TW201932114A - Compound for treating inflammation-mediated optic neuropathy - Google Patents

Abstract

Disclosed is the use of 5[alpha]-androst-3[beta],5,6[beta]-triol and analogs thereof, deuterated compounds thereof or pharmaceutically acceptable salts thereof in the preparation of drugs for treating inflammation-mediated optic neuropathy in patients. The present invention confirms that these compounds can significantly antagonize the activation of microglia and macrophages, and inhibit inflammatory responses so as to reduce the loss of rat optic ganglion cells caused by high intraocular pressure and to reduce the loss of axons of retinal ganglion cells, and can thus be used for treating inflammation-mediated optic neuropathy.

Description

Compounds for the treatment of inflammation-mediated optic neuropathy

The present invention relates to new medical applications of 5α-androst-3β, 5,6β-triol (5α-androst-3β, 5,6β-triol, "triol") and the like, and specifically relates to these compounds Application in the treatment of inflammation-mediated optic neuropathy.

Optic neuropathy mainly includes diseases such as optic neuritis, optic nerve atrophy, ischemic optic disc disease, and optic nipple edema. It is more common in the clinic, more difficult to treat, and the cause is more complicated. The optic nerve is a collection of axons (ie, optic nerve fibers) protruding from the innermost retinal ganglion cell (RCC) of the retina. There are many causes of optic nerve damage. Common causes are trauma, ischemia, poisoning, demyelination, tumor compression, inflammation, metabolism, and syphilis. This type of optic nerve damage can occur in any part of the optic nerve, including optic ganglion cells and their axons, and the consequence is the partial or complete loss of visual function. For example, the secondary death of retinal ganglion cells after optic nerve injury is the main cause of irreversible visual impairment. Slowing or inhibiting the secondary death of RGC after optic nerve injury is the basis for effective treatment of optic nerve injury and promotion of visual function recovery (Lu Yanchun et al., 2009), and the loss of optic axons caused by demyelination is considered to be multiple sclerosis sclerosis (MS) is a possible cause of permanent vision loss.

Optic neuritis refers to the general term for inflammation of any part of the optic nerve, and generally refers to diseases such as inflammatory demyelination, infection, and non-specific inflammation of the optic nerve. The role of inflammatory injuries in optic neuritis is gaining increasing attention (Costello F., 2014).

Glaucoma is the world's leading irreversible blinding eye disease. Globally, there are about 60 million glaucoma patients and about 8 million blinders (Foster A et al., 2008). The gradual loss of retinal ganglion cells (RGC) and axonal damage are its basic characteristics (Zhang X et al., 2014). Among them, optic nerve damage caused by damage and death of RGC cells is the most important pathological change in glaucoma disease (Sheng Yanmei et al., 2007). Various damaging mechanisms such as neurotrophic factor deprivation, protein misfolding, inflammation, glutamate excitotoxicity, and NO toxicity are involved in RGC injury or death caused by glaucoma eye hypertension (Baltmr A et al., 2010). Studies have shown that low-level inflammation plays an important role in the pathogenesis of glaucoma (Vohra R et al., 2013). Microglial cells are involved in the pathological process of glaucoma (Mac et al., 2015).

Diabetic retinopathy (DR) is a common complication of diabetes. It is the leading blinding eye disease in people aged 20 to 70 years. Persistent hyperglycemia causes multiple cellular pathways to participate in the pathogenesis of DR, leading to an increase in inflammation, oxidative stress, and vascular dysfunction. It is a "chronic, low-grade inflammatory retinal disease" in which inflammatory activation of microglia is involved Pathological processes (Midena E et al., 2017). More and more studies have proved that inflammatory factors are involved in the development of DR (Xie Mingjie et al., 2012). For example, tumor necrosis factor-α (TNF-α) and interleukin-1B (IL-1β), both of which can produce pro-inflammatory response proteins such as cyclooxygenase 2 (COX-2) and inducible nitric oxide Synthase (iNOS), etc., further induce the occurrence of inflammatory reactions (Serhan CN et al., 2007). The emergence of these pro-inflammatory proteins can be observed in early animal models of DR, and inhibition of their effects can effectively prevent further retinopathy (Adamis AP et al., 2008; Adamiec-Mroczek J et al., 2010).

Traumatic optic nerve injury refers to the partial or complete loss of visual function caused by the impact of external force. It can be permanent or temporary. It is one of the important traumatic blinding factors. Traumatic optic nerve injury is often accompanied by traumatic optic neuropathy, which is one of the common and serious complications in craniocerebral injury, accounting for about 2% ~ 5% of craniocerebral trauma. Due to the anatomical structure and physiological characteristics, direct injury caused by sharp instrument puncture to the optic nerve and direct damage to other parts of the optic nerve are relatively rare in clinical practice. More than 90% of optic nerve damage is indirect damage to the optic nerve tube segment. Indirect optic nerve injury refers to the external force transmitted to the optic nerve tube through the skull, causing optic nerve tube deformation or fracture, causing vision and visual field disorders caused by optic nerve damage. Due to the lack of ideal treatment methods, patients often bring irreversible visual loss. The mechanism of retinopathy after optic nerve contusion is very complicated. It is related to inflammation and other factors. In addition, a large number of free radicals produced by changes in the microenvironment of retinal ganglion cells can cause secondary damage to retinal cells (Levkovitch-Verbin H Et al., 2000).

At present, there are still insufficient clinically effective drugs to treat various optic neuropathy, so it is of great clinical significance to provide a medicine that can effectively treat optic neuropathy.

The inventors of the present invention have unexpectedly discovered that the compounds of formula I can significantly antagonize the activation of microglial cells and macrophages, inhibit the inflammatory response and reduce the loss of rat optic ganglion cells caused by high intraocular pressure, and reduce the retinal ganglion cell axis Sudden loss, which can be used to treat inflammation-mediated optic neuropathy;
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

One aspect of the present invention provides the use of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for treating inflammation-mediated optic neuropathy:
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, wherein R _{1 is} preferably H, that is, the compound is 5α-androst-3β, 5,6β-triol (5α-androst-3β, 5,6β-triol, sometimes referred to as “three alcohol"). In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In some implementations, the inflammation-mediated optic neuropathy is selected from glaucoma, infectious optic neuritis, non-infective optic neuritis, multiple sclerosis-associated retinopathy, diabetic retinopathy, and traumatic optic neuritis lesions. In some implementations, the inflammation-mediated optic neuropathy manifests as activation of macrophages and / or microglia. In some implementations, the inflammation-mediated optic neuropathy manifests as loss of optic ganglion cells and / or loss of optic ganglion cell axons. In some implementations, the medicament further comprises another therapeutic agent.

Another aspect of the present invention provides a method of treating inflammation-mediated optic neuropathy in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof, or Pharmaceutical composition comprising a compound of formula I, a deuterated form thereof, or a pharmaceutically acceptable salt thereof:
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In some implementations, the inflammation-mediated optic neuropathy is selected from glaucoma, infectious optic neuritis, non-infective optic neuritis, multiple sclerosis-associated retinopathy, diabetic retinopathy, and traumatic optic neuritis lesions. In some implementations, the inflammation-mediated optic neuropathy manifests as activation of macrophages and / or microglia. In some implementations, the inflammation-mediated optic neuropathy manifests as loss of optic ganglion cells and / or loss of optic ganglion cell axons.

Another aspect of the present invention provides a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof for use in the treatment of a patient's inflammation-mediated optic neuropathy:
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In some implementations, the inflammation-mediated optic neuropathy is selected from glaucoma, infectious optic neuritis, non-infective optic neuritis, multiple sclerosis-associated retinopathy, diabetic retinopathy, and traumatic optic neuritis lesions. In some implementations, the inflammation-mediated optic neuropathy manifests as activation of macrophages and / or microglia. In some implementations, the inflammation-mediated optic neuropathy manifests as loss of optic ganglion cells and / or loss of optic ganglion cell axons.

Yet another aspect of the present invention provides a method for reducing or eliminating an inflammatory response in a patient's optic neuropathy, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable A salt, or a pharmaceutical composition comprising a compound of formula I, a deuterated form thereof, or a pharmaceutically acceptable salt thereof:
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

Yet another aspect of the present invention provides a method of reducing or eliminating loss of optic ganglion cells in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof , Or a pharmaceutical composition comprising a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof:
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

Yet another aspect of the present invention provides a method for reducing or eliminating axonal loss of optic ganglion cells in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable A salt thereof, or a pharmaceutical composition comprising a compound of Formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof,
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

Another aspect of the present invention provides a method for reducing or eliminating activation of microglial cells and / or macrophages in a patient's optic neuropathy, the method comprising administering to the patient an effective amount of a compound of formula I, deuterium thereof A substitute or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of Formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof,
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

In one implementation, R _{1 is} preferably H. In one implementation, R _{1 is} selected from -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ .

As used herein, the term "composition" refers to a formulation suitable for administration to a desired animal subject for therapeutic purposes, which contains at least one pharmaceutically active ingredient, such as a compound. Optionally, the composition further contains at least one pharmaceutically acceptable carrier or excipient.

The term "pharmaceutically acceptable" means that these substances do not have such properties, that is, taking into account the disease or condition to be treated and their respective route of administration, these properties will prevent rational and prudent medical practitioners from avoiding Give the patient the substance. For example, for injectables, such materials are generally required to be substantially sterile.

As used herein, the terms "therapeutically effective amount" and "effective amount" mean that the substance and the amount of the substance is effective in preventing, reducing or ameliorating one or more symptoms of a disease or disorder, and / or prolonging the survival of a subject receiving treatment of.

As used herein, "treatment" includes administering a compound of the present application or a pharmaceutically acceptable salt thereof to reduce the symptoms or complications of a disease or disorder, or to eliminate a disease or disorder. The term "relief" as used herein is used to describe a process in which the signs or symptoms of a disorder are reduced in severity. Symptoms can be reduced without resolution. In one implementation, administration of a pharmaceutical composition of the present application results in elimination of signs or symptoms.

Compounds of formula I, deuterates and pharmaceutically acceptable salts thereof Compounds which may be used in the methods or applications of the invention include compounds of formula I, their deuterates or their pharmaceutically acceptable salts,
(Formula I)
Wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ , which is also referred to herein as "the compound of the present invention" . In one implementation, wherein R ₁ is H, that is, the compound is 5α-androst-3β, 5,6β-triol (5α-androst-3β, 5,6β-triol, hereinafter sometimes referred to as "triol" ). The structural formula is shown in formula (II). Triol has been proven to be a neuronal protective agent effective against acute ischemic hypoxic brain damage.
(Formula II)

In one implementation, R ₁ is -CHCH ₂ CH ₃ and the compound is 17-propylene-androst-3-3,5α, 6β-triol. In one implementation, R ₁ is -CH (CH ₃ ) ₂ and the compound is 17-isopropyl-androst-3β, 5α, 6β-triol. In one implementation, R ₁ is -CH (CH ₂ ) ₃ CH ₃ , and the compound is 17-butyl-androsta-3β, 5α, 6β-triol. In one implementation, R ₁ is -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ , and the compound is cholestane-3β, 5α, 6β-triol.

The compounds of the invention may be formulated in the form of a pharmaceutically acceptable salt. Expected pharmaceutically acceptable salt forms include, but are not limited to, mono-, di-, tri-, tetra-, and the like. Pharmaceutically acceptable salts are non-toxic in the amounts and concentrations at which they are administered. Without preventing it from exerting physiological effects, by changing the physical properties of the compounds, the preparation of such salts can facilitate pharmacological applications. Useful changes in physical properties include lowering the melting point for transmucosal administration, and increasing solubility for administration of higher concentrations of the drug.

Pharmaceutically acceptable salts include acid addition salts such as their sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, aminosulfonate, acetate , Citrate, lactate, tartrate, mesylate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylaminosulfonate and quinate salts. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, aminosulfonic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid Acids, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylaminosulfonic acid, fumaric acid and quinic acid.

When acidic functional groups such as carboxylic acids or phenols are present, pharmaceutically acceptable salts also include base addition salts, such as those which contain benzathine penicillin, chloroprocaine, choline, diethanolamine, ethanolamine, tert-butyl Salts of amines, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamines and zinc. Such salts can be prepared using the appropriate corresponding base.

With standard techniques, pharmaceutically acceptable salts can be prepared. For example, the compound in the form of a free base is dissolved in a suitable solvent, such as an aqueous or water-alcoholic solution containing a suitable acid, and the solution is then evaporated for separation. In another example, a salt is prepared by reacting a free base and an acid in an organic solvent.

Thus, for example, if a particular compound is a base, the required pharmaceutically acceptable salts can be prepared by any suitable method available in the art, such as treating the free base with an inorganic or organic acid, etc. Inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and similar acids, such organic acids as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvate, oxalic acid, glycolic acid , Salicylic acid, pyranosidyl acid (such as glucuronic acid or galacturonic acid), alpha-hydroxy acids (such as citric or tartaric acid), amino acids (such as aspartic acid or glutamine) Acid), aromatic acid (such as benzoic acid or cinnamic acid), sulfonic acid (such as p-toluenesulfonic acid or ethanesulfonic acid), or the like.

Similarly, if the specific compound is an acid, the desired pharmaceutically acceptable salt can be prepared by any suitable method, for example, treating the free acid with an inorganic or organic base such as an amine (primary Amine, secondary amine or tertiary amine), alkali metal hydroxide or alkaline earth metal hydroxide or the like. Illustrative examples of suitable salts include organic salts derived from amino acids (such as L-glycine, L-lysine, and L-spermine), ammonia, primary amines, secondary amines, and tertiary amines And cyclic amines (such as hydroxyethylpyrrolidine, piperidine, morpholine, and piperazine), and inorganic salts, which are derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium.

A pharmaceutically acceptable salt of a compound may exist as a complex. Examples of complexes include 8-chlorotheophylline complexes (similar to, for example, theophylline: diphenhydramine 8-chlorotheophylline (1: 1) complexes; halohaining) and various ring-containing compounds Dextrin complex.

The present invention is further contemplated to include a pharmaceutically acceptable deuterated compound or other non-radioactive substituted compound using the compound. Deuteration is the replacement of one or more or all of the hydrogen in the active molecular group with the isotope deuterium. Because it is non-toxic and non-radioactive, and is about 6-9 times more stable than the carbon-hydrogen bond, it can block the metabolic site and prolong the drug The half-life, which reduces the therapeutic dose without affecting the pharmacological activity of the drug, is considered an excellent modification method.

Pharmaceutical Compositions Another aspect of the present invention provides a pharmaceutical composition comprising an effective amount of a compound of Formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

In the present invention, "pharmaceutical composition" refers to a composition comprising a compound of formula I and a pharmaceutically acceptable carrier, wherein the compound and the pharmaceutically acceptable carrier are present in the composition in a mixed form. The composition will generally be used in the treatment of human subjects. However, it can also be used to treat similar or identical conditions in other animal subjects. As used herein, the terms "object", "animal object" and similar terms refer to human and non-human vertebrates, such as mammals, such as non-human primates, competitive animals and commercial animals, such as horses, cattle, pigs, sheep, Rodents, and pets (such as dogs and cats).

Suitable dosage forms depend, in part, on the use or route of administration, such as oral, transdermal, transmucosal, inhalation or by injection (parenteral). Such dosage forms should enable the compound to reach the target cells. Other factors are well known in the art and include considerations such as toxicity and the delay in which the compound or composition exerts its effect.

Carriers or excipients can be used to produce the composition. The carrier or excipient can be selected to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars (such as lactose, glucose, or sucrose), or starch types, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile water for injection (WFI) solutions, saline solutions, and glucose.

The composition or components of the composition can be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectal, transdermal or inhalation. In some implementations, injections or lyophilized powder injections are preferred. For oral administration, for example, the compounds can be formulated in conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.

Pharmaceutical preparations for oral use are available, such as by combining the composition or its components with solid excipients, optionally grinding the resulting mixture, and processing the mixture of granules after adding suitable adjuvants, if necessary, Thus, tablets or dragees are obtained. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methyl fiber Cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose (CMC), and / or polyvinylpyrrolidone (PVP: povidone). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Alternatively, injections (parenteral) can be used, such as intramuscular, intravenous, intraperitoneal and / or subcutaneous. For injection, the composition of the invention or its components is formulated as a sterile liquid solution, preferably in a physiologically compatible buffer or solution, such as a saline solution, a Hank solution or a Ringer solution. In addition, the composition or its components can be formulated in a solid form and redissolved or suspended immediately before use. It can also be produced in lyophilized powder form.

Administration can also be by transmucosal, topical or transdermal means. For transmucosal, topical or transdermal administration, a penetrant suitable for the barrier to be penetrated is used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents can be used to promote penetration. Transmucosal administration can be, for example, by nasal spray or suppository (rectally or vaginally).

By standard procedures of effective amounts of the various ingredients to be administered may be determined with, for example, considerations of the compound IC _50, the biological half life of the compound, the age, the weight and size of the object, and related disorders. The importance of these and other factors is well known to those skilled in the art. Generally, the dosage will be between about 0.01 mg / kg and 50 mg / kg of the subject being treated, preferably between 0.1 mg / kg and 20 mg / kg. Multiple doses can be used.

The composition of the invention or its components can also be used in combination with other therapeutic agents for the same disease. Such combined use includes administration of these compounds and one or more other therapeutic agents at different times, or the simultaneous use of such compounds and one or more other therapeutic agents. In some implementations, the dosage of one or more compounds of the invention or other therapeutic agents used in combination can be modified, for example, by reducing the dosage of a compound or therapeutic agent relative to the compound or therapeutic agent used alone by methods known to those skilled in the art.

It is to be understood that the combined use or combination includes use with other therapies, drugs, medical procedures, etc., where the other therapies or procedures may be at a different time than the composition of the invention or its components (e.g., in the short term (Such as several hours, such as 1, 2, 3, 4-24 hours) or for a longer period of time (such as 1-2 days, 2-4 days, 4-7 days, 1-4 weeks) The composition of the invention or its components are administered at the same time. The combined use also includes use with one or infrequently administered therapies or medical procedures (such as surgery), and accompanied by the composition of the invention or its components in Administration over a short or longer period of time before or after the other therapy or procedure. In some implementations, the invention is used to deliver a composition of the invention or a component thereof and one or more other pharmaceutical therapeutic agents, which Delivered by the same or different routes of administration.

The combined administration of any route of administration includes the delivery of the composition of the invention or its components and one or more other pharmaceutical therapeutic agents together in any formulation by the same route of administration, including the two compounds being chemically linked and Preparations that maintain their respective therapeutic activity when administered. In one aspect, these other drug therapies can be co-administered with a composition of the invention or a component thereof. By co-administration in combination with preparations including co-formulation or chemically linked compounds, or in the short term (e.g., within one hour, within two hours, within three hours, up to 24 hours ) Compounds are administered in the form of two or more separate preparations, which are administered by the same or different routes.

Co-administration of separate preparations includes co-administration of delivery via one device, such as the same inhalation device, the same syringe, etc., or from different devices within a short period of time relative to each other. Co-formulations of a compound of the invention and one or more additional drug therapies delivered by the same route of administration include preparing materials together so that they can be administered by a single device, including combining different compounds in one formulation, or compound Modified so that they are chemically linked together but still maintain their respective biological activities. Such chemically linked compounds may include a linker that separates two active ingredients, which linker is substantially maintained in the body, or may degrade in the body.

Therapeutic method and application <br/> Another aspect of the present invention provides the use of a compound of formula I, a deuterate thereof or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for treating inflammation-mediated optic neuropathy. Accordingly, the present invention provides the use of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof for the treatment of inflammation-mediated optic neuropathy. Accordingly, the present invention provides a method of treating inflammatory-mediated optic neuropathy in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof; or the above Pharmaceutical composition.

Yet another aspect of the present invention provides a method for reducing or eliminating an inflammatory response in a patient's optic neuropathy, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable A salt; or a pharmaceutical composition as described above. Yet another aspect of the present invention provides a method for reducing or eliminating loss of optic ganglion cells in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable salt thereof; Or the above pharmaceutical composition. Yet another aspect of the present invention provides a method for reducing or eliminating axonal loss of optic ganglion cells in a patient, the method comprising administering to the patient an effective amount of a compound of formula I, a deuterate thereof, or a pharmaceutically acceptable A salt thereof; or a pharmaceutical composition as described above. Another aspect of the present invention provides a method for reducing or eliminating activation of microglial cells and / or macrophages in a patient's optic neuropathy, the method comprising administering to the patient an effective amount of a compound of formula I, deuterium thereof A substitute or a pharmaceutically acceptable salt thereof; or a pharmaceutical composition as described above.

Examples
Example 1. Triol inhibits LPS and TNF-α- induced activation of peripheral macrophage inflammatory signaling pathway molecules
method

Culture, grouping and processing of mouse macrophage cell line RAW264.7 : refer to Zhao et al. (Zhao Q et al., 2012) for culture: Mouse macrophage cell line RAW264.7 cells are cultured in 10% fetal bovine serum , 100 U / mL penicillin and 0.1 mg / mL streptomycin in DMEM complete culture medium, placed in 5% CO ₂ , 37 ° C constant temperature closed incubator (relative humidity 95%), cultured and passaged, inverted growth microscope to observe the growth. Passage about once every 2-3 days, and take the cells in the logarithmic growth phase for formal experiments.

The RAW264.7 cells in the logarithmic growth phase are grouped as follows:

The solvent control group was given 20% HP-b-CD according to the highest concentration of triol; the triol treatment was given a total of 5 concentrations of 0.1, 0.5, 1, 5, and 10 mM, respectively, in LPS (or TNF-α) Pre-treat for 30 minutes before stimulation.

Detection of protein content and immunoblot detection : refer to the method of "Molecular Cloning Experiment Guide" (Joseph Sambrook, David W. Russell, Chemical Industry Press, 2008): RAW264.7 cells in the logarithmic growth phase, adjust the cells Density is seeded in 6-well plates. After 24 hours of cell culture, the serum was removed and treated with triol for 30 min, and then stimulated with LPS or TNF-α for 30 min or 15 min. Total cell protein was extracted. After measuring the protein concentration, a 20 μg protein sample was taken and 5 × SDS protein loading buffer was added. After boiling for 5 min, it was separated by 10% SDS-polyacrylamide gel electrophoresis; the separated protein was transferred to a PVDF membrane by wet transfer method, and blocked with TBST solution containing 5% skimmed milk powder at room temperature for 1 hour; Antibodies were incubated overnight at 4 ° C; TBST was washed 3 times for 5 min each time, the corresponding secondary antibody was added, and incubated at room temperature with shaking for 1 h, and TBST was washed 4 times for 5 min each. Chemiluminescence photochromography.

p65 subcellular immunofluorescence localization : refer to the method of Zhao et al. (see above): different cells in the logarithmic growth phase, digest the cells with 0.25% trypsin, adjust the cell concentration to 1 × 10 ⁵ cells / ml, inoculate In a 48-well plate, 200 μl / well. After the cells were 80% confluent, the cells were stimulated with 100 ng / ml LPS for 30 min. 4% paraformaldehyde was fixed at room temperature for 15min, washed 3 times with PBS solution for 5min each time; then added ice-cold 100% methanol and incubated at -20 ° C for 10min, rinsed with PBS solution once, 5min; added goat serum blocking solution to block at room temperature for 1h Add diluted antibody and incubate at 4 ° C overnight; wash 3 times with PBS solution for 5 min each time, add the corresponding fluorescent secondary antibody, and incubate for 1 h at room temperature with shaking in the dark, wash 2 times for 5 min each ; Then add Hoechst 33342 and incubate for 10 min, wash twice with PBS solution, observe under a fluorescence microscope, and take a picture.

Detection of mRNA expression : refer to the "Molecular Cloning Experiment Guide" (see above): RAW264.7 cells in the logarithmic growth phase, adjust the cell density and inoculate 6-well plates, and stimulate the cells with 100 ng / ml LPS for 6h, 12h After 24 hours, total RNA was collected and stored at -80 ° C. M-MuLV reverse transcriptase was used for reverse transcription to synthesize the first strand of cDNA, and then the following genes were used for PCR. Reaction conditions: 94 ° C pre-denaturation for 3 min, 94 ° C for 45 s, 58 ° C for 2 min, and 72 ° C for 1 min. After 31 cycles, 72 ° C was extended for 7 min. Agarose gel electrophoresis identified amplification results. The primer sequences are as follows, synthesized by Shanghai Biological Engineering Company.
COX-2: TCTCAGCACCCACCCGCTCA; GCCCCGTAGACCCTGCTCGA
iNOS: GTGCTGCCTCTGGTCTTGCAAGC; AGGGGCAGGCTGGGAATTCG
IL-1β: TGCTTCCAAACCTTTGACCTGGGC; CAGGGTGGGTGTGCCGTCTTTC
IL-6: GCTGGAGTCACAGAAGGAGTGGC; GGCATAACGCACTAGGTTTGCCG
CCR2: GAGCCTGATCCTGCCTCTACTTG; CTCTTCTTCTCATTCCTACAGCGA
MCP-1: ACTCACCTGCTGCTACTCATTCAC; CTTCTTTGGGACACCTGCTGCT
TNF-α: CTTGTCTACTCCCAGGTTCTCTT; GATAGCAAATCGGCTGACGG
RPLP0: CTGAGATTCGGGATATGCTGTTG; GTCCTAGACCAGTGTTCTGAGC

Statistical processing : All counted data were subjected to 3 or more independent experiments. The experimental results were expressed as mean ± standard deviation. Statistics were performed using SPSS software. P <0.05 indicates a significant statistical difference.

Results As shown in Figure 1, triol significantly blocked the phosphorylation of NF-κB and p38, inflammation-related signaling pathway molecules of RAW264.7 cells induced by LPS and TNF-α. Figure 2 shows that LPS stimulation transfers the NF-κB p65 subunit from the cytoplasm of RAW264.7 cells into the nucleus, and triol can block such nuclear translocation of NF-κB. Figure 3 shows that triol significantly inhibited the gene expression of pro-inflammatory factors such as IL-1β, TNF-α, IL-6, Cox-2, iNos, CCR2, and MCP-1 in RAW264.7 cells after LPS induction.

The results showed that triol significantly blocked the phosphorylation and nuclear translocation of NF-κB and p38 in macrophages induced by inflammatory stimulating factors, and the gene transcription of inflammatory factors such as intracellular IL-1β, indicating that triol inhibited LPS and TNF -α-induced activation of peripheral macrophage inflammatory signaling pathway molecules and synthesis of inflammatory factors.

Example 2. Triol inhibits the activation of microglial cells and their inflammatory pathway molecules. <br/> Microglia are generally considered to be monocytes that are localized or displaced to the central nervous tissue. Similar functions of macrophages in other surrounding tissues are the first layer of central nervous tissue and the main immune defense barrier. At the same time, it plays a key role in the central nervous system and other central nervous system inflammatory response processes, and its excessive activation is an important factor for neural tissue damage.

The inventors have confirmed that triol can inhibit the activation of peripheral macrophage inflammation pathway molecules. Based on this experiment, LPS was used to stimulate mouse microglial cell line BV2 cells and primary cultured mouse microglial cells. Does alcohol also have an inhibitory effect on the activation of central inflammatory cells and their inflammatory pathway molecules.

method
Culture of mouse microglial cell line BV2 cells : performed with reference to Ortega et al. (Ortega FJ et al., 2012).

Isolation and culture, grouping and processing of primary mouse microglial cells : According to the method of McCarthy et al. (McCarthy KD et al ., 1980), Balb / c mice born for one day were removed, and the cortex was separated under sterile conditions. The meninges and blood vessels were removed from the dissection solution placed on ice, cut into 1 mm ³ tissue pieces with ophthalmic scissors, and then digested in a digestive solution containing 0.25 g / L trypsin for 15 minutes at 37 ° C; 0.5 was added immediately Digestion with a g / L trypsin inhibitor and 0.05 g / L DNase I was terminated and dispersed as a single-cell suspension, centrifuged at 200 g for 5 minutes, the pellet was washed once with a washing solution, and then 200 g Centrifuge for 5 minutes; discard the supernatant and dilute the pellet with DMEM medium containing 10% (v / v) FBS to a cell density of 1.5 ~ 1.8 × 10 ⁶ cells / mL, inoculate in a culture flask, and place in 5% CO ₂ and 37 ° C incubator. On the third day after the inoculation, the medium was changed, and the culture was continued for 10-14 days. When the cultured neuroglial cells were filled with culture flasks, the microglial cells were separated and purified by mild trypsinization, and 0.0625% trypsin was added to 37 ° Gently eliminate for 30-40min, wait for the upper cells to fall off, terminate the digestion, remove the exudate, continue to trypsinize for about 30min, collect the supernatant, centrifuge to obtain microglial cells, and plate the cells for experiment.

Grouping and processing : BV2 cells in logarithmic growth phase and mature primary microglial cells are grouped as follows:

The solvent control group was given 20% HP-b-CD according to the highest concentration of triol; the triol treatment was given a total of 5 concentrations of 0.1, 0.5, 1, 5, and 10 mM.

Observation of BV2 cell morphology : refer to the method of Ortega et al .: Take BV2 cells in logarithmic growth phase, digest cells with 0.25% trypsin, adjust cell concentration, and inoculate on 6-well plates. After 24 hours, pretreat with 5 μM triol for 30 minutes, and then add LPS to a final concentration of 100 ng / ml; only add LPS treatment as a positive control; no treatment group was added as a negative control. After 24 hours of treatment, the amoebic cells were observed and counted under a phase-contrast microscope, and the data were analyzed statistically. Activation rate = number of amoebic microglial cells / total number of microglial cells × 100%.

Results <br/> As shown in Figure 4, LPS-stimulated mouse microglial cell line BV2 cells showed a large number of amoeboid-activated morphologies, and 5 μM triol could significantly block such changes in BV2 cells. Figure 5 shows that triol inhibits LPS-induced phosphorylation of NF-κB p65 subunit in BV2 cells and its transfer from the cytoplasm to the nucleus. Figure 6 shows that triol can also block LPS-induced phosphorylation and nuclear translocation of NF-κB p65 subunits in mouse primary microglial cells.

Triol inhibited the amoeba-like morphological changes of mouse BV2 microglial cells induced by LPS, and phosphorylation and nuclear translocation of NF-κB in BV2 cells; triol also blocked the primary microbes of mice induced by LPS. The phosphorylation of NF-κB and its nuclear translocation in glial cells indicate that triol can inhibit the activation of microglial cells and the activation of intracellular inflammatory signaling pathway molecules, indicating that triol can inhibit the inflammatory response of microglial cells.

Examples 3. Triol inhibits the release of pro-inflammatory factors and promotes the release of inflammatory inhibitors

Under physiological conditions, the balance of pro-inflammatory factors and inflammatory inhibitors is broken in the central nervous system. Together with activated inflammatory cells, it can trigger or aggravate the inflammatory response of central tissues through various mechanisms.

Based on the evidence that triol can inhibit the activation of inflammatory cells and intracellular inflammatory pathway molecules, this experiment uses the same inflammatory response cell model to investigate the effect of triol on the release of inflammation-related factors by the enzyme-linked immunoassay (ELISA) method. influences.

method
BV2 cell grouping and processing : BV2 cells in logarithmic growth phase and mature primary microglial cells are grouped as follows:

The solvent control group was given 20% HP-b-CD in accordance with the highest concentration of triol; the triol treatment was given a total of 4 concentrations of 0.5, 1, 5, and 10 mM.

Detection of inflammatory mediators and cytokines : Cells of each group were digested with 0.25% trypsin to adjust the cell concentration to 1 × 10 ⁵ cells / ml and seeded in 48-well plates at 200 μl / well. After the cells were 80% confluent, they were treated with drugs in groups (pre-treated cells at each concentration of YC6 for 30 min) for 24 hours. Cell supernatants were collected and stored at -20 ℃. After processing according to the kit instructions, NO and TNF were measured on a microplate reader -α, IL-6, IL-10 content.

Results <br/> Figure 7 shows that 100V ng / ml LPS stimulated the NO and TNF-α release of BV2 microglial cells to increase sharply, while 0.5 ~ 10 μM triol significantly reduced these two in a dose-dependent manner. Release of pro-inflammatory factors. Figure 8 shows that 100 ng / ml LPS induced the release of primary microglial pro-inflammatory factors NO, TNF-α, and IL-6, and stimulated the release of the inflammation inhibitor IL-10, while 1 μM or 5 μM Triol significantly inhibited the release of NO, TNF-α and IL-6, and further promoted the release of IL-10.

Triol inhibits the release of pro-inflammatory factors and up-regulates the release of inflammatory inhibitor IL-10, indicating that triol can significantly inhibit the microglial-mediated inflammatory effect, suggesting that triol can inhibit the development of central inflammatory response.

Example 4. Triol attenuates optic neuropathy caused by acute high intraocular pressure <br/> On the animal model of acute glaucoma optic neuropathy induced by high intraocular pressure, the anti-inflammatory and related medicinal effects of the steroid compound triol are evaluated.

method
Acute high intraocular pressure surgery : 1) Grouping and preoperative general anesthesia: Weigh the weight and randomly divide 60 rats into 5 groups according to body weight, each with 12 rats, which are the unoperated control group and the intraocular pressure treatment group. (High intraocular pressure, High IOP), triol drug treatment group 1 (high IOP + triol (40 μg)), triol drug treatment group 2 (high IOP + triol (80 μg)), and HP-β-CD were solvent-treated groups (High IOP + HP-β-CD), anaesthetize rats by intraperitoneal injection of 10% chloral hydrate based on body weight; 2) mydriasis: 1% tropicamide eye drops for mydriasis; local anesthesia: 0.5% hydrochloric acid The tetracaine eye drops infiltrated the cornea of the eye for local anesthesia; increased intraocular pressure: a 30 G needle was used to puncture the anterior chamber of the right eye to form a duct, and a balanced salt solution was given to increase the intraocular pressure (about 130 mmHg) and maintained for 60 min. The left eye was used as a blank control; 3) Vitreous cavity injection: 60 minutes after treatment, the injection needle was removed, and a 30G needle connected with a microinjector was used to pierce the iris vitreous cavity. After the completion of the needle stay in the vitreous cavity for 30s, it was quickly pulled out and coated with tetracycline cortisone eye ointment to prevent intraoperative infection.

Retinal sample fixation, embedding, and sectioning: 1) Rats in each group were sacrificed by excessive anesthesia 48 hours after surgery. Immediately cut the muscles and fascia around the eyeball with tissue scissors, remove the eyeballs and retain the optic nerve with a length of about 5mm, and use The modified FFA retina fixative solution containing acetic acid was fixed for 6 hours, and after 6 hours, it was replaced with ordinary 4% paraformaldehyde for 42 hours. After fixing the eyeball, cut off the corneal ring with a scalpel, cut out the lens, and retain the remaining retinal cups. Half of the retina cup is cut off with a scalpel, about 2/5, to retain the complete optic nerve and half of the retina cup. 2) Remove the tissue from the fixation solution and soak it in order of 50% ethanol (30min)-70% ethanol (overnight)-80% ethanol (30min)-90% ethanol (30min)-95% ethanol (30min)-absolute ethanol ( 2 times, 30min each time-xylene (2 times, 5-10min each time, until the sample is completely transparent)-62 ° C paraffin (3 times, 1 hour each), and then tissue embedding. (The optic nerve is placed horizontally with the retinal cup). 3) When sectioning, slice along the direction of the optic nerve layer by layer, the thickness of the slice is 5mm, and two slices of each retina sample. The slices were dried on a baking sheet machine and dried in a 37 degree oven overnight, then stored in a 4 degree refrigerator.

Photographing and image analysis : 1) Nikon Eclipse Ti-U inverted fluorescence microscope was used to take pictures with a magnification of 200 *. The photographing positions were 600um on the left side and 600um on the right side of the optic nerve at the bottom of the retina. 2) Image Pro Plus 6 software was used to count images blindly by people outside the experiment. First, count the number of cells in the field of view of each picture (number of RGCs), and then measure the length of the RGCs cell layer of each picture (pixels ), And then calculate the number of RGCs cells per mm of unit length after conversion according to the scale.

Statistical analysis : The experimental data were processed using Graphpad prism 6 software for data processing, statistics (one-way anova single factor analysis of variance and Dunnute-t test pairwise comparison) and graphing.

Principles of animal exclusion : Animals died due to excessive anesthesia or died during surgery; high intraocular pressure model during surgery was not successful or the perfusion time was less than 1 hour; pathological sections found that retinal inflammation caused a large number of inflammatory cell infiltration and interference Normal RGCs count;

Results <br/> In order to evaluate the therapeutic effect of triol on optic neuropathy in rats caused by acute high intraocular pressure, we first used the classic histopathological method (HE staining) to observe the death of RGCs cells in the optic ganglion layer. As shown in FIG. 9A, compared with the normal group, the RGCs cells (indicated by black arrows) in the retinal optic ganglion cell layer (GCL layer) of the acute ocular hypertension group treated group and the solvent HP-β-CD treated group were significantly lost. , Not arranged properly. As shown in Figures 9B and 9C, the number of RGC cells in the rats with acute ocular hypertension treated group and the solvent HP-β-CD treated group was significantly reduced. Intravitreal injection of 80 μg triol can significantly reduce the death of RGCs cells. Low dose of 40 μg triol has an improvement trend but no statistical difference. The above results show that triol significantly reduces the death of optic ganglion cells induced by acute high intraocular pressure.

Further use of β-III-Tubulin immunohistochemical staining of mature neuron axon-specific markers to evaluate the inhibitory effect of the drug triol on axon loss of optic ganglion cells caused by high intraocular pressure. The results shown in Figure 10 show that compared with the normal control group, the axons of the optic ganglion cells in the intraretinal reticular layer (IPL) of the acute ocular hypertension group and the solvent HP-β-CD treatment group were significantly damaged ( (Shown by the yellow arrow), showing a significant reduction in axon β-III-Tubulin staining with axon rupture. Compared with the acute high intraocular pressure group treatment group and the solvent HP-β-CD treatment group, 40 μg and 80 μg triol drug treatment can increase β-III-Tubulin staining to varying degrees, and morphologically reduce the axons of RGCs caused by high intraocular pressure. fracture.

In order to explore whether the drug triol system works by inhibiting the inflammatory activation of microglial cells, we first used the microglial activation marker Iba-1 to immunohistochemically stain the optic nerve of each treatment group. As shown in FIG. 11A, the microglia of the optic nerve of the normal control group rats were in an inactive resting state, while the microglia of the rats of the acute ocular hypertension group treatment group and the solvent HP-β-CD treatment group showed Exosome enlargement, pseudofoot elongation, or amoeba activation-like morphology (shown by the black arrow), while the drug-treated group significantly improved microglial activation-like morphology. Statistics of activated microglial cell counts for each treatment group are shown in Figure 11B. The 40 μg and 80 μg triol administration groups significantly reduced the number of activated microglial cells in the optic nerve caused by acute hyperbaric treatment; further activation of microglial cells was used The relative optical density of the immunohistochemical marker Iba-1 was used to quantitatively analyze the activation of microglial cells in the optic nerve. As shown in FIG. 11C, the 80 μg triol administration group could significantly reduce the increase in optical density of Iba1 caused by acute hyperbaric treatment. The above results show that triol significantly inhibits the inflammatory activation of optic nerve microglial cells induced by acute high intraocular pressure, and reduces the inflammatory damage of the optic nerve caused by ocular hypertension.

In summary, the drug triol can inhibit the inflammatory activation of macrophages and microglial cells, reduce the death of rat optic ganglion cells induced by acute high intraocular pressure, and reduce axon loss and rupture of rat optic ganglion cells.

References <br/> Lü Yanchun, Lü Liquan, Lu Yicheng, Research progress on retinal ganglion cell protection after optic nerve injury, Modern Practical Medicine, 2009, 21 (10) 1147-1149.
Costello F. Inflammatory optic neuropathies. Continuum (Minneap Minn). 2014 Aug; 20 (4 Neuro-ophthalmology): 816-37.
Foster A, Gilbert C, Johnson G., changing patterns in global blindness: 1988-2008, Community Eye Health J., 2008, 21 (67): 37-39.
Zhang X, Liu S, Yi J., Distal axonopathy in glaucomatous optic neuropathy, Zhonghua Yan Ke Za Zhi. 2014 May; 50 (5): 391-4.
Sheng Yanmei, Meng Xianli, Research progress on the protective effect of Chinese medicine optic nerve, Medical Herald, October 26, Vol. 10, 1191-1193
Baltmr A, Duggan J, Nizari S, Salt TE, Cordeiro MF. Neuroprotection in glaucoma-Is there a future role? Exp Eye Res. 2010 Nov; 91 (5): 554-66.
Vohra R, Tsai JC, Kolko M. The role of inflammation in the pathogenesis of glaucoma. Surv Ophthalmol. 2013 Jul-Aug; 58 (4): 311-20.
Mac Nair CE, Nickells RW. Neuroinflammation in Glaucoma and Optic Nerve Damage. Prog Mol Biol Transl Sci. 2015; 134: 343-63.
Midena E, Pilotto E. Emerging Insights into Pathogenesis. Dev Ophthalmol. 2017; 60: 16-27.
Xie Mingjie, Lu Hongbin, He Yue, Zhao Chunhui, Research progress on the correlation between inflammatory factors and diabetic retinopathy, new progress in ophthalmology, 2012, 32 (10): 990-993.
Serhan CN. Resolution phase of inflammation: novel endogenous anti-inflammatory and proresolving lipid mediators and pathways, Annu Rev Immunol, 2007, 25: 101-137.
Adamis AP, Berman AJ, Immunological mechanisms in the pathogenesis of diabetic retinopathy, Semin Immunopathol, 2008, 30 (2): 65-84.
Adamiec-Mroczek J, Oficjalska-Mlynczak J, Misiuk-Hojlo M, Roles of endothelin-1 and selected proinflammatory cytokines in the pathogenesis of proliferative diabetic retinopathy: Analysis of vitreons samples, Cytokine, 2010, 49 (3): 269-274) .
Levkovitch-Verbin H, Harris-Cerruti C, Groner Y, Wheeler LA, Schwartz M, Yoles E. RGC death in mice after optic nerve crush injury: oxidative stress and neuroprotection. Invest Ophthalmol Vis Sci. 2000 Dec; 41 (13): 4169-74.
Zhao Q, Qian Y, Li R, Tan B, Han H, Liu M, Qian M, Du B. Norcantharidin facilitates LPS-mediated immune responses by up-regulation of AKT / NF-κB signaling in macrophages. PLoS One 2012; 7 (9): e44956.
Joseph Sambrook, David W. Russell, Peitang Huang (translated), "Medical Cloning Experiment Guide", Chemical Industry Press, 2008.
Ortega FJ, Gimeno-Bayon J, Espinosa-Parrilla JF, Carrasco JL, Batlle M, Pugliese M, Mahy N, Rodríguez MJ. ATP-dependent potassium channel blockade strengthens microglial neuroprotection after hypoxia-ischemia in rats. Exp Neurol . 2012; 235 (1): 282-96.
McCarthy KD, Devellis J. Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J Cell Biol 1980; 85: 890-902.

Figure 1. Triol blocks phosphorylation of NF-κB and p38 in RAW264.7 cells induced by LPS and TNF-α. Western blot method was used to detect the effect of triol on (A) LPS; (B) TNF-α stimulated NF-κB and p38 phosphorylation in RAW264.7 cells.

Figure 2. Triol blocks nuclear translocation of NF-κB p65 subunits in macrophages after LPS stimulation. Immunofluorescence showed intracellular localization of NF-κB p65 subunit in RAW264.7 cells. (200 ×)

Figure 3. Triol down-regulates mRNA levels of inflammation-related factors in RAW264.7 cells after LPS stimulation. RT-PCR detects changes in mRNA levels of various pro-inflammatory factors. RPLP0 is the internal control.

Figure 4. Triol inhibits amoeba-like morphological changes in BV2 microglial cells induced by LPS. (A) Observation of morphology of BV2 cells (100 ×) by phase contrast microscopy; (B) ###: P <0.001 compared with the normal control group; ***: P <0.001 compared with the LPS treatment group.

Figure 5. Triol blocks LPS-induced activation of the NF-κB signaling pathway in BV2 cells. (A) Western blot detection of phosphorylation of NF-κB p65 subunit in BV2 cells; (B) Immunofluorescence showing intracellular localization of NF-κB p65 subunit in BV2 cells. (200 ×)

Figure 6. Triol blocks the activation of NF-κB signaling pathway in primary cultured mouse microglial cells after LPS stimulation. (A) Western blotting method to detect phosphorylation of NF-κB p65 subunit and p38 in primary mouse microglial cells; (B) Immunofluorescence showing NF-κB p65 subunit cells in primary microglial cells Within positioning. (200 ×)

Figure 7. Triol reduces LPS-induced release of NO and TNF-α from microglial BV2. BV2 cell culture supernatant (A) Griess reagent method to detect NO content; (B) ELISA method to detect TNF-α content. ##: P <0.01 compared with the control group; * / **: P <0.05 / 0.01 compared with the LPS treatment group.

Figure 8. Effect of triol on LPS-induced release of primary microglial inflammation-related factors. The contents of primary microglial culture supernatants were detected by Griess reagent method (A); the levels of IL-6, TNF-α, and IL-10 were detected by ELISA (B, C, D). ##: P <0.01 compared with the control group; * / ** /: P <0.05 / 0.01 compared with the LPS treatment group.

Figure 9. Triol significantly reduces acute ocular hypertension-induced optic ganglion cell death. A. The retina of each group was stained with HE, and the field of view was 100-200 μm on the left and right sides of the optic disc. GCL: optic ganglion cell layer; IPL: inner reticular layer; INL: inner nucleus layer; OPL: outer reticular layer; ONL: outer nucleus layer; intravitreal injection ( ivi , intravitreal injection) of the drug. B. Statistics of the number of RGCs cells per millimeter in the retinal optic ganglion layer of each group of rats. Cell counts and RGCs layer length measurements were processed using Image Pro Plus software. Statistical methods used one-way ANOVA and post-hoc Dunnet t test for pairwise comparison. *, P <0.05; **, p <0.01; ns , no significance. N = 9-12. C. The average number of RGCs cells per millimeter in the retinal optic ganglion layer of each group of rats and the number of animals in each group.

Figure 10. Triol significantly reduced axonal damage to RGCs in rat retina caused by acute high intraocular pressure.

Figure 11. Triol significantly reduces the inflammatory activation of optic nerve microglial cells induced by acute high intraocular pressure. A. Iba1 immunohistochemical staining of optic nerve microglial cells in each group of rats. The brown signal is the microglial activation marker Iba1, and the blue signal is hematoxylin nuclear dye. The scale bar is 50 μm. B. Statistics on the number of optic nerve microglial cells per unit area of rats in each group. Cells with enlarged soma, elongation of pseudopods, and deep staining of Iba1 were defined as activated microglial cells, and the cell count and tissue area measurement were performed using Image Pro Plus software. Statistical methods used one-way ANOVA and post-hoc Dunnute t test for one-to-two comparisons, *, p <0.05; **, p <0.01; ***, p <0.001; ns , no significance. N = 3. C. Statistics of the relative expression of Iba1, a microglial activation marker in the optic nerve of rats in each group. The expression value of Iba1 is a relative value that is standardized according to the relative optical density value (IOD, IOD) of the normal group. IOD values and tissue area were measured using Image Pro Plus software. The statistical method used the nonparametric test Kruska Wallis rank sum test and the post-hoc LSD test for pairwise comparison, *, p <0.05, N = 3.

Claims (8)

Use of a compound of formula I, a deuterate thereof or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for treating inflammation-mediated optic neuropathy in a patient: (Formula I) wherein R ₁ is H, an alkyl or terminal alkenyl group having 1 to 5 carbon atoms, or -CH (CH ₃ ) (CH ₂ ) ₃ CH (CH ₃ ) ₂ . As used in claim 1, wherein R ₁ is H. As used in claim 1, wherein R _{1 is} selected from: -CHCH ₂ CH ₃ , -CH (CH ₃ ) ₂ , -CH (CH ₂ ) ₃ CH ₃ and -CH (CH ₃ ) (CH ₂ ) ₃ CH ( CH ₃ ) ₂ . The use according to any one of claims 1 to 3, wherein the inflammation-mediated optic neuropathy is selected from the group consisting of glaucoma, infective optic neuritis, non-infective optic neuritis, multiple sclerosis-associated retinopathy, diabetic retinopathy and trauma Optic neuritis. The use according to any one of claims 1 to 3, wherein the inflammation-mediated optic neuropathy manifests as activation of macrophages and / or microglia. The use of any one of claims 1 to 3, wherein the inflammation-mediated optic neuropathy is manifested by loss of optic ganglion cells and / or loss of optic ganglion cell axons. The use as claimed in any one of claims 1 to 3, wherein the medicament further comprises another therapeutic agent. The use of any one of claims 1 to 3, wherein the patient is a human.