improved. The method is highly consistent with the detection result of the international standard method, and has higher safety and better practicability. Meanwhile, a serum-free culture medium is adopted during insect cell culture, so that bovine serum interference is removed, false positive is avoided, and the specificity is good. And the marked antigen adopted by the virus-like particle is rabies virus-like particles expressed by insect cells, is assembled by G protein and M protein only, has no nucleic acid component, and eliminates the potential biological safety hazard generated by adopting whole virus as the marked antigen.

While certain exemplary embodiments of the present invention have been described above by way of illustration only, it will be apparent to those of ordinary skill in the art that the described embodiments may be modified in various different ways without departing from the spirit and scope of the invention. Accordingly, the description is illustrative in nature and is not to be construed as limiting the scope of the invention as claimed.

Sequence listing

<110> Changchun Cinobo Biotechnology Ltd

<120> rabies virus antibody quantitative detection kit, and preparation method and detection method thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1575

<212> DNA

<213> Rabies virus

<400> 1

atgattcctc aagctctgtt gtttgtacct cttctggttt ttccattgtg tttcgggaaa 60

ttccccattt acacgatacc agacaaactc ggcccctgga gtcccatcga tatacatcac 120

ctcagctgtc cgaacaatct ggttgtggag gacgaaggat gtaccaatct gtcaggattc 180

tcatacatgg agcttaaagt aggatatatt tcggccataa aggtgaacgg gttcacttgt 240

acgggtgtgg taacggaagc agaaacctac actaactttg tcggttatgt caccaccacg 300

tttaagagaa agcacttccg accaacaccg gatgcatgca gatcagcata caattggaag 360

atggcaggtg accccagata tgaagagtct ctgcacaatc cctatcctga ttatcattgg 420

ctccggactg taaaaaccac caaagagtct gttgttatca tatctccaag tgtggcagac 480

ttagacccgt acgataaatc acttcattcg agagtttttc ctagaggaaa atgctcagga 540

ataacggtgt cttctgccta ctgctctacc aaccatgatt ataccatctg gatgcctgaa 600

aatcctagac tggggacctc ttgtgatatt ttcaccaaca gcagagggaa gagagcatcc 660

aaagggagca agacctgtgg atttgtggat gagagaggct tgtacaaatc tctaaaagga 720

gcatgcaaac tgaagctgtg tggagttctt ggacttaggc ttatggacgg aacctgggtc 780

gcgattcaga catcaaacga gaccaagtgg tgccctcctg atcaactagt gaatctacat 840

gactttcatt cagatgagat tgaacatctt gttgtggagg agttggttaa gaagagggag 900

gagtgtctag atgcactgga gtccatcatg accaccaagt ccgtgagttt cagacgtctc 960

agtcacttga ggaagcttgt gcctggattt ggaaaagcat acaccatatt caacaagacc 1020

ttaatggagg ctgatgctca ctacaaatcg gtccgaactt ggaatgagat catcccctcg 1080

aaagggtgtt taagagtcgg ggggagatgt catcctcatg tgaacggagt atttttcaat 1140

ggtatcatcc taggccctga cggccatgtc ttaatcccgg aaatgcagtc atccctcctc 1200

cagcagcata tggagttgtt ggaatcctcg gtcatcccct taatgcatcc cttggcagat 1260

ccatcaacgg tttttaaaga tggtgacgag gtggaggatt ttgttgaggt tcaccttcca 1320

gatgtgcata agcaggtctc aggggttgat ctcggtctcc caaactgggg gaaggatgtg 1380

ttgatgggcg caggcgtttt gacggcactg atgttgatga ttttcctaat gacgtgttgc 1440

cgaaggacta atagagcaga atcaatacaa cacagtcttg gagagacagg gaggaaagtg 1500

tcggtgacct cccaaagcgg gagggtcata tcttcatggg agtcatataa aagcggaggt 1560

gagaccaagc tgtaa 1575

<210> 2

<211> 609

<212> DNA

<213> Rabies virus

<400> 2

atgaactttc tacgcaagat agtgaaaaac tgtagggatg aggacaccca gaagcccccc 60

cctgtatcgg ctcctccaga tgatgatgac ttgtggctgc cccctcctga atatgtcccg 120

ctgaaagaac tcacgggcaa gaagaacatg aggaacttct gcatcaatgg tgaggtcaag 180

gtgtgcagtc caaacggcta ttcattcagg atcttacggc atattctaag atcatttgat 240

gagatatatt ctggaaatca cagaatgatt ggattagtca aggtagtcat tgggcttgct 300

ttatcagggg ctccggtccc tgagggcatg aactgggtgt acaaattgag gagaactctt 360

atcttccaat gggctgattc tagaggtccc ctcgaggggg aggagttaga gtactctcaa 420

gagatcacct gggatgacga tactgagttt gtcggattgc agataagagt gagtgcaaga 480

caatgtcata tccagggtag ggtatggtgt atcaacatga attctagaac atgtcaacta 540

tggtctgaca tgtctcttca gacacaaagg tcggaggagg acaaggactc ttccctgctc 600

ctagaatag 609

<210> 3

<211> 34

<212> DNA

<213> Rabies virus

<400> 3

cccgaattca tgattcctca agctctgttg tttg 34

<210> 4

<211> 31

<212> DNA

<213> Rabies virus

<400> 4

tttctgcagt tacagcttgg tctcacctcc g 31

<210> 5

<211> 34

<212> DNA

<213> Rabies virus

<400> 5

cccctcgaga tgaactttct acgcaagata gtga 34

<210> 6

<211> 33

<212> DNA

<213> Rabies virus

<400> 6

cccggtaccc tattctagga gcagggaaga gtc 33

<210> 7

<211> 524

<212> PRT

<213> Rabies virus

<400> 7

Met Ile Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu

1 5 10 15

Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp Lys Leu Gly Pro

20 25 30

Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val

35 40 45

Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu

50 55 60

Leu Lys Val Gly Tyr Ile Ser Ala Ile Lys Val Asn Gly Phe Thr Cys

65 70 75 80

Thr Gly Val Val Lys Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr

85 90 95

Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala

100 105 110

Cys Arg Ser Ala Tyr Asn Trp Thr Met Ala Gly Asp Pro Arg Tyr Glu

115 120 125

Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr His Trp Leu Arg Asn Val

130 135 140

Lys Thr Thr Lys Glu Ser Val Val Ile Ile Ser Pro Ser Val Ala Asp

145 150 155 160

Leu Asp Pro Tyr Asp Lys Ser Leu His Ser Arg Val Phe Pro Arg Gly

165 170 175

Lys Cys Ser Gly Ile Thr Val Ser Ser Ala Tyr Cys Ser Thr Asn His

180 185 190

Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Thr Ser Trp

195 200 205

Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Lys

210 215 220

Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly

225 230 235 240

Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp

245 250 255

Gly Thr Trp Val Ala Ile Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro

260 265 270

Pro Asp Gln Leu Val Asn Leu His Asp Phe His Pro Asp Glu Ile Glu

275 280 285

His Leu Val Val Glu Glu Leu Val Lys Lys Arg Glu Glu Cys Leu Asp

290 295 300

Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Pro

305 310 315 320

Arg His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile

325 330 335

Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg

340 345 350

Thr Trp Asn Glu Ile Ile Pro Ser Lys Gly Cys Leu Arg Val Gly Gly

355 360 365

Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Ile

370 375 380

Gly Pro Asp Gly His Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu

385 390 395 400

Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Met His

405 410 415

Pro Leu Ala Asp Pro Ser Thr Val Phe Asn Asp Gly Asp Glu Val Glu

420 425 430

Asp Phe Val Glu Val His Leu Pro Asp Val His Lys Gln Val Ser Gly

435 440 445

Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Asp Val Leu Met Gly Ala

450 455 460

Gly Val Phe Thr Ala Leu Met Leu Met Ile Phe Leu Met Thr Cys Cys

465 470 475 480

Arg Arg Thr Asn Arg Ala Glu Ser Ile Gln His Ser Leu Gly Glu Thr

485 490 495

Gly Arg Lys Val Ser Val Thr Ser Lys Ser Gly Arg Val Ile Ser Ser

500 505 510

Trp Glu Ser Tyr Lys Ser Gly Gly Glu Thr Lys Leu

515 520

<210> 8

<211> 202

<212> PRT

<213> Rabies virus

<400> 8

Met Asn Phe Leu Arg Lys Ile Val Lys Asn Cys Arg Asp Glu Asp Thr

1 5 10 15

Gln Lys Pro Pro Pro Val Ser Ala Pro Pro Asp Asp Asp Asp Leu Cys

20 25 30

Leu Pro Pro Pro Glu Tyr Val Pro Leu Lys Glu Leu Thr Gly Asn Lys

35 40 45

Asn Met Arg Asn Phe Cys Ile Asn Gly Glu Val Lys Val Cys Ser Pro

50 55 60

Lys Gly Tyr Ser Phe Arg Ile Leu Arg His Ile Leu Arg Ser Phe Asp

65 70 75 80

Glu Ile Tyr Ser Gly Asn His Ser Met Ile Gly Leu Val Lys Val Val

85 90 95

Ile Gly Leu Ala Leu Ser Gly Ala Pro Val Pro Glu Gly Met Asn Trp

100 105 110

Val Tyr Lys Phe Arg Arg Thr Leu Ile Phe Gln Trp Ala Asp Ser Arg

115 120 125

Gly Pro Leu Asp Gly Glu Glu Leu Glu Tyr Ser Gln Glu Ile Thr Trp

130 135 140

Asp Asp Asp Thr Glu Leu Val Gly Leu Gln Ile Arg Val Ser Ala Arg

145 150 155 160

Gln Cys His Ile Gln Gly Arg Val Trp Cys Ile Lys Met Asn Ser Arg

165 170 175

Thr Cys Gln Leu Trp Ser Asp Met Ser Leu Pro Thr Gln Arg Ser Glu

180 185 190

Glu Asp Lys Asp Ser Ser Leu Leu Leu Glu

195 200

Claims

1. A rabies virus antibody quantitative determination kit comprises an immunochromatography detection test strip and a sample diluent;

the immunochromatography detection test strip comprises from one end to the other end in sequence: a sample pad coated with rabies virus antigen, a labeling pad coated with monoclonal antibody against rabies virus antigen, a nitrocellulose membrane coated with a detection line and a quality control line, and a water absorption pad, which are mutually overlapped and attached to the upper surface of the back plate; it is characterized in that the preparation method is characterized in that,

the rabies virus antigen coated by the sample pad is rabies virus-like particles, basic assembly elements of the rabies virus-like particles comprise rabies virus G protein and rabies virus M protein, wherein a nucleotide sequence for coding the G protein is shown as SEQ ID NO.1, a nucleotide sequence for coding the M protein is shown as SEQ ID NO.2, the rabies virus antigen is virus-like particles expressed by rabies virus CTN-1 strain glycoprotein through a Bac-to-Bac baculovirus-Sf 9 insect cell expression system, and the protein concentration of the rabies virus antigen coated by the sample pad is 0.5-2.0G/L;

the detection line is coated with the monoclonal antibody of the anti-rabies virus antigen, and the protein concentration of the monoclonal antibody of the anti-rabies virus antigen coated by the detection line is 1.0-2.0 g/L;

the quality control line is coated with staphylococcus aureus protein A, and the protein concentration of the staphylococcus aureus protein A coated with the quality control line is 1.0-2.0 g/L;

the monoclonal antibody of the rabies virus antigen coated by the marking pad is marked by colloidal gold or fluorescent microspheres; the protein concentration of the monoclonal antibody of the anti-rabies virus antigen coated by the gold-labeled pad is 50 mug/ml, and the protein concentration of the monoclonal antibody of the anti-rabies virus antigen coated by the fluorescent pad is 0.01mg-0.05 mg/ml;

the sample diluent contains 10-20mmol/L borax, 0.2-6% NaCl, 0.1-0.5% Tween-20, 0.1-0.5% NaN ₃ A solution with a pH value of 8.2-8.6;

the kit is prepared by the following steps:

s2, preparing a marking pad: dispersing the microsphere suspension with solid content of 1% by ultrasonic uniformly, and diluting by 10 times of ultrapure water; respectively adding an N-hydroxysuccinimide solution with the concentration of 50mg/ml and a 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride solution with the concentration of 50mg/ml according to the volume ratio of 1:25, uniformly mixing, and reacting for 0.5 hour at normal temperature; dispersing the reacted suspension evenly, adding the monoclonal antibody of the anti-rabies virus antigen according to the protein concentration of 0.01mg-0.05mg/ml, reacting for 1-2min, then carrying out ultrasonic treatment for 20-40 seconds, and then reacting for 1 hour; adding BSA to a final concentration of 0.50%, and blocking for 1-2 hours; centrifuging at 10000r/min for 15-20min, dissolving in 0.01M boric acid buffer solution containing 1% bovine serum, 4% sucrose, 0.5% casein, and pH 6.0, and spraying on glass fiber to obtain a marking pad; alternatively, 0.2mol/L K is used ₂ CO ₃ After the pH value of the colloidal gold solution of 25-40nm is adjusted to 8.4, adding the monoclonal antibody of the anti-rabies virus antigen into the colloidal gold solution according to the protein concentration of 50 mu g/ml, and continuously stirring for 30 minutes; adding 10% of BSA is added to the concentration of 1 percent, the mixture is stirred for 30 minutes, the mixture is centrifuged for 30 minutes at 10000r/min, supernatant fluid is absorbed, and precipitate which is the preliminarily purified monoclonal antibody of the colloidal gold marked rabies virus antigen is dissolved in the mixture containing 3 percent BSA, 3 percent sucrose, 0.2 percent Tween-20 and 0.1 percent NaN ₃ 20mmol/L Tris-HCl solution, spraying on glass fiber as a marking pad;

s3, coating the nitrocellulose membrane: detecting line coated 1.0-2.0g/L rabies virus antigen resisting monoclonal antibody, coating liquid is 3% sucrose-containing PBS, pH7.2; the quality control line is coated with 1.0-2.0g/L SPA, and the coating solution is PBS containing 3% sucrose, and has pH of 7.2;

s4, assembling test paper: a sample one-way chromatography assembly mode is adopted, a sample pad, a marking pad, a nitrocellulose membrane and a water absorption pad are sequentially stuck from one end to the other end of a back plate, and the back plate is cut into strips, sealed and stored at 4-30 ℃.

2. The method for preparing the rabies virus antibody quantitative detection kit according to claim 1, comprising the following steps:

s4, assembling test paper: a sample one-way chromatography assembly mode is adopted, a sample pad, a marking pad, a nitrocellulose membrane and a water absorption pad are sequentially stuck to one end to the other end of a back plate, and the back plate is cut into strips, sealed and stored at 4-30 ℃.

3. The method for preparing the rabies virus antibody quantitative detection kit according to claim 1, characterized by comprising the following steps:

s1, sample pad preparation: preparing and purifying rabies virus antigen, diluting the purified rabies virus antigen to 0.5-2.0mg/ml by using 20mM sodium tetraborate solution containing 2% Tween-20, and spraying the diluted rabies virus antigen on a glass cellulose membrane to be used as a sample pad;

s2, preparing a marking pad: with 0.2mol/L K ₂ CO ₃ After the pH value of the colloidal gold solution with the particle size of 25-40nm is adjusted to 8.4, adding the monoclonal antibody of the rabies virus antigen into the colloidal gold solution according to the protein concentration of 50 mu g/ml, and continuously stirring for 30 minutes; adding 10% BSA to a final concentration of 1%, stirring for 30min, centrifuging at 10000r/min for 30min, sucking supernatant, collecting precipitate which is the primarily purified monoclonal antibody against rabies virus labeled with colloidal gold, and dissolving in a solution containing 3% BSA, 3% sucrose, 0.2% Tween-20 and 0.1% NaN ₃ 20mmol/L Tris-HCl solution, spraying on glass fiber as a marking pad;