CN109988760B - mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof - Google Patents

Abstract

The invention discloses mRNAi for inhibiting the proliferation and invasion activity of liver cancer cells, a vector, a lentivirus and a pharmaceutical composition containing the mRNAi sequence, and application of the mRNAi in preparation of liver cancer treatment drugs. The mRNAi sequence can effectively inhibit the expression of PPP2R3A gene. After the PPP2R3A gene in the liver cancer cell is interfered by the mRNAi sequence, the cell proliferation capacity, the migration capacity and the invasiveness are obviously reduced, and the apoptosis occurs, thereby showing the application prospect of the gene in the preparation of liver cancer treatment drugs.

Description

mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof

Technical Field

The invention discloses an mRNAi sequence, and particularly discloses an mRNAi sequence capable of inhibiting the proliferation and invasion activity of liver cancer cells.

Background

The incidence of Hepatocellular carcinoma (HCC, liver cancer for short) in China is the first global. According to statistics, the number of liver cancer attacks is about 70 thousands of people every year, China accounts for 1055%, and the death rate accounts for 45% of the whole world. Because liver cancer patients in China are in middle and late stages during treatment and are mostly accompanied by liver cirrhosis, the surgical resection rate is less than 30 percent, and the postoperative recurrence rate is as high as 70 percent. The curative effects of chemotherapy and radiotherapy are poor, the effective rate of the existing targeting drugs is low, and no effective drug for treating liver cancer exists at present. Research and development of anti-liver cancer drugs are the current global research hotspots.

The PPP2R3A gene is a newly discovered gene related to tumorigenesis. The protein expressed by PPP2R3A gene belongs to a regulation subunit B of protein phosphatase 2(PP2A), forms heterotrimer with a structural subunit A and a catalytic subunit C to jointly form protein phosphatase 2 holoenzyme, and PP2A belongs to serine/threonine phosphatase and participates in negative regulation of cell growth and division. The B subunit is encoded by a diverse group of genes, including the B/PR55, B'/PR61, and B "/PR 72 families, with different regulatory subunits determining the substrate specificity and intracellular localization of the holoenzyme. The product of the PPP2R3A gene belongs to the B "family, which is further divided into different subfamilies, and the product of this gene belongs to the alpha subfamily of the B" regulatory subunit. Alternative splicing results in the production of multiple splice variants, which may encode different isoforms.

The Ser/Thr protein phosphatase can be divided into two types of PP1 and PP2 according to the influence of inhibiting factors and the difference of catalytic substrate specificity, and PP2 is further divided into PP2A, PP2B and PP2C according to the difference of the dependence of the inhibitor on divalent metal ions. In addition, PP1, PP2A and PP2C have a wide substrate action range, while PP2B is relatively narrow. PP1, PP2A and PP2B belong to protein phosphatase PPP family, are important Ser/Thr protein phosphatase components in vivo, and regulate various life processes in vivo, including muscle contraction, cell cycle, cell growth and the like.

There are studies showing that a mechanism of calcium ion regulation of serine/threonine phosphatase activity exists inside cells. The B'/PR 72 subunit is accessible via Ca²⁺Dependent regulatory protein phosphatase 2A dephosphorylates DARPP-32/Thr-75 sites. Dopamine and cAMP regulated phosphoprotein (DARPP-32, 32kD) is a unique protein with double functions, and is an inhibitor of both phosphatase (such as PP-1) and protein kinase (such as PKA), namely DARPP-32 plays a role in bidirectional regulation of protein phosphorylation and dephosphorylation processes through self-phosphorylation at different sites.

The PR70 subunit of PP2A regulates Cdc6(cell division control protein 6) through the calcium ion-dependent characteristic, and the existence of PP2A (containing PR70) is favorable for the normal exertion of Cdc6 protein function; and PR70 was also found to promote the conversion of the G1 phase to the S phase of the cell cycle. The Cdc6 protein is crucial to complete pre-RC assembly, and inhibition of Cdc6 can block DNA synthesis; however, the overexpression of Cdc6 can cause repeated DNA replication in a cell division cycle, and Cdc6 in tumor cells is high and plays an important role in malignant proliferation of the tumor cells. Research shows that the chromosome 3NotI gene chip is used for detecting epigenetic inactivation genes in the ALL of the acute lymphatic leukemia of children. PPP2R3A (protein kinase 2, regulatory subunit B) was found to be frequently methylated in childhood ALL. The PR70 subunit of PP2A regulates Cdc6(cell division control protein 6) through the calcium ion-dependent characteristic, and the existence of PP2A (containing PR70) is favorable for the normal exertion of Cdc6 protein function; and PR70 was also found to promote the conversion of the G1 phase to the S phase of the cell cycle. The Cdc6 protein is crucial to complete pre-RC assembly, and inhibition of Cdc6 can block DNA synthesis; however, the overexpression of Cdc6 can cause repeated DNA replication in a cell division cycle, and Cdc6 in tumor cells is high and plays an important role in malignant proliferation of the tumor cells. PR72/PR130(PPP2R3A) and Nkd (Naked cuticle, Naked cornea homologous protein) protein are both inhibitors of wnt signal pathway, and have interaction in the process of exerting inhibition effect. Wnt signaling plays a crucial role in early development of animal embryos, organogenesis, tissue regeneration and other physiological processes. If this signaling pathway is abnormally activated, it is possible to induce cancer.

Although PPP2R3A plays an important role in tumorigenesis, the correlation between PPP2R3A and liver cancer and the influence of the correlation on the proliferation and invasion activity of liver cancer cells are not reported at present. In view of the high morbidity and mortality of liver cancer in China, the current effective treatment and prevention means are very limited, so that the invention aims to research the correlation between PPP2R3A and liver cancer, provide an mRNAi sequence capable of inhibiting the proliferation and invasion activity of liver cancer cells, and further provide the effect of the mRNAi sequence in preparing liver cancer drugs.

Disclosure of Invention

Based on the above purpose, the invention firstly discloses an mRNAi for inhibiting the proliferation and invasion activity of hepatoma carcinoma cells, wherein the mRNAi is a DNA double strand, and the sequences of a sense strand and an antisense strand of the mRNAi are shown as SEQ ID NO.1 and SEQ ID NO.2, or as SEQ ID NO.3 and SEQ ID NO.4, or as SEQ ID NO.5 and SEQ ID NO.6, or as SEQ ID NO.7 and SEQ ID NO. 8.

The invention also discloses a vector containing the mRNAi.

In a preferred embodiment, the vector is LV3 vector.

The invention also discloses a packaging cell containing the vector.

In a preferred embodiment, the cell is a 293T cell.

The invention also discloses a lentivirus containing the mRNAi.

The invention also discloses a pharmaceutical composition containing the mRNAi.

The invention also discloses application of the mRNAi in preparation of a tumor treatment drug.

In a preferred technical scheme, the tumor treatment drug is a liver tumor treatment drug.

Finally, the invention discloses a packaging method of the lentivirus, which comprises the following steps:

(1) cloning the mrrnai into LV3 vector;

(2) transfecting the vector obtained in the step (1) and a packaging helper plasmid into 293T cells;

(3) culturing the cells obtained in step (3);

(4) cell supernatant culture was collected and concentrated to obtain packaged lentiviruses.

The mRNAi sequence provided by the invention can specifically interfere the expression of PPP2R3A gene, and the PPP2R3A gene in the HEPG2 cell of the liver cancer cell is infected by the mRNAi sequence, so that the cell proliferation capacity, the migration capacity and the invasiveness are obviously reduced, and the apoptosis occurs, thereby showing the application prospect of the mRNAi sequence in the preparation of tumor treatment medicines, especially liver cancer treatment medicines.

Drawings

FIG. 1 is a schematic view of the structure of LV3 vector;

FIG. 2 shows an electrophoretogram of total RNA of HEPG2 cells;

FIG. 3 is an electropherogram of Real-time PCR amplification products;

FIG. 4 is a histogram of expression of PPP2R3A after disruption relative to hACTB;

FIG. 5 is a histogram of apoptotic effects due to mRNAi;

FIG. 6 is a graph of the effect of mRNAi on cell proliferation;

FIG. 7 is a bar graph of the effect of mNiRNA on the ability of cells to migrate;

FIG. 8 is a bar graph of the effect of mNiRNA on cell invasiveness.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1: preparation and screening of mRNAi

1. Target Gene selection and MRNAi design

A total of 4 target sequences to be interfered with were selected for the PPP2R3A gene, and the information is shown in Table 1.

TABLE 14 target sequences and one negative control sequence for PPP2R3A

Numbering	Name of Gene	Target sequence (5 '-3')
			6328	PPP2R3A-630	GGATTTCATCCCTCTACTTCA
6331	PPP2R3A-1224	GCCCTTGCCATTCCATGATTT
			6332	PPP2R3A-1316	GCAGAATGGCTCACATCTTCT
6333	PPP2R3A-1356	GGAGAAATACTTAGACCATGA
				shNC	TTCTCCGAACGTGTCACGT

shNC as negative control sequence

2. MRNAi sequence design and synthesis aiming at the 4 target point sequences

The DNA oligo was designed using Designer3.0 (Genephrma) software, and the DNA oligo was synthesized using a conventional gene synthesis technique.

The design principle is as follows: TTCAAGAGAGA is selected as the loop structure in the LV3-shRNA template to avoid the formation of a termination signal. GATCC is added at the 5' end of the sense strand template and is complementary with a sticky end formed after BamHI enzyme digestion; AATTC is added at the 5' end of the antisense strand template and is complementary with a sticky end formed after EcoRI enzyme digestion.

Sense connecting: 5 '-GATCC- (GN18) - (TTCAAGAGAGA) - (N18C) -TTTTTTG-3'

Antisense strand 3 '-G (CN18) - (AAGTTCTCT) - (N18G) -AAAAAACTTAA-5'

Wherein G represents guanine, C represents cytosine, GN18 and CN18 represent inserted interference fragments, and N18C and N18G represent reverse complementary connection of GN 18.

Taking the DNA oligo design against target sequence 6328 as an example:

sense strand (SEQ ID NO. 1):

GATCCGGATTTCATCCCTCTACTTCATTCAAGAGATGAAGTAGAGG GATGAAATCCTTTTTTG

antisense strand (SEQ ID NO.2):

AATTCAAAAAAGGATTTCATCCCTCTACTTCATCTCTTGAATGAAG TAGAGGGATGAAATCCG

transcribed mrrnai sequences:

GGATTTCATCCCTCTACTTCATTCAAGAGATGAAGTAGAGGGATGA AATCCTT

the DNA oligos for the other target sequences are designed sequentially as:

DNA oligo for target sequence 6331:

sense strand (SEQ ID NO. 3):

GATCCGCCCTTGCCATTCCATGATTTCAAGAGAATCATGGAATGGC AAGGGCTTTTTTG

antisense strand (SEQ ID NO.4):

AATTCAAAAAAGCCCTTGCCATTCCATGATTCTCTTGAAATCATGG AATGGCAAGGGCG

transcribed mrrnai sequences:

GCCCTTGCCATTCCATGATTTCAAGAGAATCATGGAATGGCAAGG GCTT

DNA oligo for target sequence 6332:

sense strand (SEQ ID NO. 5):

GATCCGCAGAATGGCTCACATCTTCTTTCAAGAGAAGAAGATGTG AGCCATTCTGCTTTTTTG

antisense strand (SEQ ID NO.6):

AATTCAAAAAAGCAGAATGGCTCACATCTTCTTCTCTTGAAAGAA GATGTGAGCCATTCTGCG

transcribed mrrnai sequences:

GCAGAATGGCTCACATCTTCTTTCAAGAGAAGAAGATGTGAGCCA TTCTGCTT

DNA oligo for target sequence 6333:

sense strand (SEQ ID NO. 7):

GATCCGGAGAAATACTTAGACCATGATTCAAGAGATCATGGTCTA AGTATTTCTCCTTTTTTG

antisense strand (SEQ ID NO.8):

AATTCAAAAAAGGAGAAATACTTAGACCATGATCTCTTGAATCAT GGTCTAAGTATTTCTCCG

transcribed mrrnai sequences:

GGAGAAATACTTAGACCATGATTCAAGAGATCATGGTCTAAGTAT TTCTCCTT

DNA oligo against negative control target sequence shNC:

sense strand (SEQ ID NO.9):

GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTT CGGAGAACTTTTTTG

antisense strand (SEQ ID NO.10):

AATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGA CACGTTCGGAGAACG

transcribed mrrnai sequences:

GTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGA GAACTT

annealing of LV3-shDNA template

The DNA oligos were dissolved in TE (pH8.0) at a concentration of 100uM, respectively. Taking corresponding sense strand and antisense strand oligo solutions, and annealing on a PCR instrument according to the following procedures: 5min at 95 ℃; 5min at 85 ℃; 5min at 75 ℃; 5min at 70 ℃; storing at 4 ℃. After annealing treatment, the shRNA template with the concentration of 10 mu M is obtained. The resulting template solution was diluted 50-fold to a final concentration of 200nM and used for ligation reactions.

Linearization of LV3 vector

According to 2 XBuffer Tango 10ul, BamHI and EcoRI5 each 5ul, LV3 vector 10ug, ddH₂The O was supplemented to 100ul for digestion (see FIG. 1 for schematic structure of LV3 vector).

Construction of LV3-shRNA vector

According to 10 XT₄Ligation Buffer 2ul, LV3(BamHI + EcoRI)1ul, shDNA template (100nM)1ul, T4DNA ligase (5weissU/ul)1ul, ddH₂The system of O15ul was used to perform the ligation of the support.

6. Preparation of competent cells E.coli DH5 α: (calcium chloride method) reference for preparation of competent cells: molecular cloning guidelines second edition, page 55, Seikagaku et al, san Diego (10.1.1999) (Mei), Chin Dong Yan et al.

7. Conversion of ligation products

(1) Taking out the competent cells from-70 ℃, placing the centrifuge tube filled with the competent cells on ice for 4 minutes, adding 10 mu l of the ligation product after the competent cells are thawed, gently mixing the contents uniformly, and placing the mixture in the ice for 30 minutes;

(2) placing the centrifuge tube on a test tube rack placed in a water bath kettle preheated to 42 ℃, and placing for 90 seconds without shaking the centrifuge tube;

(3) the centrifuge tube was quickly transferred to an ice bath to cool the cells for 3 minutes;

(4) adding 800 ul LB culture medium (without antibiotic) into each centrifuge tube, then transferring the centrifuge tube to a 37 ℃ shaking table, carrying out 250 revolutions per minute, and culturing for 45 minutes to recover the bacteria;

(5) taking 200 mul of cultured cells and evenly coating the cells on an LB plate containing 50 mug/ml ampicillin;

(6) after the liquid on the plate was absorbed, the plate was placed upside down in an incubator at 37 ℃ and incubated for 16 hours.

8. Identification and sequencing of Positive clones

(1) 5 colonies were picked from each plate, inoculated into LB medium containing 50ug/ml ampicillin, and cultured at 37 ℃ for 16 hours;

(2) extracting plasmid by using an alkaline cracking method;

(3) carrying out single enzyme digestion identification on the obtained plasmid by using EcoRI;

(4) the strain with correct sequencing is extracted by a high-purity plasmid medium-volume extraction kit, and the obtained plasmid can be used for conventional molecular biology experiments and cytology experiments. If the cells were more toxic when used for cell transfection, they were retransformed into E.coli Top10 and then a higher purity plasmid was prepared using a kit or CsCl ultracentrifugation.

9. Lentiviral packaging

(1) Taking 293T cells in good cell state and logarithmic growth phase, counting the cells, and culturing at 5X 10 cells per 10cm culture dish⁶Inoculating the number of cells in cultureIn a culture dish, 5% CO at 37 DEG C₂Culturing in an incubator overnight;

(2) the old culture solution is removed before the transfection in the next day, and 5mL of fresh DMEM culture solution containing 10% serum is added; preparation of DNA-Lipofectamine 2000 complexes, exemplified by the amount used in a10 cm dish:

a prepare a sterile 5mL centrifuge tube, add 1.5mL serum-free

Adding pLV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5 and the target plasmid (4 ug each) into the culture solution, and slightly inverting and mixing;

b prepare another sterile 5mL centrifuge tube and add 1.5mL serum free

The culture broth and 40. mu.L of Lipofectamine 2000 were mixed by gentle inversion. Incubation for 5 minutes at room temperature;

after 5 minutes C, the diluted DNA was added to serum-free medium containing Lipofectamine 2000

The culture broth was gently inverted and mixed. Incubation at room temperature for 20 minutes;

(3) the DNA-Lipofectamine 2000 complexes were added drop by drop to 293T cells and the dishes were gently shaken back and forth to mix the complexes. Standing at 37 deg.C and 5% CO₂Culturing overnight in a saturated humidity incubator;

(4) one day after transfection, 10mL of DMEM medium containing 10% serum was replaced. Standing at 37 deg.C and 5% CO₂Continuously culturing in a saturated humidity incubator;

(5) collecting culture supernatant 48 hours after transfection and concentrating; adding 10ml of fresh culture solution for continuous culture, and collecting and concentrating again 72 hours after transfection;

centrifuging at 3000rpm for 15min, and filtering the supernatant with 0.45 μm filter to remove cell debris completely;

b, filling 20mL of filtrate in each UT centrifugal tube, centrifuging at 50000 Xg at a high speed for 90min to precipitate virus particles, and discarding the supernatant;

c, resuspending the virus precipitate by 200ul culture medium in each tube, and subpackaging into 2 0.5ml imported AXYGEN tubes with 100ul each tube;

(6) the packaged virus is stored at-80 ℃.

10. Cell culture

HEPG2 cells, routinely cultured using 10% FBS (BI) in DMEM medium (Gibco) (containing 1.5mM L-Glutamine,100U/ml penicillin, 100. mu.g/ml Streptomyces, 15ug/ml 5-fu), 5% CO at 37 ℃%₂Culturing in a saturated humidity incubator. HEPG2 cells were cultured in 6cm dish to 80-90% confluency, the medium was decanted and the cells were washed twice with 3ml D-Hank's solution. Adding 1ml of Trypsin-EDTA solution, mixing uniformly, carefully absorbing the pancreatin solution, and standing at 37 ℃ for 3 minutes. After 2ml of DMEM medium was added, the cells were blown up to form a single cell suspension. Counting with 10X 10 blood count plate⁵Inoculating 6-pore plate at cell/pore concentration, mixing, and adding 5% CO at 37 deg.C₂The culture was carried out for 24 hours.

11. Viral infection

200ul of lentivirus stock solution was diluted five times with 10% FBS in DMEM medium and Polybrene was added to a final concentration of 5 ug/ml. Removing culture medium from 6-well plate by suction, adding 1ml diluted virus solution into each well, and setting blank control group at 37 deg.C with 5% CO₂And culturing for 24 h. The diluted virus solution in 6-well plates was discarded, and 2ml of 10% FBS DMEM medium was added to each well at 37 ℃ with 5% CO₂And continuously culturing for 72 and 96 hours, and respectively collecting the samples, and using the obtained cells for RT and WB detection.

12. Lethal concentration

(1) And (4) preparing puromycin. Fully dissolving puromycin powder by using a freshly prepared and sterilized PBS solution to prepare 2.5ug/ul of mother liquor, and subpackaging 0.5ml of EP tubes into 200 mul for freezing and storing;

(2) SHG44, U251 cells were routinely cultured in 25T flasks, counted on a hemocytometer, aspirated to approximately 5X 10⁵Centrifuging the cell amount culture medium at 4000rpm for 5 min;

(3) adding 1ml of DMEM culture solution, and blowing and beating to enable cells to form single cell suspension;

(4) counting with a hemocytometer, diluting the cells to 3X 10⁵Cells/ml;

(5) by 2X 10⁴Inoculating 24-well plate at cell/well concentration, mixing well at 37 deg.C with 5% CO₂Culturing for 24 hr, and adding DMEM serum-containing culture medium with puromycin concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 ug/ml;

(6) maintaining puromycin concentration, changing liquid every other day, and observing. For 4 consecutive days, the optimal puromycin concentration was selected for complete cell killing.

13, construction of Stable Sieve Strain

(1) HEPG2 cells were routinely cultured in 25T flasks, counted on a hemacytometer, aspirated to approximately 5X 10⁵Centrifuging the cell amount culture medium at 4000rpm for 5 min;

(2) adding 1ml of DMEM culture solution, and blowing and beating to enable cells to form single cell suspension;

(3) counting with a hemocytometer, diluting the cells to 3X 10⁵Cells/ml;

(4) by 1 × 10⁶Cell/well concentration seeded 6-well plates;

(5) diluting lentivirus stock solution 200ul with DMEM culture solution containing FBS five times, and respectively adding Polybrene with final concentration of 5 ug/ml;

(6) dropping the diluted virus solution into a paved 6-well plate, and adding 5% CO at 37 DEG C₂Culturing for 24 h;

(7) the diluted virus solution in 6-well plates was discarded, and 2ml of 10% FBS DMEM medium was added to each well at 37 ℃ with 5% CO₂Continuing amplification culture and transferring to a 6cm culture dish;

(8) when the cells with the resistant group are cultured in a 6cm culture dish until 80-90% of fusion, puromycin concentration obtained in a lethal concentration experiment is added, and meanwhile, blank control group cells are set. Maintaining puromycin concentration, changing liquid every other day, and observing. After 4 days, considering that stable screening strains are obtained until all blank cells die;

(9) stably screening the cell amplification samples for RT and WB detection;

(10) extracting total RNA for further identification.

FIG. 2 shows the electrophoretogram of the extracted RNA, wherein lanes 1-6 are samples cultured for 72 hours, lanes 1 and 2 are cell blank and vector blank controls, respectively, lanes 3-6 are 6328, 6331, 6332 and 6333, and lanes 7-12 are corresponding samples cultured for 96 hours, and the 28s rRNA and 18s rRNA bands are clearly visible in FIG. 2, indicating that the RNA is not degraded; the OD value is measured, A260/A280 is between 1.9 and 2.2, and no protein pollution is caused in the extraction process.

13. Real-time PCR analysis of target Gene expression level

(1) Reagent and apparatus

Real-time fluorescent quantitative universal reagent (Cat # GMRS-001 gimama, shanghai), MX3000P real-time fluorescent quantitative PCR instrument (Stratagene, u.s.);

(2) designing a primer by taking human beta actin (hACTB) as an expression background control;

TABLE 2 primer sequences for PCR amplification

(3) Reverse transcription reaction system: 2 × 10 μ l of reverse transcription buffer, 1uM reverse transcription primer (final concentration 50nM)1.2 μ l, total RNA2 μ l, 200U/. mu.l MMLV reverse transcriptase (final concentration 2U/. mu.l) 0.2 μ l, DEPC water added to the total volume of 20 μ l;

reverse transcription program, 42 ℃ 30 min; 10min at 85 ℃;

(4) a real-time fluorescent quantitative reaction system: 2 Xquantitative PCR Master Mix 10. mu.l, 20uM upstream and downstream primers (final concentration 0.08. mu.M each) 0.08. mu.l, cDNA template 2. mu.l, 2.5U/. mu.l Taq DNA polymerase (final concentration 0.05U/. mu.l) 0.4. mu.l dd H₂O was added to a total volume of 20. mu.l;

quantitative PCR reaction procedure: denaturation at 95 ℃ for 3 min, 95 ℃ for 12 sec; at 62 ℃ for 40 seconds, and 40 cycles.

In FIG. 3, A is a DNA molecular weight marker, B is an electropherogram of a Real-time PCR detection product, and the result shows that the size of the PCR product is correct and no impurity band indicates no non-specific amplification.

Western blot detection 14

In the experiment, a polyclonal antibody [ Rabbit Anti-PPP2R3A antibody, # ab126195, abcam ] of PPP2R3A is adopted to detect the expression condition of PPP2R3A in a sample. Chemiluminescent detection was performed with SuperSignal West Pico chemistry Substrates and X-ray film exposure. After development and fixing, the films were photographed using a Gel imaging analysis system and analyzed using Gel-Pro Analyzer software. As can be seen from FIG. 4, 6328, 6332, 6333 interfering group stable strains had significant interfering effects compared to the control group stable strains (N-negative control; B-blank cell group).

Example 2 cell flow assay for apoptosis by MRNAi

1. Experimental materials and reagents:

(1) AnnexinV-PE/7-AAD apoptosis detection kit (KGA1017)

(2) BD FACS Calibur flow cytometer

2. The method comprises the following steps:

(1) after the cells of each group are passaged for 48 hours, digesting the cells by pancreatin without EDTA, centrifugally collecting the cells, centrifuging at 2000RPM for 5min by a microcentrifuge, and removing the culture medium;

(2) cells were washed twice with cold PBS (2000RPM, 5min centrifugation time to collect cells);

(3) adding 5ul7-AAD dye solution into 50ul Binding Buffer, and mixing uniformly;

(4) adding the 7-AAD dye solution into the collected cells, and uniformly mixing; reacting for 15 minutes at room temperature in a dark place;

(5) adding 450ul Binding Buffer after reaction and mixing evenly; adding 1ul annexin V-PE, mixing uniformly, and reacting for 15 minutes at room temperature in a dark place;

(6) detection was performed by flow cytometry within 1 hour.

3. Results

FIG. 5 is a bar graph of the data of apoptosis detected by flow cytometry after detection of apoptosis. Compared with a control group (3N: interference negative control; B: blank cell group), the PPP2R3A interference group has higher proportions of early apoptosis, late apoptosis and dead cells than the control group, which indicates that the liver cancer cells after the PPP2R3A gene is interfered by 6328 and 6332 are apoptotic.

Example 3 use of the CCK8 kit to detect the Effect of MRNAi on cell proliferation

1. The cells of each group were subcultured overnight, the culture broth was decanted, and the cells were washed twice with 3ml of PBS. 2, adding 1ml of Trypsin-EDTA solution, mixing uniformly, carefully absorbing the pancreatin solution, and standing at 37 ℃ for 3 minutes.

3. 6ml of a culture medium containing 10% FBS was added, and the cells were blown up to form a single cell suspension.

4. Counting with a hemocytometer, diluting the cells to 5X 10⁵Cells/ml.

5. According to 3X 10³Inoculating 96-well plate with cell/well concentration, and setting zero-adjusting group, i.e. directly adding 100 μ 1DMEM medium into well, setting 5 repeats for each group, mixing uniformly at 37 deg.C with 5% CO₂And (5) culturing.

6. And pouring out the culture solution after 0, 24, 48, 72 and 96 hours, adding 100 mu l of fresh culture medium, adding 810 mu l of CCK into each hole in a dark place, culturing for 3 hours in a dark place, and measuring the OD value by using a microplate reader at the wavelength of 450 nm.

FIG. 6 shows the proliferation of cells of each group at the corresponding time points under different treatment conditions (6328, 6332 are PPP2R3A gene interference-stabilized strain; 3N: interference negative control; B: blank cell group) detected by the general CCK8 method, the abscissa represents the corresponding time points, and the ordinate represents OD measured by a microplate reader at a wavelength of 450nm₄₅₀And (4) reading the value. As can be seen from the graph, the OD of each interference group of PPP2R3A is compared with that of the control group₄₅₀The readings were all smaller than the control group. The results show that: the proliferation capacity of the liver cancer cells after the PPP2R3A gene is interfered by 6328 and 6332 is reduced.

Example 4 Effect of mNAI on cell migration

1. Experimental materials and reagents: DMEM medium + 15% FBS, DMEM medium + 5% FBS, PBS, Trypsin-EDTA Solution (0.25% Trypsin +0.53mM EDTA, Gibco), matrigel (BD), 24-well plate and transwell chamber (Corning).

2. Step (ii) of

(1) Culturing the cells of each group of HEPG2 for 24h, removing the complete culture medium, and continuously culturing for 24h by using 5% FBS culture medium;

(2) the culture medium was decanted and the cells were washed twice with 3ml PBS;

(3) adding 1ml of Trypsin-EDTA solution, mixing uniformly, carefully absorbing pancreatin solution, and standing at 37 ℃ for 3-5 minutes;

(4) the cells were then made into a single cell suspension by adding 2ml of DMEM medium containing 5% FBS and pipetting. Counting with a hemocytometer, diluting the cells to 3X 10⁵Cells/ml;

(5) by 8X 10²The concentration of cells/well was seeded in a transwell chamber, and 700. mu.l of a medium with a serum concentration of 15% was added to the lower chamber, 5% CO at 37 ℃₂Culturing for 48 h;

(6) the chamber was removed and washed once with PBS. Adding pre-cooled methanol, and fixing at-20 deg.C for 10 min;

(7) PBS was rinsed 3 times. Taking out the small chamber, inverting and air-drying;

(8) placing the chamber in a new 24-well, adding 200ul 0.1% crystal violet, immersing the membrane, and dyeing at 37 deg.C for 30 min;

(9) by ddH₂And washing for 3 times by using O. After the chamber is air-dried, the chamber is placed in a hole, a plurality of visual fields are taken out under an inverted microscope, and the photographing and counting are carried out.

3. Results

FIG. 7 is a bar graph of the effect of mRNAi on cell migration with the abscissa representing the number of cells passing through the basement membrane of the transwell chamber and the abscissas representing differently treated cell samples, (6328, 6332 for PPP2R3A gene interference stable strain; LV 3-NC: interference negative control; B: blank cell group, respectively). As can be seen from the figure, the number of cells that cross the basement membrane in each interfering group of PPP2R3A is less than that in the control group, and the difference is significant. The results show that: the migration of the liver cancer cells after the PPP2R3A gene is interfered by 6328 and 6332 is reduced.

Example 5 Effect of mNAI on cell invasiveness

1. Experimental materials and reagents: DMEM medium + 15% FBS, DMEM medium + 5% FBS, PBS, Trypsin-EDTA Solution (0.25% Trypsin +0.53mM EDTA, Gibco), Opti-MEM I Reduced serum medium (Gibco), matrigel (BD), 24-well plate and transwell chamber (Corning).

2. Step (ii) of

(1) Coating a basement membrane: DMEM medium containing 0.5% FBS was used at a rate of 1: 6 dilution of 50mg/LMatrigel, 60. mu.l of the upper compartment surface coated with the bottom membrane of the Transwell chamber, and release of 5% CO at 37 ℃ in a container₂Incubating in an incubator for 4 hours, and sucking and removing supernatant;

(2) culturing the cells of each group of HEPG2 for 24h, removing the complete culture medium, and continuously culturing for 24h by using 5% FBS culture medium;

(3) the culture medium was decanted and the cells were washed twice with 3ml PBS;

(4) adding 1ml of Trypsin-EDTA solution, mixing uniformly, carefully absorbing pancreatin solution, and standing at 37 ℃ for 3-5 minutes;

(5) the cells were then made into a single cell suspension by adding 2ml of DMEM medium containing 5% FBS and pipetting. Counting with a hemocytometer, diluting the cells to 3X 10⁵Cells/ml;

(6) by 1 × 10³The concentration of cells/well was seeded in a transwell chamber, and 700. mu.l of a medium with a serum concentration of 15% was added to the lower chamber, 5% CO at 37 ℃₂Culturing for 48 h;

(7) the chamber was removed and washed once with PBS. Adding pre-cooled methanol, and fixing at-20 deg.C for 10 min;

(8) the methanol was discarded and washed with PBS. The Matrigel gel on the upper surface of the chamber was gently scraped off in PBS using a cotton swab, and the upper surface was washed 3 times with PBS. Taking out the small chamber, inverting and air-drying;

(9) placing the chamber in a new 24-well, adding 200ul 0.1% crystal violet, immersing the membrane, and dyeing at 37 deg.C for 30 min;

(10) by ddH₂And washing for 3 times by using O. After the chamber is air-dried, the chamber is placed in a hole, a plurality of visual fields are taken out under an inverted microscope, and the photographing and counting are carried out.

FIG. 8 is a bar graph of the effect of mRNAi on cell invasiveness with the abscissa representing the number of cells passing through the basement membrane of a transwell cell coated with matrigel gel and different treated cell samples (6328, 6332 for PPP2R3A gene interference stable strain; LV 3-NC: interference negative control; B: blank cell group, respectively). As can be seen, the number of cells that cross the basement membrane was less in each of the PPP2R3A interfering groups than in the control group. The results show that: the invasiveness of the hepatoma cells after the PPP2R3A gene is interfered by 6328 and 6332 is reduced.

The research project is funded by a national science fund project (81372595) and a national major scientific research project A type project (973 project) (2014CBA 02001).

Sequence listing

<110> general hospital for armed police force of China people

<120> mRNAi capable of inhibiting liver cancer cell proliferation and invasion activity and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 63

<212> DNA

<213> Artifical

<400> 1

gatccggatt tcatccctct acttcattca agagatgaag tagagggatg aaatcctttt 60

ttg 63

<210> 2

<211> 63

<212> DNA

<213> Artifical

<400> 2

aattcaaaaa aggatttcat ccctctactt catctcttga atgaagtaga gggatgaaat 60

ccg 63

<210> 3

<211> 59

<212> DNA

<213> Artifical

<400> 3

gatccgccct tgccattcca tgatttcaag agaatcatgg aatggcaagg gcttttttg 59

<210> 4

<211> 59

<212> DNA

<213> Artifical

<400> 4

aattcaaaaa agcccttgcc attccatgat tctcttgaaa tcatggaatg gcaagggcg 59

<210> 5

<211> 63

<212> DNA

<213> Artifical

<400> 5

gatccgcaga atggctcaca tcttctttca agagaagaag atgtgagcca ttctgctttt 60

ttg 63

<210> 6

<211> 63

<212> DNA

<213> Artifical

<400> 6

aattcaaaaa agcagaatgg ctcacatctt cttctcttga aagaagatgt gagccattct 60

gcg 63

<210> 7

<211> 63

<212> DNA

<213> Artifical

<400> 7

gatccggaga aatacttaga ccatgattca agagatcatg gtctaagtat ttctcctttt 60

ttg 63

<210> 8

<211> 63

<212> DNA

<213> Artifical

<400> 8

aattcaaaaa aggagaaata cttagaccat gatctcttga atcatggtct aagtatttct 60

ccg 63

<210> 9

<211> 61

<212> DNA

<213> Artifical

<400> 9

gatccgttct ccgaacgtgt cacgtttcaa gagaacgtga cacgttcgga gaactttttt 60

g 61

<210> 10

<211> 61

<212> DNA

<213> Artifical

<400> 10

aattcaaaaa agttctccga acgtgtcacg ttctcttgaa acgtgacacg ttcggagaac 60

g 61

Claims (9)

1. An mRNAi for inhibiting the proliferation and invasion activity of hepatoma cells is characterized in that the mRNAi is a DNA double chain, and the sequences of a sense strand and an antisense strand of the mRNAi are shown as SEQ ID NO.1 and SEQ ID NO.2, or as shown as SEQ ID NO.5 and SEQ ID NO. 6.

2. A vector comprising the mrrnai of claim 1.

3. The vector according to claim 2, wherein the vector is LV3 vector.

4. A packaging cell comprising the vector of claim 3.

5. The cell of claim 4, wherein the cell is a 293T cell.

6. A lentivirus comprising the mrrnai of claim 1.

7. A pharmaceutical composition comprising the mrrnai of claim 1.

8. Use of the mrrnai of claim 1 in the preparation of a medicament for the treatment of a tumor, said medicament being a liver tumor treatment.

9. A method of packaging the lentivirus of claim 6, said method comprising the steps of:

(1) cloning the mrrnai of claim 1 into LV3 vector;

(2) transfecting the vector obtained in the step (1) and a packaging helper plasmid into 293T cells;

(3) culturing the cells obtained in the step (2);

(4) cell supernatant culture was collected and concentrated to obtain packaged lentiviruses.

Images