CN109988760A - A kind of inhibition hepatoma cell proliferation and invade active mRNAi and its application - Google Patents

A kind of inhibition hepatoma cell proliferation and invade active mRNAi and its application Download PDF

Info

Publication number
CN109988760A
CN109988760A CN201711480875.6A CN201711480875A CN109988760A CN 109988760 A CN109988760 A CN 109988760A CN 201711480875 A CN201711480875 A CN 201711480875A CN 109988760 A CN109988760 A CN 109988760A
Authority
CN
China
Prior art keywords
cell
mrnai
seq
carrier
ppp2r3a
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711480875.6A
Other languages
Chinese (zh)
Other versions
CN109988760B (en
Inventor
张庆
陈新国
沈中阳
郭静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Medical Center of PLA General Hospital
Original Assignee
GENERAL HOSPITAL CHINESE PEOPLE'S ARMED POLICE TROOPS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GENERAL HOSPITAL CHINESE PEOPLE'S ARMED POLICE TROOPS filed Critical GENERAL HOSPITAL CHINESE PEOPLE'S ARMED POLICE TROOPS
Priority to CN201711480875.6A priority Critical patent/CN109988760B/en
Publication of CN109988760A publication Critical patent/CN109988760A/en
Application granted granted Critical
Publication of CN109988760B publication Critical patent/CN109988760B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of inhibition hepatoma cell proliferation and invade active mRNAi, and the carrier containing the mRNAi sequence, slow virus and pharmaceutical composition and its preparing the application in cancer treatment drug.The mRNAi sequence can effectively inhibit the expression of PPP2R3A gene.PPP2R3A gene in liver cancer cells is after by mRNAi sequence interference of the invention, and cell proliferation capacity, migration force, invasiveness significantly reduce, and Apoptosis occur, it is shown that it is preparing the application prospect in cancer treatment drug.

Description

A kind of inhibition hepatoma cell proliferation and invade active mRNAi and its application
Technical field
The invention discloses a kind of mRNAi sequences, and more specifically, the invention discloses one kind to be able to suppress liver cancer cells It is proliferated and invades active mRNAi sequence.
Background technique
The incidence of China's hepatocellular carcinoma (Hepatocellular Careinoma, HCC, abbreviation liver cancer) occupies the whole world the One.According to statistics, annual about 700,000 people of onset of liver cancer number in the whole world, China account for 10 55%, and the death rate accounts for the whole world 45%.Due to me Belong to middle and advanced stage when state's liver cancer patient is medical, majority is with cirrhosis, and less than 30%, Postoperative recurrent rate is up to Resection Rate more 70%., the curative effect of chemotherapy and radiotherapy is poor, and the effective percentage of existing targeted drug is lower, currently there is no having for treatment liver cancer Imitate drug.Research and development medicines resistant to liver cancer is the research hotspot in the current whole world.
PPP2R3A gene is a kind of newfound gene relevant to tumour generation.The albumen category of PPP2R3A gene expression In an adjusting subunit B of phosphoprotein phosphatase 2 (PP2A), heterotrimer, common structure are formed with Structural subunits A, catalytic subunit C At 2 holoenzyme of phosphoprotein phosphatase, PP2A belongs to serine/threonine phosphatase, participates in the growth of negative regulation cell and division.B subunit It is to be encoded by a different set of gene, including B/PR55, B'/PR61 and B "/PR72 family, different adjusting subunits determine entirely The substrate specificity and intracellular targeting of enzyme.The product of PPP2R3A gene belongs to B " family, and B " family is further divided into difference Subfamily, the product of this gene belong to the α subfamily that B " adjusts subunit.Alternative splicing causes to generate multiple splicing variants, can compile The different hypotype of code.
Ser/Thr phosphoprotein phosphatase the foundation influence of inhibiting factor and the difference of catalysis substrate specificity, and can be specific Be divided into two class of PP1 and PP2, PP2 again according to its to the difference of bivalent metal ion dependence be further divided into PP2A, PP2B and PP2C.In addition substrate-function wider range of PP1, PP2A and PP2C, and PP2B then relative narrower.PP1, PP2A, PP2B belong to It is Ser/Thr phosphoprotein phosphatase constituent important in vivo, they regulate and control a variety of in vivo in phosphoprotein phosphatase PPP family The processes such as life process, including contraction of muscle, cell cycle, cell growth.
Have that researches show that there is a kind of mechanism of regulation of calcium serine/threonine phosphatase activity for cell interior. B "/PR72 subunit passes through Ca2+Dependence regulatory protein phosphatase 2A is for the site DARPP-32/Thr-75 dephosphorylation.It is more The phosphoprotein (DARPP-32,32kD) that bar amine and cAMP are adjusted is the unique protein with dual function, it is both phosphoric acid The inhibitor of enzyme (such as PP-1) and the inhibitor of protein kinase (such as PKA), i.e. DARPP-32 pass through itself different loci Phosphorylation plays protein phosphorylation and dephosphorylation process the effect of double regulation control.
The PR70 subunit of PP2A adjusts Cdc6 (cell division control by the characteristic that calcium ion relies on Protein 6), the presence of PP2A (including PR70) has the normal performance conducive to Cdc6 protein function；And at the same time discovery PR70 It can promote conversion of phase cell cycle G1 to the S phase.Wherein Cdc6 albumen is most important for the assembling for completing pre-RC, inhibits Cdc6 can hinder the synthesis of DNA；And it is overexpressed Cdc6 to will lead to the DNA that duplicates in a cell division cycle multiple It makes, Cdc6 is higher in tumour cell, plays a significant role for the malignant proliferation of tumour cell.Some researches show that in children acute Chromosome 3NotI genechip detection epigenetic inactivation gene is used in lymphatic leukemia ALL.It was found that (albumen swashs PPP2R3A Enzyme 2 adjusts subunit B) methylation that is frequent in children ALL.The characteristic that the PR70 subunit of PP2A is relied on by calcium ion It adjusts Cdc6 (cell division control protein 6), the presence of PP2A (including PR70) has conducive to Cdc6 albumen The normal performance of function；And at the same time discovery PR70 can promote conversion of phase cell cycle G1 to the S phase.Wherein Cdc6 albumen pair It is most important in the assembling for completing pre-RC, inhibit Cdc6 that can hinder the synthesis of DNA；And it is overexpressed Cdc6 and will lead at one carefully The DNA replication dna duplicated in born of the same parents' division cycle, Cdc6 is higher in tumour cell, has weight for the malignant proliferation of tumour cell It acts on.PR72/PR130 (PPP2R3A) and Nkd (Naked cuticle, naked cutin membrane homologous protein) albumen are wnt letter The inhibiting factor of number access, and there is interaction during playing inhibiting effect.Wnt signal is early stage animal embryo In development, orga- nogenesis, regeneration and other physiology courses, it is of crucial importance.If this signal paths is different Often activation, it is possible to the generation of induced cancer.
Although PPP2R3A plays important role in tumour generation, the correlation of PPP2R3A and liver cancer, with And its report yet there are no to the proliferation and invasion activity influence of liver cancer cells.In view of liver cancer in the high incidence of China and extremely Rate is died, current effective treatment and prevention means are also very limited, and therefore, the object of the invention is to study PPP2R3A and liver The correlation of cancer provides one kind and is able to suppress hepatoma cell proliferation and invades active mRNAi sequence, and then provides the mRNAi Sequence is preparing the effect in liver-cancer medicine.
Summary of the invention
Based on foregoing invention purpose, the present invention discloses a kind of inhibition hepatoma cell proliferation first and invades active MRNAi, the mRNAi are DNA double chain, the sequence such as SEQ ID NO.1 and SEQ ID NO.2 institute of positive-sense strand and antisense strand Show, perhaps as shown in SEQ ID NO.3 and SEQ ID NO.4 perhaps as shown in SEQ ID NO.5 and SEQ ID NO.6 or As shown in SEQ ID NO.7 and SEQ ID NO.8.
The invention also discloses a kind of carriers containing above-mentioned mRNAi.
In a preferred technical solution, the carrier is LV3 carrier.
The invention also discloses a kind of incasing cells containing above-mentioned carrier.
In a preferred technical solution, the cell is 293T cell.
The invention also discloses a kind of slow virus containing above-mentioned mRNAi.
The invention also discloses a kind of pharmaceutical compositions containing above-mentioned mRNAi.
The invention also discloses application of the above-mentioned mRNAi in preparation tumor therapeutic agent.
In a preferred technical solution, the tumor therapeutic agent is liver neoplasm therapeutic agent.
Finally, the described method comprises the following steps the invention discloses a kind of packing method of above-mentioned slow virus:
(1) above-mentioned mRNAi is cloned into LV3 carrier；
(2) carrier and packaging helper plasmid that step (1) obtains are transfected into 293T cell；
(3) cell that incubation step (3) obtains；
(4) it collects cell conditioned medium culture solution and the slow virus for obtaining packaging is concentrated.
MRNAi sequence provided by the invention can specifically interfere the expression of PPP2R3A gene, hepatocarcinoma cell line HEPG2 After by mRNAi sequence infection of the invention, cell proliferation capacity, migration force, invasiveness significantly drop PPP2R3A gene in cell It is low, and there is Apoptosis, it is shown that it is before the application in preparation tumor therapeutic agent, especially cancer treatment drug Scape.
Detailed description of the invention
Fig. 1 .LV3 carrier structure schematic diagram；
Fig. 2 .HEPG2 cell total rna extracts electrophorogram；
Fig. 3 .Real-time pcr amplification product electrophorogram；
Expression quantity histogram after Fig. 4 .PPP2R3A is disturbed relative to hACTB；
Apoptosis effect column analysis chart caused by Fig. 5 .mRNAi；
The curve graph that Fig. 6 .mRNAi cell proliferation power influences；
Column analysis chart of Fig. 7 .mRNAi to cell migration capacity；
Column analysis chart of Fig. 8 .mRNAi to cell invasion capacity.
Specific embodiment
The invention will now be further described with reference to specific embodiments, the advantages and features of the present invention will be with description and It is apparent.But examples are merely exemplary for these, does not constitute any restrictions to protection scope of the present invention.
The preparation and screening of embodiment 1:mRNAi
1. target gene selection and mRNAi design
4 target sequences to be interfered have been selected altogether for PPP2R3A gene, and information is shown in Table 1.
Table 1. is directed to 4 target sequences and a negative control sequence of PPP2R3A
Number Gene Name Target sequence (5 ' -3 ')
6328 PPP2R3A-630 GGATTTCATCCCTCTACTTCA
6331 PPP2R3A-1224 GCCCTTGCCATTCCATGATTT
6332 PPP2R3A-1316 GCAGAATGGCTCACATCTTCT
6333 PPP2R3A-1356 GGAGAAATACTTAGACCATGA
shNC TTCTCCGAACGTGTCACGT
ShNC is negative control sequence
2. for above-mentioned 4 target sequences design MRNAi sequence and synthesis
DNA oligo is designed using Designer3.0 (Genepharma) software, using conventional gene synthetic technology Synthetic DNA oligo.
Design principle: the loop structure in LV3-shRNA template has selected TTCAAGAGA to avoid termination signal is formed. 5 ' ends of positive-sense strand template are added to GATCC, complementary with the cohesive end formed after BamHI digestion；5 ' end additions of antisense strand template AATTC, it is with the cohesive end formed after EcoRI digestion complementary.
Justice connects: 5 '-GATCC- (GN18)-(TTCAAGAGA)-(N18C)-TTTTTTG-3 '
Antisense strand: 3 '-G (CN18)-(AAGTTCTCT)-(N18G)-AAAAAACTTAA-5 '
Wherein, G represents guanine, and C represents cytimidine, and GN18, CN18 represent the interference fragment of insertion, N18C, N18G generation The reverse complemental of table GN18 connects.
For for the DNA oligo of target sequence 6328 design:
Positive-sense strand (SEQ ID NO.1):
GATCCGGATTTCATCCCTCTACTTCATTCAAGAGATGAAGTAGAGG GATGAAATCCTTTTTTG
Antisense strand (SEQ ID NO.2):
AATTCAAAAAAGGATTTCATCCCTCTACTTCATCTCTTGAATGAAG TAGAGGGATGAAATCCG
The mRNAi sequence transcribed out:
GGATTTCATCCCTCTACTTCATTCAAGAGATGAAGTAGAGGGATGA AATCCTT
The DNA oligo of other target sequences is successively designed are as follows:
For the DNA oligo of target sequence 6331:
Positive-sense strand (SEQ ID NO.3):
GATCCGCCCTTGCCATTCCATGATTTCAAGAGAATCATGGAATGGC AAGGGCTTTTTTG
Antisense strand (SEQ ID NO.4):
AATTCAAAAAAGCCCTTGCCATTCCATGATTCTCTTGAAATCATGG AATGGCAAGGGCG
The mRNAi sequence transcribed out:
GCCCTTGCCATTCCATGATTTCAAGAGAATCATGGAATGGCAAGG GCTT
For the DNA oligo of target sequence 6332:
Positive-sense strand (SEQ ID NO.5):
GATCCGCAGAATGGCTCACATCTTCTTTCAAGAGAAGAAGATGTG AGCCATTCTGCTTTTTTG
Antisense strand (SEQ ID NO.6):
AATTCAAAAAAGCAGAATGGCTCACATCTTCTTCTCTTGAAAGAA GATGTGAGCCATTCTGCG
The mRNAi sequence transcribed out:
GCAGAATGGCTCACATCTTCTTTCAAGAGAAGAAGATGTGAGCCA TTCTGCTT
For the DNA oligo of target sequence 6333:
Positive-sense strand (SEQ ID NO.7):
GATCCGGAGAAATACTTAGACCATGATTCAAGAGATCATGGTCTA AGTATTTCTCCTTTTTTG
Antisense strand (SEQ ID NO.8):
AATTCAAAAAAGGAGAAATACTTAGACCATGATCTCTTGAATCAT GGTCTAAGTATTTCTCCG
The mRNAi sequence transcribed out:
GGAGAAATACTTAGACCATGATTCAAGAGATCATGGTCTAAGTAT TTCTCCTT
For the DNA oligo of negative control target sequence shNC:
Positive-sense strand (SEQ ID NO.9):
GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTT CGGAGAACTTTTTTG
Antisense strand (SEQ ID NO.10):
AATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGA CACGTTCGGAGAACG
The mRNAi sequence transcribed out:
GTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGA GAACTT
3.LV3-shDNA the annealing of template
TE (pH8.0) is used to dissolve respectively DNA oligo, concentration 100uM.Take corresponding positive-sense strand and antisense strand Oligo solution, is made annealing treatment according to the procedure below in PCR instrument: 95 DEG C of 5min；85℃ 5min；75℃ 5min；70 ℃ 5min；4 DEG C of preservations.The shRNA template that concentration is 10 μM is obtained after annealing.Gained template solution is diluted 50 times, Final concentration of 200nM, for connecting reaction.
4.LV3 the linearisation of carrier
According to 2 × Buffer Tango each 5ul of 10ul, BamHI and EcoRI5, LV3 carrier 10ug, ddH2O is supplemented to 100ul carries out digestion processing (LV3 carrier structure schematic diagram is shown in Fig. 1).
5.LV3-shRNA the building of carrier
According to 10 × T4Ligation Buffer 2ul, LV3 (BamHI+EcoRI) 1ul, shDNA template (100nM) 1ul, T4DNA ligase (5weissU/ul) 1ul, ddH2The system of O15ul carries out the connection reaction of carrier.
6. the preparation of competent cell bacillus coli DH 5 alpha: (Calcium Chloride Method) competent cell preparation reference: molecular cloning The experiment guide second edition page 55, Science Press (on October 1st, 1999) (beauty) Pehanorm Brooker etc. writes golden winter wild goose etc. and translates.
7. the conversion of connection product
(1) competent cell is taken out from -70 DEG C, and the centrifuge tube equipped with competent cell is placed 4 minutes on ice, to After competent cell thaws, 10 μ l connection products are added, softly mixes content, is placed 30 minutes in ice；
(2) centrifuge tube is put on the rack for test tube that pre-heating is put well into 42 DEG C of water-bath, is placed 90 seconds, Bu Yaoyao Dynamic centrifuge tube；
(3) quickly centrifuge tube is transferred in ice bath, keeps cell 3 minutes cooling；
(4) 800 μ l LB culture mediums (being free of antibiotic) is added to every centrifuge tube, centrifuge tube is then transferred to 37 DEG C Shaking table, 250 revs/min, cultivating 45 minutes makes bacteria resuscitation；
(5) cell after taking 200 μ l to cultivate is spread evenly across containing on 50 μ g/ml ampicillin/LB plates；
(6) etc. after liquid is absorbed on plates, plate is inverted in 37 DEG C of incubators, is cultivated 16 hours.
8. the identification and sequencing of positive colony
(1) it from 5 bacterium colonies of picking on every piece of plate, is inoculated into the LB culture medium of the ampicillin containing 50ug/ml, 37 DEG C culture 16 hours；
(2) plasmid is extracted using alkaline lysis；
(3) gained plasmid carries out single endonuclease digestion identification with EcoRI；
(4) correct bacterial strain is sequenced can be used for often using the extracting of amount extraction agent box, gained plasmid in high purity plasmid The molecular biology experiments and cytological experiments of rule.If be used for cell transfecting when cytotoxicity it is larger, please convert again to In Escherichia coli Top10, higher purity plasmid then is prepared with kit or CsCl supercentrifugation.
9. slow virus is packed
(1) take cell state good, the 293T cell in logarithmic growth phase, after cell count, according to each 10cm's Culture dish 5 × 106A cell number is inoculated in culture dish, and 37 DEG C, 5%CO2Incubator in overnight incubation；
The old culture solution of removal before transfection in (2) second days, be added 5mL it is fresh contain 10% serum DMEM culture solution；Preparation 2000 compound of DNA-Lipofectamine is demonstration with the dosage of a 10cm culture dish:
A prepares a sterile 5mL centrifuge tube, and 1.5mL serum-free is first addedCulture solution, then plus Enter pLV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5, purpose plasmid (each 4ug), is gently mixed by inversion；
B prepares in other one sterile 5mL centrifuge tube, and 1.5mL serum-free is addedCulture solution and The Lipofectamine 2000 of 40 μ L, is gently mixed by inversion.Incubation at room temperature 5 minutes；
C is added to the serum-free containing Lipofectamine 2000 after five minutes, by dilution DNACulture solution is gently mixed by inversion.Incubation at room temperature 20 minutes；
(3) 2000 compound of DNA-Lipofectamine is drop by drop added in 293T cell, lightly before After rock culture dish to mix compound.Place 37 DEG C, 5%CO2It is incubated overnight in saturated humidity incubator；
(4) one day after, replacement 10mL contains 10% serum DMEM culture solution for transfection.Place 37 DEG C, 5%CO2Saturated humidity training It supports and continues to cultivate in case；
(5) 48 hours collection culture supernatants are concentrated after transfecting；The fresh culture solution of 10ml is added to continue to cultivate, transfects Afterwards concentration is collected again within 72 hours；
A 3000rpm low-speed centrifugal 15min, supernatant is filtered with 0.45 μm of filter, to completely remove cell fragment；
The each UT centrifuge tube of B fills 20mL filtrate, and 50000 × g high speed centrifugation 90min precipitate virus particle discards supernatant；
Viral pellet is resuspended with 200ul culture solution in the every pipe precipitating of C, dispenses into 2 0.5ml import AXYGEN pipes, often Pipe 100ul；
(6) virus dispensed places -80 DEG C of preservations.
10. cell culture
HEPG2 cell, routine culture use DMEM culture medium (Gibco) (L- containing 1.5mM containing 10%FBS (BI) Glutamine, 100U/ml penicillin, 100 μ g/ml Streptomycin, 15ug/ml 5-fu) in, 37 DEG C 5% CO2It is cultivated in saturated humidity incubator.HEPG2 cell is cultivated in 6cm dish to when 80-90% fusion, and incline culture solution, Cell is washed twice with 3ml D-Hank ' s solution.Add 1ml Trypsin-EDTA solution, it is careful to inhale after mixing Trypsin solution is removed, 37 DEG C are placed 3 minutes.2ml DMEM culture solution is being added, piping and druming makes cell form single cell suspension.Hemocytometer Number plate counts, by 10 × 105The concentration of cells/well is inoculated with 6 orifice plates, 37 DEG C of 5% CO after mixing2Culture 24 hours.
11. virus infection
By slow virus stoste 200ul, five times of liquid dilutions are trained with the DMEM of 10%FBS, and be added final concentration of 5ug/ml's Polybrene.The culture solution in 6 orifice plates is sucked, the above-mentioned diluted virus liquid of 1ml is added in every hole, while setting up blank control Group, in 37 DEG C of 5%CO2Culture is for 24 hours.The dilution virus liquid abandoned in 6 orifice plates is inhaled, the DMEM training of 2ml 10%FBS is added in every hole Liquid is in 37 DEG C of 5% CO2Continue culture and received sample respectively to 72,96 hours, gained cell is detected for RT, WB.
12. lethasl concentration
(1) preparation of puromycin.PBS solution after being sterilized using Fresh sufficiently dissolves puromycin powder End, is configured to 2.5ug/ul mother liquor, and 0.5ml EP pipe is distributed into 200 μ l and freezes；
(2) SHG44, U251 cell routine are cultivated in 25T culture bottle, and blood counting chamber counts, and are drawn containing about 5 × 105 The culture medium 4000rpm of cell concentration is centrifuged 5min；
(3) 1ml DMEM culture solution is added, piping and druming makes cell form single cell suspension；
(4) blood counting chamber counts, and cell is diluted to 3 × 105Cell/ml；
(5) 2 × 10 are pressed4The concentration of cells/well is inoculated with 24 orifice plates, in 37 DEG C of 5%CO after mixing2Culture 24 hours, pre- reality Test the DMEM serum-containing media that middle addition puromycin concentration is respectively 0.1,0.2,0.3,0.4,0.5ug/ml；
(6) puromycin concentration is maintained, changes liquid every other day, is observed.Continuous 4 days, selection can kill completely cell most suitable Puromycin concentration.
13, it is steady to sieve strain building
(1) HEPG2 cell routine is cultivated in 25T culture bottle, and blood counting chamber counts, and is drawn containing about 5 × 105Cell concentration Culture medium 4000rpm be centrifuged 5min；
(2) 1ml DMEM culture solution is being added, piping and druming makes cell form single cell suspension；
(3) blood counting chamber counts, and cell is diluted to 3 × 105Cell/ml；
(4) 1 × 10 is pressed6The concentration of cells/well is inoculated with 6 orifice plates；
(5) by slow virus stoste 200ul, five times of liquid dilutions are trained with the DMEM containing FBS, and be separately added into final concentration of 5ug/ The Polybrene of ml；
(6) virus liquid that will have been diluted, is added dropwise in the 6 orifice plates completed, in 37 DEG C of 5%CO2Culture is for 24 hours；
(7) the dilution virus liquid abandoned in 6 orifice plates is inhaled, the DMEM training liquid of 2ml 10%FBS is added in 37 DEG C of 5%CO in every hole2 Continue amplification cultivation, reaches 6cm culture dish；
(8) band resistance group cell is cultivated in 6cm culture dish to when 80-90% fusion, is added in lethasl concentration experiment and is touched The puromycin concentration that rope obtains, while setting up blank control group cell.Puromycin concentration is maintained, changes liquid every other day, is observed. Continuous 4 days, until after the whole death of blanc cell, it is believed that obtained steady sieve strain；
(9) surely sample is received in the amplification of sieve strain cell, is detected for RT, WB；
(10) total serum IgE is extracted in case of the identification of next step.
Fig. 2 shows extracted RNA electrophorogram, and wherein 1-6 swimming lane is the sample cultivated 72 hours, and 1 and 2 are respectively Cell blank and carrier blank control, 3-6 6328,6331,6332 and 6333,7-12 swimming lane are the correspondence cultivated 96 hours Sample, 28s rRNA, 18s rRNA band are high-visible in Fig. 2, illustrate that RNA is undegraded；OD value measures A260/A280 1.9 Between~2.2, there is no protein contamination in extraction process.
13. the Real-time PCR of destination gene expression amount is analyzed
(1) reagent and instrument
Real time fluorescent quantitative common reagent (Cat#GMRS-001 Ji Ma, Shanghai), MX3000P real-time fluorescence quantitative PCR instrument (Stratagene,U.S.)；
It (2) is that expression Background control carries out design of primers with people β actin (hACTB)；
Table 2.PCR expands the primer sequence
(3) reverse transcription reaction system: 2 × RT Buffer 10 μ l, 1uM reverse transcriptase primer (final concentration 50nM) 1.2 μ L, total serum IgE 2 μ l, 200U/ μ l MMLV reverse transcriptase (final concentration 2U/ μ l) 0.2 μ l, DEPC water are added to 20 μ l of total volume；
Reverse transcription reaction program, 42 DEG C of 30min；85℃10min；
(4) real time fluorescent quantitative reaction system: 2 × quantitative PCR Master Mix10 μ l, 20uM upstream and downstream primer are (dense eventually Degree is respectively 0.08 μM) 0.4 μ l of each 0.08 μ l, cDNA template 2 μ l, 2.5U/ μ l Taq archaeal dna polymerase (final concentration 0.05U/ μ l), dd H2O is added to 20 μ l of total volume；
Quantitative PCR response procedures: it 95 DEG C, is denaturalized within 3 minutes, 95 DEG C, 12 seconds；62 DEG C, 40 seconds, 40 circulations.
A is DNA molecular amount label in Fig. 3, and B is the electrophorogram that Real-time PCR detects product, as the result is shown PCR Primer size is correct, and no miscellaneous band explanation is without non-specific amplification.
14, Western blot detection
This experiment uses polyclonal antibody [Rabbit the Anti-PPP2R3A antibody, # of PPP2R3A Ab126195, abcam], the expression situation to detect PPP2R3A in sample.With SuperSignal West Pico Chemiluminent Substrates carries out chemiluminescence detection, and exposes to X-ray.After developed fixing processing, film It is taken pictures with Labworks image acquisition and analysis software, is handled using Gel-Pro Analyzer software analysis.From fig. 4, it can be seen that steady with control group It sieves strain and compares (N- negative control；B- blanc cell group), 6328,6332,6333 interference groups, which surely sieve strain, apparent interference effect.
Apoptosis caused by 2 cell flow cytometer detection MRNAi of embodiment
1. experimental material and reagent:
(1) AnnexinV-PE/7-AAD apoptosis detection kit (KGA1017)
(2) BD FACS Calibur flow cytometer
2. step:
(1) after group of cells is passaged to 48h, with the trypsin digestion cell for being free of EDTA, cell, microcentrifugation is collected by centrifugation Machine revolving speed 2000RPM, centrifugation time 5min abandon culture medium；
(2) cell (2000RPM, centrifugation time 5min collect cell) twice is washed with cold PBS；
(3) 5ul7-AAD dye liquor is added in the Binding Buffer of 50ul, mixes；
(4) above-mentioned 7-AAD dye liquor is added in the cell of collection, mixes；Room temperature is protected from light, reacts 15 minutes；
(5) the Binding Buffer that 450ul is added after reacting is mixed；1ulAnnexin V-PE is added to mix, room Temperature is protected from light, reacts 15 minutes；
(6) flow cytomery is used in 1 hour.
3. result
Fig. 5 is using the cylindricality after flow cytomery Apoptosis, gone out according to the apoptosis data statistics that detected Figure.With control group (3N: interference negative control；B: blanc cell group) it compares, the early apoptosis of PPP2R3A interference group, advanced stage wither Die and dead cell shared by ratio be above control group, illustrate PPP2R3A gene by 6328 and 6332 interference after liver cancer There is apoptosis in cell.
The influence of the application CCK8 kit detection MRNAi cell proliferation of embodiment 3
1. group of cells, overnight incubation after passage, incline culture solution, cell is washed twice with 3ml PBS.2. adding 1ml Trypsin-EDTA solution after mixing, carefully sucks trypsin solution, and 37 DEG C are placed 3 minutes.
3. culture solution of the 6ml containing 10%FBS is added, piping and druming makes cell form single cell suspension.
4. blood counting chamber counts, cell is diluted to 5 × 105Cell/ml.
5. pressing 3 × 103The concentration of cells/well is inoculated with 96 orifice plates, while zeroing group group is arranged, i.e., is directly added in hole 100 μ 1DMEM culture mediums, every group sets 5 repetitions, in 37 DEG C of 5%CO after mixing2Culture.
6. to 0,24,48,72,96 hours, inclined culture solution, fresh 100 μ l of culture medium is added, every hole is protected from light addition 10 μ l of CCK8, is protected from light culture 3 hours, and microplate reader 450nm wavelength surveys OD value.
Fig. 6 be under the conditions of general CCK8 method detection different disposal group of cells in the proliferative conditions at corresponding time point (6328,6332 be respectively the interference stability strain of PPP2R3A gene；3N: interference negative control；B: blanc cell group), abscissa generation Table each corresponding time point, ordinate are represented using microplate reader in wavelength as the OD that measures under the conditions of 450nm450Readings.By in figure As can be seen that being compared with control group, the OD of each interference group of PPP2R3A450Readings is respectively less than control group.As the result is shown: PPP2R3A The proliferative ability of liver cancer cells of the gene after by 6328 and 6332 interference declines.
Influence of the embodiment 4.mRNAi to cell migration power
1. experimental material and reagent: DMEM culture medium+15%FBS, DMEM culture medium+5%FBS, PBS, Trypsin- EDTA Solution (0.25%Trypsin+0.53mM EDTA, Gibco), Matrigel (BD), 24 orifice plates and The cell transwell (Corning).
2. step
(1) HEPG2 group of cells cultivates to for 24 hours, removes complete medium, continues culture for 24 hours with 5%FBS culture medium；
(2) incline culture solution, washs cell twice with 3ml PBS；
(3) add 1ml Trypsin-EDTA solution, after mixing, carefully suck trypsin solution, 37 DEG C of placement 3-5 divide Clock；
(4) DMEM culture solution of the 2ml containing 5%FBS is being added, piping and druming makes cell form single cell suspension.Blood counting chamber It counts, cell is diluted to 3 × 105Cell/ml；
(5) 8 × 10 are pressed2The concentration of cells/well is inoculated in the cell transwell, and it is 15% that serum-concentration, which is added, in lower room Train liquid 700 μ l, 37 DEG C of 5%CO2Cultivate 48h；
(6) cell is taken out, PBS is washed once.The methanol of pre-cooling, -20 DEG C of fixed 10min are added；
(7) PBS is rinsed 3 times.Cell inversion is taken out, is air-dried；
(8) cell is put into a new 24-well, 0.1% crystal violet of 200ul is added, submerges film, 37 DEG C of dyeing 30min；
(9) ddH is used2O is washed 3 times.After cell air-dries, it is put into hole, several visuals field is taken under inverted microscope, counting of taking pictures.
3. result
Fig. 7 is the column analysis chart that mRNAi influences cell migration power, and abscissa represents the cell sample of different disposal, (6328,6332 be respectively the interference stability strain of PPP2R3A gene；LV3-NC: interference negative control；B: blanc cell group), it indulges and sits Mark represents the cell number across the cell transwell basilar memebrane.It is compared as can be seen from Figure with control group, PPP2R3A Each interference group is less than control group, and significant difference across the cell number of basilar memebrane.As the result is shown: PPP2R3A gene by 6328, the migration force decline of the liver cancer cells after 6332 interference.
Influence of the embodiment 5.mRNAi to cell invasion power
1. experimental material and reagent: DMEM culture medium+15%FBS, DMEM culture medium+5%FBS, PBS, Trypsin- EDTA Solution (0.25%Trypsin+0.53mM EDTA, Gibco), Opti-MEM I Reduced serum Medium (Gibco), Matrigel (BD), 24 orifice plates and the cell transwell (Corning).
2. step
(1) it is coated with basilar memebrane: diluting 50mg/LMatrigel by 1:6 with the DMEM culture solution containing 0.5%FBS, take 60 μ l It is coated with the upper chamber face of the cell Transwell bottom film, puts 37 DEG C of 5%CO2Incubator is incubated for 4 hours, is inhaled and is abandoned supernatant；
(2) HEPG2 group of cells cultivates to for 24 hours, removes complete medium, continues culture for 24 hours with 5%FBS culture medium；
(3) incline culture solution, washs cell twice with 3ml PBS；
(4) add 1ml Trypsin-EDTA solution, after mixing, carefully suck trypsin solution, 37 DEG C of placement 3-5 divide Clock；
(5) DMEM culture solution of the 2ml containing 5%FBS is being added, piping and druming makes cell form single cell suspension.Blood counting chamber It counts, cell is diluted to 3 × 105Cell/ml；
(6) 1 × 10 is pressed3The concentration of cells/well is inoculated in the cell transwell, and it is 15% that serum-concentration, which is added, in lower room Train liquid 700 μ l, 37 DEG C of 5%CO2Cultivate 48h；
(7) cell is taken out, PBS is washed once.The methanol of pre-cooling, -20 DEG C of fixed 10min are added；
(8) net methanol is abandoned, PBS is washed.The Matrigel glue for gently scraping off cell upper surface with cotton swab in PBS, uses PBS Wash upper surface 3 times.Cell inversion is taken out, is air-dried；
(9) cell is put into a new 24-well, 0.1% crystal violet of 200ul is added, submerges film, 37 DEG C of dyeing 30min；
(10) ddH is used2O is washed 3 times.After cell air-dries, it is put into hole, several visuals field is taken under inverted microscope, counting of taking pictures.
Fig. 8 is the column analysis chart that mRNAi influences cell invasion power, and abscissa represents the cell sample of different disposal (6328,6332 be respectively the interference stability strain of PPP2R3A gene；LV3-NC: interference negative control；B: blanc cell group), it indulges and sits Mark represents the cell number across the cell the transwell basilar memebrane for being coated with matrigel glue.As can be seen from Figure with it is right It is compared according to group, each interference group of PPP2R3A is less than control group across the cell number of basilar memebrane.As the result is shown: PPP2R3A base Because the invasiveness of the liver cancer cells after by 6328 and 6332 interference declines.
Research project of the present invention obtains project of national nature science fund project (81372595) and national great scientific research plan A Intermediate item (973 plan) (2014CBA02001) is subsidized.
Sequence table
<110>General Hospital, Chinese People's Armed Police Troop
<120>one kind is able to suppress hepatoma cell proliferation and invades active mRNAi and its application
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 63
<212> DNA
<213> Artifical
<400> 1
gatccggatt tcatccctct acttcattca agagatgaag tagagggatg aaatcctttt 60
ttg 63
<210> 2
<211> 63
<212> DNA
<213> Artifical
<400> 2
aattcaaaaa aggatttcat ccctctactt catctcttga atgaagtaga gggatgaaat 60
ccg 63
<210> 3
<211> 59
<212> DNA
<213> Artifical
<400> 3
gatccgccct tgccattcca tgatttcaag agaatcatgg aatggcaagg gcttttttg 59
<210> 4
<211> 59
<212> DNA
<213> Artifical
<400> 4
aattcaaaaa agcccttgcc attccatgat tctcttgaaa tcatggaatg gcaagggcg 59
<210> 5
<211> 63
<212> DNA
<213> Artifical
<400> 5
gatccgcaga atggctcaca tcttctttca agagaagaag atgtgagcca ttctgctttt 60
ttg 63
<210> 6
<211> 63
<212> DNA
<213> Artifical
<400> 6
aattcaaaaa agcagaatgg ctcacatctt cttctcttga aagaagatgt gagccattct 60
gcg 63
<210> 7
<211> 63
<212> DNA
<213> Artifical
<400> 7
gatccggaga aatacttaga ccatgattca agagatcatg gtctaagtat ttctcctttt 60
ttg 63
<210> 8
<211> 63
<212> DNA
<213> Artifical
<400> 8
aattcaaaaa aggagaaata cttagaccat gatctcttga atcatggtct aagtatttct 60
ccg 63
<210> 9
<211> 61
<212> DNA
<213> Artifical
<400> 9
gatccgttct ccgaacgtgt cacgtttcaa gagaacgtga cacgttcgga gaactttttt 60
g 61
<210> 10
<211> 61
<212> DNA
<213> Artifical
<400> 10
aattcaaaaa agttctccga acgtgtcacg ttctcttgaa acgtgacacg ttcggagaac 60
g 61

Claims (10)

1. a kind of inhibition hepatoma cell proliferation and the active mRNAi of invasion, which is characterized in that the mRNAi is DNA double chain, The sequence of positive-sense strand and antisense strand is as shown in SEQ ID NO.1 and SEQ ID NO.2, or such as SEQ ID NO.3 and SEQ ID Shown in NO.4, perhaps as shown in SEQ ID NO.5 and SEQ ID NO.6 or such as SEQ ID NO.7 and SEQ ID NO.8 institute Show.
2. a kind of carrier containing mRNAi described in claim 1.
3. carrier according to claim 2, which is characterized in that the carrier is LV3 carrier.
4. a kind of incasing cells containing carrier described in claim 3.
5. cell according to claim 4, which is characterized in that the cell is 293T cell.
6. a kind of slow virus containing mRNAi described in claim 1.
7. a kind of pharmaceutical composition containing mRNAi described in claim 1.
8. application of the mRNAi described in claim 1 in preparation tumor therapeutic agent.
9. application according to claim 8, the tumor therapeutic agent is liver neoplasm therapeutic agent.
10. a kind of packing method of slow virus described in claim 6, the described method comprises the following steps:
(1) mRNAi as described in claim 1 is cloned into LV3 carrier；
(2) carrier and packaging helper plasmid that step (1) obtains are transfected into 293T cell；
(3) cell that incubation step (3) obtains；
(4) it collects cell conditioned medium culture solution and the slow virus for obtaining packaging is concentrated.
CN201711480875.6A 2017-12-29 2017-12-29 mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof Active CN109988760B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711480875.6A CN109988760B (en) 2017-12-29 2017-12-29 mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711480875.6A CN109988760B (en) 2017-12-29 2017-12-29 mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof

Publications (2)

Publication Number Publication Date
CN109988760A true CN109988760A (en) 2019-07-09
CN109988760B CN109988760B (en) 2021-03-30

Family

ID=67109151

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711480875.6A Active CN109988760B (en) 2017-12-29 2017-12-29 mRNAi for inhibiting liver cancer cell proliferation and invasion activity and application thereof

Country Status (1)

Country Link
CN (1) CN109988760B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1852974A (en) * 2003-06-09 2006-10-25 密歇根大学董事会 Compositions and methods for treating and diagnosing cancer
WO2007062243A2 (en) * 2005-11-28 2007-05-31 Choongwae Pharma Corporation Serum-free expansion of cells in culture
CN106480022A (en) * 2015-08-27 2017-03-08 杨光华 Interfere fragment and its application
CN106754928A (en) * 2016-12-28 2017-05-31 中国人民武装警察部队总医院 A kind of RNAi and its application in cancer treatment drug is prepared

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1852974A (en) * 2003-06-09 2006-10-25 密歇根大学董事会 Compositions and methods for treating and diagnosing cancer
WO2007062243A2 (en) * 2005-11-28 2007-05-31 Choongwae Pharma Corporation Serum-free expansion of cells in culture
CN106480022A (en) * 2015-08-27 2017-03-08 杨光华 Interfere fragment and its application
CN106754928A (en) * 2016-12-28 2017-05-31 中国人民武装警察部队总医院 A kind of RNAi and its application in cancer treatment drug is prepared

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KAREN ZWAENEPOEL等: "Protein phosphatase 2A PR130/B α1 subunit binds to the SH2 domain-containing inositol polyphosphate 5-phosphatase 2 and prevents epidermal growth factor (EGF)-induced EGF receptor degradation sustaining EGF-mediated signaling", 《THE FASEB JOURNAL》 *
Y ITO等: "Expression and clinical significance of erb-B receptor family in hepatocellular carcinoma", 《BRITISH JOURNAL OF CANCER》 *
蒋丽: "EGFR信号通路调控人肝细胞癌细胞增殖的分子机制的研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 *

Also Published As

Publication number Publication date
CN109988760B (en) 2021-03-30

Similar Documents

Publication Publication Date Title
Liu et al. MiR-155 targets TP53INP1 to regulate liver cancer stem cell acquisition and self-renewal
Chen et al. Downregulation of the circadian rhythm regulator HLF promotes multiple-organ distant metastases in non-small cell lung cancer through PPAR/NF-κb signaling
Liu et al. Sulforaphane targets cancer stemness and tumor initiating properties in oral squamous cell carcinomas via miR-200c induction
Spaccarotella et al. STAT3-mediated activation of microRNA cluster 17~ 92 promotes proliferation and survival of ALK-positive anaplastic large cell lymphoma
US11234968B2 (en) Use of VCP inhibitor and oncolytic virus in the preparation of an anti-tumor drug
CN109837306A (en) Contain the excretion body and its preparation method and application of miRNA-204-5p
Shi et al. Functional differences of miR-125b on the invasion of primary glioblastoma CD133-negative cells and CD133-positive cells
CN115960742B (en) Lactobacillus fermentum XJC with functions of prolonging service life of dermal fibroblasts and resisting skin aging and application thereof
CN115300512B (en) Use of ATR inhibitor VE-822 in the treatment of lung adenocarcinoma
CN115969980B (en) Application of RNA helicase DHX33 inhibitor in preparation of medicine for treating gastric cancer
CN110452907A (en) Target the ASO of long-chain non-coding RNA DDX11-AS1, kit and application in the treatment of liver cancer
Liu et al. MiR-601 inhibits the proliferation and metastasis of esophageal squamous cell carcinoma (ESCC) by targeting HDAC6.
CN108004322B (en) Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma
EP3597739A1 (en) Composition for regulating cancer cell division or differentiation comprising setdb1 or a setdb1 inhibitor
CN112494654B (en) Pharmaceutical composition containing LncRNA HCG18 inhibitor and application thereof
Wang et al. LncRNA LACAT1 promotes proliferation of oral squamous cell carcinoma cells by inhibiting microRNA-4301.
CN106591308A (en) Human pulmonary carcinoma erlotinib drug tolerance improving shRNA
CN109988760A (en) A kind of inhibition hepatoma cell proliferation and invade active mRNAi and its application
CN101352448B (en) Use of Liriope muscari Bailey C in pharmacy
CN106754928B (en) A kind of RNAi and its preparing the application in cancer treatment drug
WO2020113877A1 (en) Function and use of e2f6 inhibitor
CN115927617A (en) Application of LncRNA LINC01748 in glioma diagnosis, treatment and drug sensitivity improvement
CN111407758A (en) Application of cantharidin as miR-214-3p/Wnt/β -Catenin signal pathway inhibitor in preventing and treating osteosarcoma
CN114480256A (en) Glycyrrhetinic acid-induced oxidative stress and inflammatory reaction of liver cells and application thereof
CN110960546B (en) Application of MicroRNAs in preparation of reinforcing agent for treating liver cancer by sorafenib

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP01 Change in the name or title of a patent holder
CP01 Change in the name or title of a patent holder

Address after: 100039 No. 69, Yongding Road, Beijing, Haidian District

Patentee after: Third Medical Center, General Hospital of the Chinese PLA

Address before: 100039 No. 69, Yongding Road, Beijing, Haidian District

Patentee before: GENERAL HOSPITAL OF CHINESE PEOPLE'S ARMED POLICE FORCES