CN109985046B - 5 alpha-androst-3 beta, 5,6 beta-triol for the treatment of inflammation mediated optic neuropathy - Google Patents

Abstract

The invention discloses an application of 5 alpha-androstane-3 beta, 5,6 beta-triol, a deuteron thereof or a pharmaceutically acceptable salt thereof in preparing a medicament for treating inflammation-mediated optic neuropathy of a patient. The invention proves that the 5 alpha-androstane-3 beta, 5,6 beta-triol can obviously antagonize the activation of microglia and macrophage, inhibit inflammatory reaction so as to reduce the loss of rat optic ganglion cells caused by high intraocular pressure and reduce the loss of retina ganglion cell axons, thereby being capable of being used for treating inflammation-mediated optic neuropathy.

Description

5 alpha-androst-3 beta, 5,6 beta-triol for the treatment of inflammation mediated optic neuropathy

Technical Field

The invention relates to a new medical application of 5 alpha-androstane-3 beta, 5,6 beta-Triol (5 alpha-androst-3 beta, 5,6 beta-Triol, Triol), in particular to an application of 5 alpha-androstane-3 beta, 5,6 beta-Triol in the treatment of inflammation-mediated optic neuropathy.

Background

The optic neuropathy mainly comprises optic neuritis, optic atrophy, ischemic optic disc lesion, optic papillary edema and other diseases. Clinically, the diseases are common and difficult to treat, and the etiology is complicated. The optic nerve (optic nerve) is formed by the collection of axon axons extending from the innermost Retinal Ganglion Cells (RGCs), i.e., optic nerve fibers. The damage to optic nerve is caused by many reasons, and the common causes include trauma, ischemia, poisoning, demyelination, tumor compression, inflammation, metabolism, syphilis and the like. Such damage to the optic nerve may occur anywhere in the optic nerve, including the optic ganglion cells and their axons, which is followed by partial or complete loss of visual function. For example, secondary death of a number of retinal ganglion cells following optic nerve injury is a major cause of irreversible visual function loss. While slowing or inhibiting secondary death of RGCs following optic nerve injury is the basis for effective treatment of optic nerve injury and promotion of recovery of visual function (luyanchun et al, 2009), demyelination of optic nerve axons is believed to be a possible cause of permanent loss of vision due to Multiple Sclerosis (MS).

Optic neuritis is a generic term for inflammation at any part of the optic nerve, and broadly refers to inflammatory demyelination, infection, nonspecific inflammation, and the like of the optic nerve. The role of inflammatory lesions in optic neuritic diseases is increasingly gaining importance (Costello f., 2014).

Glaucoma is the irreversible blinding eye disease which is the first eye in the world, and the number of global glaucoma patients reaches about 6000 thousands, and the number of blinding patients reaches about 800 thousands (Foster A)et al,2008). Gradual loss of Retinal Ganglion Cells (RGCs) and axonal damage are the fundamental features (Zhang X) et al2014), in which damage and death of RGC cells lead to optic nerve damage, which is the most important pathological change in glaucoma disease (superbuge et al, 2007). Various damaging mechanisms such as neurotrophic factor deprivation, protein misfolding, inflammation, glutamate excitotoxicity, and NO toxicity have been implicated in glaucoma-induced RGC injury or death by ocular hypertension (Baltmr A)et al,2010). Studies have shown that low grade inflammation plays an important role in the pathogenesis of glaucoma (Vohra R) et al,2013). While microglia are involved in the pathological process of glaucoma (Mac) et al， 2015）。

Diabetic Retinopathy (DR) is a common complication of diabetes and is the leading blinding eye disease in the 20 to 70 year old population. Persistent hyperglycemia, which leads to multiple cellular pathways involved in the pathogenesis of DR, leads to increased inflammation, oxidative stress and vascular dysfunction, is a "chronic, low-grade inflammatory retinal disease" in which inflammatory activation of microglia is involved in the pathological process (miena E) et al,2017). More and more studies have demonstrated that inflammatory factors are involved in the development of DR (xiemie et al, 2012). For example, tumor necrosis factor-alpha (TNF-alpha) and interleukin-1B (IL-1 beta), both of which are capable of producingProinflammatory proteins, such as cyclooxygenase 2(COX-2) and Inducible Nitric Oxide Synthase (iNOS), further induce inflammatory responses (Serhan CN) et al,2007). The appearance of these pro-inflammatory proteins was observed in early DR animal models, and inhibition of their effects was effective in preventing the progression of retinopathy (Adamis AP) et al，2008; Adamiec-Mroczek J et al，2010) 。

Traumatic optic nerve injury refers to partial or complete loss of visual function caused by external impact, and can be permanent or temporary, and is one of the important factors causing blindness due to trauma. Traumatic optic nerve injury is often accompanied by traumatic optic neuritis lesion (traumatic optic nerve), which is one of the common and serious complications in craniocerebral injury, accounting for about 2% -5% of craniocerebral trauma. Due to the anatomical structure and physiological characteristics, direct injury caused by puncturing the optic nerve with a sharp instrument and direct injury of other parts of the optic nerve are relatively rare clinically, and more than 90% of optic nerve injury is indirect injury of optic nerve duct segments. The indirect optic nerve injury refers to the visual disturbance and visual field disorder caused by optic nerve injury due to the deformation or fracture of optic nerve canal caused by external force transmitted to the optic nerve canal through skull. Lack of ideal treatment often results in irreversible loss of visual function to the patient. The mechanism of retinopathy after optic nerve contusion is very complex, and relates to multifactorial pathological changes such as inflammation, and in addition, a large amount of free radicals generated by the change of the microenvironment of retinal ganglion cells can cause secondary damage effect on retinal cells (Levkovitch-Verbin H) et al，2000）。

At present, the clinical application still lacks enough effective drugs for treating various optic neuropathy, so that the provision of a drug capable of effectively treating optic neuropathy has important clinical significance.

Disclosure of Invention

The inventor of the invention unexpectedly finds that the 5 alpha-androstane-3 beta, 5,6 beta-triol can obviously antagonize the activation of microglia and macrophages, inhibit inflammatory reaction so as to reduce the loss of rat optic ganglion cells caused by high intraocular pressure and reduce the loss of axons of retina ganglion cells, thereby being capable of being used for treating inflammation-mediated optic neuropathy.

In one aspect, the invention provides the use of 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for the treatment of inflammation-mediated optic neuropathy. In some embodiments, the inflammation-mediated optic neuropathy is selected from the group consisting of glaucoma, infectious optic neuritis, non-infectious optic neuritis, retinopathy associated with multiple sclerosis, diabetic retinopathy, and traumatic optic neuritis. In some embodiments, the inflammation-mediated optic neuropathy is manifested by activation of macrophages and/or microglia. In some embodiments, the inflammation-mediated optic neuropathy is manifested by loss of optic ganglion cells and/or loss of optic ganglion cell axons. In some embodiments, the medicament further comprises another therapeutic agent.

In another aspect, the invention provides a method of treating inflammation-mediated optic neuropathy in a patient, the method comprising administering to the patient an effective amount of 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof, or a pharmaceutically acceptable salt thereof. In some embodiments, the inflammation-mediated optic neuropathy is selected from the group consisting of glaucoma, infectious optic neuritis, non-infectious optic neuritis, retinopathy associated with multiple sclerosis, diabetic retinopathy, and traumatic optic neuritis. In some embodiments, the inflammation-mediated optic neuropathy is manifested by activation of macrophages and/or microglia. In some embodiments, the inflammation-mediated optic neuropathy is manifested by loss of optic ganglion cells and/or loss of optic ganglion cell axons.

In a further aspect, the present invention provides 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof, or a pharmaceutically acceptable salt thereof for use in the treatment of inflammation-mediated optic neuropathy in a patient. In some embodiments, the inflammation-mediated optic neuropathy is selected from the group consisting of glaucoma, infectious optic neuritis, non-infectious optic neuritis, retinopathy associated with multiple sclerosis, diabetic retinopathy, and traumatic optic neuritis. In some embodiments, the inflammation-mediated optic neuropathy is manifested by activation of macrophages and/or microglia. In some embodiments, the inflammation-mediated optic neuropathy is manifested by loss of optic ganglion cells and/or loss of optic ganglion cell axons.

Yet another aspect of the present invention provides a method of reducing or eliminating an inflammatory response in an optic neuropathy in a patient, the method comprising administering to the patient an effective amount of 5 α -androst-3 β,5,6 β -triol, a deutero-mate thereof or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising 5 α -androst-3 β,5,6 β -triol, a deutero-mate thereof or a pharmaceutically acceptable salt thereof. Yet another aspect of the invention provides a method of reducing or eliminating loss of optic ganglion cells in a patient, the method comprising administering to the patient an effective amount of 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof or a pharmaceutically acceptable salt thereof. Yet another aspect of the invention provides a method of reducing or eliminating loss of optic ganglion cell axons in a patient, the method comprising administering to the patient an effective amount of 5 α -androst-3 β,5,6 β -triol, a deutero thereof or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising 5 α -androst-3 β,5,6 β -triol, a deutero thereof or a pharmaceutically acceptable salt thereof. Yet another aspect of the present invention provides a method of reducing or eliminating activation of microglia and/or macrophages in an optical neuropathy in a patient, the method comprising administering to the patient an effective amount of 5 α -androst-3 β,5,6 β -triol, a deutero-mate thereof or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising 5 α -androst-3 β,5,6 β -triol, a deutero-mate thereof or a pharmaceutically acceptable salt thereof.

Drawings

FIG. 1 TRIOL blocks LPS and TNF- α induced phosphorylation of NF- κ B, p38 in RAW264.7 cells. Detecting the LPS of the Triol pair (A) by Western blot; (B) effect of NF-. kappa. B, p38 phosphorylation in RAW264.7 cells after TNF-. alpha.stimulation.

FIG. 2. Triol blocks nuclear translocation of the NF- κ B p65 subunit in macrophages after LPS stimulation. Immunofluorescence revealed the intracellular localization of NF-. kappa. B p65 subunit in RAW264.7 cells. (200X)

FIG. 3 Triol down-regulates mRNA levels of RAW264.7 cell inflammation-associated factors after LPS stimulation. RT-PCR detects changes in mRNA levels of various proinflammatory factors. RPLP0 is an internal control.

Figure 4. trio inhibits LPS-induced amoebic morphological changes in microglia BV 2. (A) Phase contrast microscopy of BV2 cell morphology (100 ×); (B) # ##: comparing with normal control groupPLess than 0.001; ***: comparison with LPS-treated groupP＜0.001。

FIG. 5. Triol blocks LPS-induced activation of the NF-. kappa.B signaling pathway in BV2 cells. (A) Detecting phosphorylation of NF-kappa B p65 subunit of BV2 cells by Western blot; (B) immunofluorescence revealed the intracellular localization of the NF-. kappa. B p65 subunit in BV2 cells. (200X)

FIG. 6. Triol blocks activation of NF-. kappa.B signaling pathway in primary cultured mouse glial cells following LPS stimulation. (A) Detecting phosphorylation of NF-kappa B p65 subunit and p38 of primary mouse microglia by Western blot; (B) immunofluorescence revealed the intracellular localization of the NF- κ B p65 subunit of primary microglia. (200X)

FIG. 7. TRIOL reduces LPS-induced release of NO, TNF- α from microglia BV 2. BV2 cell culture supernatant (A) Griess reagent method to detect NO content; (B) detecting the content of TNF-alpha by an ELISA method. # #: compared with the control groupPLess than 0.01; */**: compared with LPS-treated groupP＜0.05/0.01。

FIG. 8. Effect of Triol on LPS-induced release of primary microglial inflammation-associated factors. Detecting the NO content (A) of the culture supernatant of the primary microglia by using a Griess reagent method; ELISA was used to detect IL-6, TNF- α, and IL-10 levels (B, C, D). # #: compared with the control groupPLess than 0.01; */**/: compared with LPS-treated groupP＜0.05/0.01。

Figure 9. trio significantly reduced acute ocular hypertension-induced optic ganglion cell death. A. The HE staining of the retinas of rats in each group is 100-200 mu m on the left and right sides of the optic disc. GCL: the optic nerve ganglion cell layer; IPL: an inner mesh layer; INL: an inner core layer; OPL: an outer mesh layer; ONL: an outer core layer;the medicine is injected into vitreous cavity (i.v.iIntraviral injection). B. The number of RGCs per mm of retinal ganglion layer was counted for each group of rats. Cell counts and RGCs layer length measurements were processed using Image Pro Plus software and statistical methods used One-way Anova and post-hoc Dunnet test for pairwise comparisons using One-way Anova. *,p < 0.05；**，p < 0.01；n.s.no design N = 9-12. C. The average number of RGCs per mm of retinal ganglion layer of rats in each group and the number of animals in each group.

Figure 10. trio significantly reduced axonal damage in rat retinal RGCs caused by acute ocular hypertension.

Figure 11. Triol significantly reduced inflammatory activation of optic microglia induced by acute ocular hypertension. A. Each group of rats had an immunohistochemical staining of the optic microglia Iba 1. The brown signal is the microglia activation marker Iba1, and the blue is hematoxylin nuclear dye. The scale bar is 50 μm. B. And counting the activated quantity of the optic nerve microglia of each group of rats in unit area. Cells with enlarged cell bodies, pseudopodic elongation and Iba1 deep staining were defined as activated microglia and cell counts and tissue area measurements were performed using Image Pro Plus software. Statistical methods One-way Anova and post-hoc dunnoute t test were compared pairwise using One-way Anova and post-hoc dunnoute t test,p < 0.05；**，p < 0.01；***，p < 0.001；n.s.and no signalicicane N =3. c. statistics of relative expression of the rat optic nerve microglia activation marker Iba1 in each group. The Iba1 expression level is a relative value normalized by the relative optical density value (IOD) of Iba1 of the normal group. IOD values and tissue area were measured using Image Pro Plus software. Statistical methods two-by-two comparisons were performed using the nonparametric test Kruska Wallis rank sum test and post-hoc LSD test,p < 0.05，N=3。

Detailed Description

As used herein, the term "composition" refers to a formulation suitable for administration to a desired animal subject for therapeutic purposes, which contains at least one pharmaceutically active ingredient, e.g., a compound. Optionally, the composition further comprises at least one pharmaceutically acceptable carrier or excipient.

The term "pharmaceutically acceptable" means that the substance does not possess properties that would allow a reasonably prudent medical practitioner to avoid administering the substance to a patient, given the disease or condition to be treated and the respective route of administration. For example, for injectables, it is often desirable that such substances be substantially sterile.

As used herein, the terms "therapeutically effective amount" and "effective amount" mean that the substance or amount of substance is effective to prevent, alleviate or ameliorate one or more symptoms of a disease or disorder, and/or prolong the survival of the subject being treated.

As used herein, "treating" includes administering a compound of the present application, or a pharmaceutically acceptable salt thereof, to alleviate a symptom or complication of a disease or condition, or to eliminate a disease or condition. The term "alleviating" as used herein is used to describe the process of reducing the severity of signs or symptoms of a disorder. Symptoms can be reduced without elimination. In one embodiment, administration of the pharmaceutical composition of the present application results in elimination of the signs or symptoms.

5 alpha-androstane-3 beta, 5,6 beta-triol, deuterons thereof and pharmaceutically acceptable salts thereof

The 5 alpha-androstane-3 beta, 5,6 beta-Triol is also referred to herein as "Triol" or "the compound of the invention" and has the structural formula shown in formula (I). Triol has been shown to be a neuronal protective agent effective against acute ischemic-hypoxic brain injury.

(formula I)

The compounds of the present invention may be formulated in the form of pharmaceutically acceptable salts. Contemplated pharmaceutically acceptable salt forms include, but are not limited to, mono-, di-, tri-, tetra-, and the like. Pharmaceutically acceptable salts are non-toxic in the amounts and concentrations at which they are administered. The preparation of such salts may facilitate pharmacological applications by altering the physical properties of the compounds without preventing them from exerting their physiological effects. Useful changes in physical properties include lowering the melting point for transmucosal administration, and increasing solubility for administration of higher concentrations of drug.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, mesylate, esylate, benzenesulfonate, p-toluenesulfonate, cyclamate, and quinic acid salts. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclamic acid, fumaric acid, and quinic acid.

Pharmaceutically acceptable salts also include base addition salts when acidic functional groups such as carboxylic acids or phenols are present, such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethanolamine, tert-butylamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine, and zinc. Such salts can be prepared using the appropriate corresponding bases.

Pharmaceutically acceptable salts can be prepared by standard techniques. For example, the compound in free base form is dissolved in a suitable solvent, such as an aqueous or aqueous-alcoholic solution containing a suitable acid, and the solution is evaporated for isolation. In another example, salts are prepared by reacting the free base and the acid in an organic solvent.

Thus, for example, if a particular compound is a base, the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art, e.g., by treating the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, or an organic acid, such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, an amino acid, such as aspartic acid or glutamic acid, an aromatic acid, such as benzoic acid or cinnamic acid, a sulfonic acid, such as p-toluenesulfonic acid or ethanesulfonic acid, or the like.

Likewise, if a particular compound is an acid, the desired pharmaceutically acceptable salt can be prepared by any suitable method, for example, by treating the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary), an alkali or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids (e.g., L-glycine, L-lysine, and L-arginine), ammonia, primary, secondary, and tertiary amines, and cyclic amines (e.g., hydroxyethylpyrrolidine, piperidine, morpholine, and piperazine), and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium.

Pharmaceutically acceptable salts of the compounds may exist as complexes. Examples of the complex include 8-chlorophylline complex (analogous to, for example, theohydramine: diphenhydramine 8-chlorophylline (1:1) complex; haloainin) and various cyclodextrin-containing complexes.

The invention also contemplates the use of pharmaceutically acceptable deuterated or other non-radioactively substituted compounds of the compounds. The deuteration is to replace one or more or all hydrogen in the active molecular groups of the medicine with isotope deuterium, and because the deuterium is non-toxic and non-radioactive, and is stabilized by about 6-9 times compared with a carbon-hydrogen bond, the deuterium can seal metabolic sites to prolong the half-life period of the medicine, so that the treatment dosage is reduced, and the pharmacological activity of the medicine is not influenced, and the deuterium is considered to be an excellent modification method.

Pharmaceutical composition

In the present invention, "pharmaceutical composition" refers to a composition comprising a trio compound and a pharmaceutically acceptable carrier, wherein the compound and the pharmaceutically acceptable carrier are present in the composition in admixture. The compositions will generally be used for the treatment of human subjects. However, they may also be used to treat similar or identical conditions in other animal subjects. As used herein, the terms "subject," "animal subject," and similar terms refer to humans and non-human vertebrates, e.g., mammals, such as non-human primates, sports and commercial animals, such as horses, cows, pigs, sheep, rodents, and pets, such as dogs and cats.

Suitable dosage forms depend, in part, on the use or route of administration, e.g., oral, transdermal, transmucosal, inhalation, or by injection (parenteral). Such dosage forms should enable the compound to reach the target cell. Other factors are well known in the art, including considerations such as toxicity and the dosage form that delays the compound or composition from exerting its effect.

Carriers or excipients may be used to produce the composition. The carrier or excipient may be selected to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars (e.g. lactose, glucose or sucrose), or starch types, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile water for injection (WFI), saline solutions and glucose.

The compositions or components of the compositions may be administered by different routes, including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectal, transdermal or inhalation. In some embodiments, injections or lyophilized injections are preferred. For oral administration, for example, the compounds may be formulated in conventional oral dosage forms such as capsules, tablets, as well as liquid preparations such as syrups, elixirs, and concentrated drops.

Pharmaceutical preparations for oral use can be obtained, for example, by combining the composition or its components with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragees. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, for example maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose (CMC) and/or polyvinylpyrrolidone (PVP: Povidone). If desired, disintegrating agents may be added, such as cross-linked polyvinylpyrrolidone, agar or alginic acid or a salt thereof, such as sodium alginate.

Alternatively, injection (parenteral administration), e.g., intramuscular, intravenous, intraperitoneal, and/or subcutaneous, may be used. For injection, the compositions of the invention or components thereof are formulated as sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. In addition, the compositions or components thereof may be formulated in solid form and redissolved or suspended immediately prior to use. Also can be produced in the form of freeze-dried powder.

Administration may also be by transmucosal, topical, or transdermal means. For transmucosal, topical, or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate penetration. Transmucosal administration, for example, can be through a nasal spray or suppository (rectal or vaginal).

Effective amounts of the various components to be administered can be determined by standard procedures, taking into account factors such as the compound IC₅₀The biological half-life of the compound, the age, size and weight of the subject, and conditions associated with the subject. The importance of these and other factors is well known to those of ordinary skill in the art. In general, the dose will be between about 0.01mg/kg and 50mg/kg, preferably between 0.lmg/kg and 20mg/kg of the subject being treated. Multiple doses may be used.

The compositions of the invention or components thereof may also be used in combination with other therapeutic agents for the treatment of the same disease. Such combined use includes administering the compounds and one or more other therapeutic agents at different times, or simultaneously administering the compounds and one or more other therapeutic agents. In some embodiments, the dosage of one or more compounds of the invention or other therapeutic agents used in combination may be modified, for example, by reducing the dosage relative to the compound or therapeutic agent used alone by methods known to those skilled in the art.

It is to be understood that the combined use or combination includes use with other therapies, drugs, medical procedures, and the like, wherein the other therapies or procedures may be administered at a time other than the composition of the invention or a component thereof (e.g., within a short period of time (e.g., several hours, such as 1, 2, 3, 4-24 hours) or within a longer period of time (e.g., 1-2 days, 2-4 days, 4-7 days, 1-4 weeks) or at the same time as the composition of the invention or a component thereof. They are delivered by the same or different routes of administration.

The combined administration of any route of administration includes delivery of the composition of the invention or components thereof and one or more other pharmacotherapeutic agents together by the same route of administration in any formulation, including formulations in which the two compounds are chemically linked and which retain their respective therapeutic activities upon administration. In one aspect, the additional drug therapy may be co-administered with the composition of the invention or a component thereof. Combined use by co-administration includes administration of co-formulations (co-formulations) or formulations of chemically linked compounds, or administration of the compounds in two or more separate formulations, administered by the same or different routes, within a short period of time (e.g., within one hour, within 2 hours, within 3 hours, up to 24 hours).

Co-administration of separate formulations includes co-administration via delivery from one device, e.g., the same inhalation device, the same syringe, etc., or by different devices within a short period of time relative to each other. Co-formulations of the compounds of the invention and one or more additional pharmaceutical therapies delivered by the same route of administration include materials prepared together so that they can be administered by one device, including different compounds combined in one formulation, or compounds modified so that they are chemically linked together but retain their respective biological activities. Such chemically linked compounds may include a linker that separates the two active ingredients, which linker is substantially maintained in vivo, or may degrade in vivo.

Examples

Example 1 Triol inhibits LPS and TNF-alpha induced activation of inflammatory signaling pathway molecules in peripheral macrophages

Method

Culturing, grouping and processing a mouse macrophage strain RAW 264.7: reference is made to the method of Zhao et al (Zhao Q)et al,2012) And (3) culturing: mouse macrophage strain RAW264.7 cells were cultured in DMEM complete medium containing 10% fetal calf serum, 100U/mL penicillin and 0.1 mg/mL streptomycin, and 5% CO was added₂Culturing and subculturing in a constant-temperature closed incubator (relative humidity 95%) at 37 ℃, and observing the growth condition by an inverted microscope. And (4) carrying out passage once for about 2-3 days, and taking the cells in the logarithmic growth phase for formal experiments.

RAW264.7 cells in logarithmic growth phase were grouped as follows:

group of	Treatment of
		Normal control	Untreated
LPS (or TNF-alpha) treatment	100 ng/ml LPS (or 10 ng/ml TNF-. alpha.)
		Solvent control	LPS (or TNF-. alpha.) treatment + 20% HP-. beta. -CD
Triol treatment	LPS (or TNF-. alpha.) treatment + respective concentrations of Triol

The solvent control group was given 20% HP- β -CD by the amount of the highest concentration of Triol administered; triol treatment was given at 5 concentrations of 0.1, 0.5, 1, 5 and 10. mu.M, respectively, and pre-conditioned for 30min prior to LPS (or TNF-. alpha.) stimulation.

Protein content detection and immunoblot detection: reference is made to the method of molecular cloning guidelines (Joseph Sambrook, David w. russell, chemical industry publishers, 2008): RAW264.7 cells in logarithmic growth phase were seeded in 6-well plates with cell density adjusted. Removing serum from cells, culturing for 24 hr, treating with Triol for 30min, adding LPS or TNF-alpha, stimulating for 30min or 15min, extracting total cell protein, measuring protein concentration, collecting protein sample 20 μ g, adding 5 xSDS protein loading buffer, boiling for 5min, and separating by 10% SDS-polyacrylamide gel electrophoresis; transferring the separated protein to a PVDF membrane by a wet transfer method, and carrying out liquid-temperature sealing for 1h by using a liquid containing 5% of skimmed milk powder TBST; adding diluted primary antibody, and incubating overnight at 4 ℃; washing with TBST for 3 times (5 min each time), adding corresponding secondary antibody, incubating at room temperature with shaking for 1h, and washing with TBST for 4 times (5 min each time). And (5) performing color development photographing by using a chemiluminescence method.

Subcellular immunofluorescence localization: reference is made to the method of Zhao et al (see above): different cells in logarithmic growth phase were digested with 0.25% pancreatin to adjust the cell concentration to 1X 10⁵One/ml, seeded in 48-well plates, 200. mu.l/well. After 80% confluence, cells were stimulated with 100 ng/ml LPS for 30 min. Fixing 4% paraformaldehyde at room temperature for 15min, washing with PBS solution for 5min for 3 times; then adding ice-cold 100% methanol, incubating at-20 deg.C for 10min, rinsing with PBS solution for 5 min; adding goat serum blocking solution, and blocking at room temperature for 1 h; adding the diluted antibody, and incubating overnight at 4 ℃; washing with PBS for 5min for 3 times the next day, adding corresponding fluorescent secondary antibody, shaking and incubating for 1h at room temperature in dark place, and washing with PBS for 2 times for 5min each time; then adding Hoechst 33342, incubating for 10min, washing with PBS solution for 2 times, observing under a fluorescent microscope, and taking a picture.

And (3) expression detection: reference to the molecular cloning guidelines method (see above): RAW264.7 cells in logarithmic growth phase were seeded in 6-well plates at adjusted cell density, cells were stimulated with 100 ng/ml LPS for 6h, 12h, 24h, total RNA was collected and stored at-80 ℃. The first strand of cDNA was synthesized by reverse transcription using M-MuLV reverse transcriptase, and PCR was performed using the primers upstream and downstream of the following genes. Reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, pre-denaturation at 94 ℃ for 45 s, pre-denaturation at 58 ℃ for 2min, pre-denaturation at 72 ℃ for 1min, and pre-denaturation at 72 ℃ for 7min after 31 cycles. And identifying the amplification result by agarose gel electrophoresis. The primer sequences were synthesized by Shanghai bioengineering, Inc. as follows.

COX-2：TCTCAGCACCCACCCGCTCA; GCCCCGTAGACCCTGCTCGA

iNOS：GTGCTGCCTCTGGTCTTGCAAGC; AGGGGCAGGCTGGGAATTCG

IL-1β：TGCTTCCAAACCTTTGACCTGGGC; CAGGGTGGGTGTGCCGTCTTTC

IL-6：GCTGGAGTCACAGAAGGAGTGGC; GGCATAACGCACTAGGTTTGCCG

CCR2：GAGCCTGATCCTGCCTCTACTTG; CTCTTCTTCTCATTCCTACAGCGA

MCP-1：ACTCACCTGCTGCTACTCATTCAC; CTTCTTTGGGACACCTGCTGCT

TNF-α：CTTGTCTACTCCCAGGTTCTCTT; GATAGCAAATCGGCTGACGG

RPLP0：CTGAGATTCGGGATATGCTGTTG; GTCCTAGACCAGTGTTCTGAGC

Statistical treatment: all counting data were subjected to 3 or more independent experiments, and the results were expressed as mean ± standard deviation and were counted using SPSS software.P<0.05 indicated a significant statistical difference.

Results

As can be seen in FIG. 1, Triol significantly blocked LPS and TNF- α induced phosphorylation of NF-. kappa.B and p38, molecules of the RAW264.7 cellular inflammation-associated signaling pathway. FIG. 2 shows that LPS stimulation translocates the NF-. kappa. B p65 subunit from the cytoplasm of RAW264.7 cells into the nucleus, and that Triol can block this nuclear translocation of NF-. kappa.B. FIG. 3 shows that Triol significantly inhibited the gene expression of proinflammatory factors such as IL-1 β, TNF- α, IL-6, Cox-2, iNos, CCR2 and MCP-1 in RAW264.7 cells after LPS induction.

The results show that the Triol obviously blocks the phosphorylation and nuclear translocation of macrophages NF-kappa B and p38 induced by inflammatory stimulating factors and the gene transcription of inflammatory factors such as intracellular IL-1 beta and the like, and the Triol inhibits the activation of peripheral macrophage inflammatory signal channel molecules and the synthesis of the inflammatory factors induced by LPS and TNF-alpha.

Example 2 Triol inhibits the activation of microglia and their inflammatory pathway molecules

Microglia (microglia) are generally considered to be monocytes that localize to or translocate to central nervous tissue, perform a similar function to macrophages of other tissues in the periphery, and are the first layer and the major immune defense barrier of central nervous tissue. Meanwhile, the compound plays a key role in the inflammatory reaction process of central nervous systems such as brain tissues and the like, and the over-activation of the compound is an important factor for the damage of the nervous tissues.

The inventor has proved that the Triol can inhibit the activation of peripheral macrophage inflammatory pathway molecules, and the experiment uses LPS to stimulate mouse microglial cell strain BV2 cells and primary cultured mouse microglia on the basis of the above to investigate whether the Triol also has the inhibition effect on the activation of central inflammatory cells and inflammatory pathway molecules thereof.

Method

Culture of mouse microglial cell strain BV 2: reference is made to the method of Ortega et al (Ortega FJ)et al,2012）。

Isolation and culture, grouping and treatment of primary mouse microglia: according to McCarthy et al (McCarthy KD) et al1980), 1 day old Balb/c mice were taken, the cortex was separated under aseptic conditions, the mice were placed on ice to remove meninges and blood vessels, and the mice were cut into 1 mm pieces by ophthalmic scissors³The tissue pieces of the size were then digested in a digestive solution containing 0.25 g/L pancreatin for 15 minutes at 37 ℃; adding a blowing-off solution of 0.5 g/L pancreatin inhibitor and 0.05 g/L DNase I to terminate digestion, blowing off to obtain a single cell suspension, centrifuging for 5 minutes at 200 g, washing the precipitate for 1 time by using a blowing-off solution, and centrifuging for 5 minutes at 200 g; discarding the supernatant, and diluting the precipitate with DMEM medium containing 10% (v/v) FBS until the cell density is 1.5-1.8 × 10⁶cells/mL, inoculated in a culture flask, placed in 5% CO₂And culturing in an incubator at 37 ℃. Changing the culture medium on the third day after inoculation, continuously culturing for 10-14 days, separating and purifying microglia by a mild trypsin digestion method when the mixed cultured glial cells grow over the culture bottle, adding 0.0625% of pancreatin, performing mild digestion at 37 ℃ for 30-40min, stopping digestion when the upper layer cells fall off, removing the falling liquid, continuously adding pancreatin for digestion for about 30min, collecting supernatant, centrifuging to obtain the microglia, and plating the cells for experiments.

Grouping and processing: BV2 cells in the logarithmic growth phase and mature primary microglia were grouped as follows:

group of	Treatment of
		Normal control	Untreated
LPS treatment
		100 ng/ml LPS
Solvent control
		100 ng/ml LPS + 20% HP-β-CD
Triol treatment
		100 ng/ml LPS + respective concentrations of Triol

The solvent control group was given 20% HP- β -CD by the amount of the highest concentration of Triol administered; triol treatment gave 5 concentrations of 0.1, 0.5, 1, 5 and 10. mu.M, respectively.

And (3) observing cell morphology: reference is made to the method of Ortega et al: BV2 cells in logarithmic growth phase were taken, digested with 0.25% pancreatin, adjusted for cell concentration, and plated in 6-well plates. After 24h, pre-treated with 5 μ M Triol for 30min, and then LPS was added to a final concentration of 100 ng/ml; LPS only treatment is taken as a positive control; the group without any treatment was negative control. After 24 hours of treatment, amoeba-like cells were observed under a phase contrast microscope and counted, and the data were statistically analyzed. Activation rate-amoeba-like microglia number/total microglia number × 100%.

Results

As shown in FIG. 4, LPS stimulated mouse microglial strain BV2 cells exhibited largely amoeba-like (amoeboid) activated morphology, and 5. mu.M Triol could significantly block this change in BV2 cells. FIG. 5 shows that Triol inhibits LPS-induced phosphorylation of NF- κ B p65 subunit of BV2 cells and its translocation from cytoplasm to nucleus. FIG. 6 shows that Triol can also block LPS-induced phosphorylation of NF- κ B p65 subunit of mouse primary microglia and its nuclear translocation.

The trio inhibits LPS-induced amoeblike morphological change of mouse BV2 microglia, phosphorylation and nuclear translocation of BV2 cell NF-kappa B; triol also blocks the phosphorylation and nuclear translocation of mouse primary microglia NF-kB induced by LPS, which shows that Triol can inhibit the activation of microglia and the activation of intracellular inflammation signal channel molecules, and shows that Triol can inhibit the inflammatory reaction of microglia.

Example 3 Triol inhibits the release of proinflammatory factors and promotes the release of inflammation inhibitors

The balance of proinflammatory and inflammation suppressing factors is disrupted in the central nervous system under physiological conditions, together with activated inflammatory cells, by a variety of mechanisms that initiate or exacerbate the damaging inflammatory response of central tissues.

On the basis of proving that the Triol can inhibit the activation of inflammatory cells and intracellular inflammatory pathway molecules, the experiment utilizes the same inflammatory reaction cell model and examines the influence of the Triol on the release of inflammatory related factors by an enzyme-linked immunosorbent assay (ELISA) method.

Method

BV2 cell grouping and processing: BV2 cells in the logarithmic growth phase and mature primary microglia were grouped as follows:

group of	Treatment of
		Normal control	Untreated
LPS treatment
		100 ng/ml LPS
Solvent control
		100 ng/ml LPS + 20% HP-β-CD
Triol treatment
		100 ng/ml LPS + respective concentrations of Triol

The solvent control group was given 20% HP- β -CD by the amount of the highest concentration of Triol administered; triol treatment was given at 4 concentrations of 0.5, 1, 5 and 10. mu.M, respectively.

Inflammation mediator and cytokine detection: the cells of each group were digested with 0.25% of pancreatic enzyme to adjust the cell concentration to 1X 10⁵One/ml, seeded in 48-well plates, 200. mu.l/well. After the cells are 80% confluent, the cells are treated by using the medicines according to groups (the cells are pretreated for 30min at each concentration of YC 6) for 24h, cell supernatant is collected, the cell supernatant is stored at the temperature of minus 20 ℃, and the contents of NO, TNF-alpha, IL-6, IL-10 and the like are measured on a microplate reader after the cell supernatant is treated according to the instruction of a kit.

Results

FIG. 7 shows that 100 ng/ml LPS stimulation dramatically increased NO and TNF- α release from BV2 microglia, while 0.5-10 μ M Triol dose-dependently reduced the release of both pro-inflammatory factors. FIG. 8 shows that 100 ng/ml LPS induces the release of primary microglial proinflammatory factors NO, TNF- α and IL-6, while stimulating the release of the inflammation inhibitory factor IL-10, while 1 μ M or 5 μ M Triol significantly inhibited the release of NO, TNF- α and IL-6 and further promoted the release of IL-10.

The release of the proinflammatory factor and the inflammation inhibitor IL-10 is simultaneously up-regulated by the Triol, which shows that the Triol can obviously inhibit the microglia-mediated inflammation, and the Triol is suggested to have the effect of inhibiting the generation and development of central inflammation reaction.

Example 4 Triol alleviates optic neuropathy caused by acute ocular hypertension

The anti-inflammatory and related drug effects of steroid compound Triol are evaluated on an acute glaucoma optic neuropathy change model induced by high intraocular pressure.

Method

Acute ocular hypertension surgery: 1) grouping and preoperative general anesthesia: weighing 60 rats, randomly dividing into 5 groups according to the body weight, wherein each group comprises 12 rats which are respectively an unoperated Control group, an intraocular pressure (High IOP) treatment group, a Triol (High IOP) medicament treatment group 1 (High IOP + Triol (40 μ g)), a Triol medicament treatment group 2 (High IOP + Triol (80 μ g)) and an HP-beta-CD (High IOP + HP-beta-CD) solvent treatment group, and injecting 10% chloral hydrate into the abdominal cavity according to the body weight to anaesthetize the rats; 2) mydriasis: 1% tropicamide (tropicamide) was dropped into the eye for mydriasis; local anesthesia: the 0.5% tetracaine hydrochloride eye drops infiltrate the cornea of the eye to perform local anesthesia; intraocular pressure rising: the right anterior chamber was tunneled with a 30G needle and given balanced salt solution to elevate intraocular pressure (about 130 mmHg) for 60 min. Performing blank comparison on the left eye; 3) intravitreal injection administration: removing the injection needle after 60min treatment, puncturing the vitreous cavity below the iris with a 30G needle connected with a microinjector, injecting 4 or 8 ul/piece of corresponding medicine into each group of rats, stopping the needle in the vitreous cavity for 30s after injection, quickly pulling out, and coating with cortisone eye ointment for tetracycline treatment to prevent intraoperative infection

Retinal sample fixation, embedding and sectioning: 1) the rats in each group were sacrificed after 48h of post-operation over anesthesia, the muscles and fascia around the eyeball were immediately circumcised using tissue scissors, the eyeball was removed and optic nerve of about 5mm length was retained, and then fixed with modified FFA retinal fixative containing acetic acid for 6 hours, and fixed with normal 4% paraformaldehyde for 42 hours after 6 hours. The cornea ring of the fixed eyeball is cut off by a scalpel, the crystalline lens is extracted, and the residual retina cup is reserved. The retinal cup was half-cut with a scalpel to approximately 2/5, leaving the optic nerve intact and the hemilateral retinal cup. 2) The tissue was taken out of the fixation solution, sequentially soaked in 50% ethanol (30 min) -70% ethanol (overnight) -80% ethanol (30 min) -90% ethanol (30 min) -95% ethanol (30 min) -absolute ethanol (2 times, 30min each time) -xylene (2 times, 5-10 min each time until the sample was completely transparent) -62 ℃ paraffin (3 times, 1 hour each time), and then subjected to tissue embedding. (optic nerve placed horizontally to the retinal cup). 3) When the retina samples are sliced, the retina samples are sliced layer by layer along the extending direction of the optic nerve, the thickness of the slice is 5mm, and each retina sample is sliced into two pieces. The slices are dried on a baking machine, placed in a 37-degree oven for baking overnight, and then placed in a 4-degree refrigerator for storage.

Photographing and picture analysis: 1) photographs were taken using a Nikon Eclipse Ti-U inverted fluorescence microscope at 200X magnification, one at each of the left 600um and right 600um retinal base optic nerve. 2) The pictures were counted blindly by a person other than the experimental operator using Image Pro Plus 6 software, by counting cells in the field of view of each picture (number of RGCs), measuring the length of the RGCs cell layer of each picture (pixels), and calculating the number of RGCs cells per mm unit length after conversion according to a scale.

Statistical analysis: experimental data were processed, counted (one-way anova plus Dunnute-t test two-by-two comparisons) and plotted using Graphpad prism 6 software.

Principle of animal elimination: animals die during surgery due to over-anesthesia or post-operative death; the high intraocular pressure model is not successfully molded or the perfusion time is not longer than 1 hour in the operation process; retinal inflammation is found in pathological sections to cause infiltration of a large number of inflammatory cells, interfering with normal RGCs counts;

results

To evaluate the therapeutic effect of drug, Triol, on acute ocular hypertension induced optic neuropathy in rats, we first observed death of optic ganglion RGCs cells using classical histopathology (HE staining). As shown in FIG. 9A, the RGCs (indicated by black arrows) in the retinal ganglion cell layer (GCL layer) of rats were significantly lost and were not aligned in the acute ocular hypertension group-treated group and the solvent HP- β -CD-treated group, as compared with the normal group. As shown in fig. 9B and 9C, the number of RGC cells was significantly reduced in the acute ocular hypertension treated group and the solvent HP- β -CD treated group rats. Whereas intravitreal injection of 80 μ g Triol significantly reduced RGCs cell death, the low dose of 40 μ g Triol was more prevalent but not statistically different. The above results show that trio significantly reduces acute ocular hypertension-induced optic ganglion cell death

The inhibitory effect of the drug Triol on axonal loss by ocular hypertension induced in optic ganglion cells was further evaluated using immunohistochemical staining of the mature neuronal axon specific marker β -III-Tubulin. As shown in the results of FIG. 10, compared with the normal control group, the axons of the optic ganglion cells in the retina inner reticular layer (IPL) of the rats of the acute ocular hypertension group and the solvent HP-beta-CD group were significantly injured (indicated by yellow arrows), and the axons were remarkably reduced by staining the axons with beta-III-Tubulin and were accompanied by axon breakage. Treatment with 40. mu.g and 80. mu.g Triol drug increased β -III-Tubulin staining to different extents and morphologically reduced RGCs axonal rupture due to ocular hypertension as compared to the acute ocular hypertension treated group and the solvent HP- β -CD treated group.

To explore whether the drug, Triol, acts by inhibiting inflammatory activation of microglia, we first performed immunohistochemical staining of rat optic nerves of each treatment group using the microglia activation marker Iba-1. As shown in fig. 11A, the optic microglia of the rats in the normal control group appeared in an inactivated resting state, while the microglia of the rats in the acute ocular hypertension group-treated group and the solvent HP- β -CD treated group showed soma enlargement, pseudopodia elongation or amoeba activation-like morphology (shown by black arrows), while the drug-treated group significantly improved the microglia activation-like morphology. Activated microglia count statistics for each treatment group as shown in fig. 11B, the 40 μ g and 80 μ g Triol administered groups significantly reduced the number of activated microglia in optic nerve caused by acute high pressure treatment; further, immunohistochemistry using the microglia activation marker Iba-1 was used to quantitatively analyze the activation of optic nerve microglia with respect to optical density, and as shown in fig. 11C, the 80 μ g Triol administered group significantly reduced the increase in optical density of Iba1 caused by acute high pressure treatment. The results show that the Triol obviously inhibits the inflammatory activation of optic nerve microglia induced by acute high intraocular pressure and relieves the inflammatory injury of optic nerve caused by high ocular pressure.

In conclusion, the drug Triol can reduce the death of rat optic ganglion cells induced by acute high intraocular pressure and relieve the axon loss and the breakage of rat optic ganglion cells by inhibiting the inflammatory activation of macrophages and microglia cells.

Reference to the literature

Lv Yan Chun, Lv Li Cheng, the research progress of retinal ganglion cell protection after optic nerve injury, modern practice medicine, 2009, 21 (10) 1147-.

Costello F. Inflammatory optic neuropathies. Continuum (Minneap Minn). 2014 Aug;20(4 Neuro-ophthalmology):816-37.

Foster A，Gilbert C，Johnson G.，changing patterns in global blindness：1988—2008,Community Eye Health J.，2008．21(67)：37-39．

Zhang X, Liu S, Yi J. , Distal axonopathy in glaucomatous optic neuropathy, Zhonghua Yan Ke Za Zhi. 2014 May;50(5):391-4.

Shengyanmei, Monmorii, research progress of optic nerve protection of traditional Chinese medicine, pharmaceutical guide, Vol.26, No. 10, 2007, 1191-1193.

Baltmr A, Duggan J, Nizari S, Salt TE, Cordeiro MF. Neuroprotection in glaucoma - Is there a future role- Exp Eye Res. 2010 Nov;91(5):554-66.

Vohra R, Tsai JC, Kolko M. The role of inflammation in the pathogenesis of glaucoma. Surv Ophthalmol. 2013 Jul-Aug;58(4):311-20.

Mac Nair CE, Nickells RW. Neuroinflammation in Glaucoma and Optic Nerve Damage. Prog Mol Biol Transl Sci. 2015;134:343-63.

Midena E, Pilotto E. Emerging Insights into Pathogenesis. Dev Ophthalmol. 2017;60:16-27.

Xieming, Luhong Bin, what leap and Zhao Chun, research progress of correlation between inflammatory factors and diabetic retinopathy, new progress in ophthalmology, 2012, 32 (10): 990-.

Serhan CN．Resolution phase of inflammation：novel endogenous anti-inflammatory and proresolving lipid mediators and pathways，Annu Rev Immunol，2007，25：101—137.

Adamis AP, Berman AJ, Immunological mechanisms in the pathogenesis of diabetic retinopathy , Semin Immunopathol，2008．30(2)：65-84.

Adamiec-Mroczek J．Oficjalska-Mlynczak J．Misiuk-Hojlo M．Roles of endothelin-1 and selected proinflammatory cytokines in the pathogenesis of proliferative diabetic retinopathy：Analysis of vitreons samples, Cytokine，2010，49(3)：269-274).

Levkovitch-Verbin H, Harris-Cerruti C, Groner Y, Wheeler LA, Schwartz M, Yoles E. RGC death in mice after optic nerve crush injury: oxidative stress and neuroprotection. Invest Ophthalmol Vis Sci. 2000 Dec;41(13):4169-74.

Zhao Q, Qian Y, Li R, Tan B, Han H, Liu M, Qian M, Du B.Norcantharidin facilitates LPS-mediated immune responses by up-regulation of AKT/NF-κB signaling in macrophages. PLoS One 2012;7(9):e44956.

Joseph Sambrook, David w.russell, huang peitang (master translation), molecular cloning instructions, fine editions, chemical industry publishers, 2008.

Ortega FJ, Gimeno-Bayon J, Espinosa-Parrilla JF, Carrasco JL, Batlle M, Pugliese M, Mahy N, Rodríguez MJ.ATP-dependent potassium channel blockade strengthens microglial neuroprotection after hypoxia-ischemia in rats. Exp Neurol. 2012;235(1):282-96.

McCarthy KD, Devellis J.Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J Cell Biol 1980; 85:890-902.。

Claims (5)

1. Use of 5 α -androst-3 β,5,6 β -triol, a deutero-derivative thereof, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treating an inflammation-mediated optic neuropathy in a patient, wherein the inflammation-mediated optic neuropathy is selected from infectious optic neuritis, non-infectious optic neuritis, and is manifested by activation of macrophages and/or microglia.
2. 2. The use of claim 1, wherein the inflammation-mediated optic neuropathy is infectious optic neuritis.
3. 3. The use of claim 1, wherein the inflammation-mediated optic neuropathy is noninfectious optic neuritis.
4. 4. The use of claim 1, wherein the medicament further comprises another therapeutic agent.
5. 5. The use of claim 1, wherein the patient is a human.

Images