CN109971859A - A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 - Google Patents
A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 Download PDFInfo
- Publication number
- CN109971859A CN109971859A CN201910353438.0A CN201910353438A CN109971859A CN 109971859 A CN109971859 A CN 109971859A CN 201910353438 A CN201910353438 A CN 201910353438A CN 109971859 A CN109971859 A CN 109971859A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- quality control
- arms
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 53
- 230000003187 abdominal effect Effects 0.000 title claims abstract description 17
- 238000000034 method Methods 0.000 claims abstract description 23
- 238000011529 RT qPCR Methods 0.000 claims abstract description 19
- 230000003321 amplification Effects 0.000 claims abstract description 15
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 15
- 238000003908 quality control method Methods 0.000 claims description 20
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 11
- 108090000623 proteins and genes Proteins 0.000 claims description 10
- 238000012360 testing method Methods 0.000 claims description 9
- 239000013612 plasmid Substances 0.000 claims description 6
- 230000000295 complement effect Effects 0.000 claims description 5
- 108091092562 ribozyme Proteins 0.000 claims description 4
- 239000000872 buffer Substances 0.000 claims description 3
- 230000003139 buffering effect Effects 0.000 claims description 2
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 230000004087 circulation Effects 0.000 claims description 2
- 239000007788 liquid Substances 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 238000012942 design verification Methods 0.000 abstract description 2
- 238000002474 experimental method Methods 0.000 abstract description 2
- 239000000203 mixture Substances 0.000 description 9
- 230000035772 mutation Effects 0.000 description 7
- 239000007853 buffer solution Substances 0.000 description 6
- 238000005119 centrifugation Methods 0.000 description 6
- 238000013461 design Methods 0.000 description 6
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 108091005804 Peptidases Proteins 0.000 description 2
- 102000006382 Ribonucleases Human genes 0.000 description 2
- 108010083644 Ribonucleases Proteins 0.000 description 2
- 150000001298 alcohols Chemical class 0.000 description 2
- 210000000702 aorta abdominal Anatomy 0.000 description 2
- 230000001351 cycling effect Effects 0.000 description 2
- 229940079593 drug Drugs 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000002195 synergetic effect Effects 0.000 description 2
- 201000001320 Atherosclerosis Diseases 0.000 description 1
- 206010003645 Atopy Diseases 0.000 description 1
- 108010009392 Cyclin-Dependent Kinase Inhibitor p16 Proteins 0.000 description 1
- 102100024458 Cyclin-dependent kinase inhibitor 2A Human genes 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 208000034826 Genetic Predisposition to Disease Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 208000031816 Pathologic Dilatation Diseases 0.000 description 1
- 102000035195 Peptidases Human genes 0.000 description 1
- 239000004365 Protease Substances 0.000 description 1
- 102100037486 Reverse transcriptase/ribonuclease H Human genes 0.000 description 1
- 208000002223 abdominal aortic aneurysm Diseases 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 208000007474 aortic aneurysm Diseases 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 235000013601 eggs Nutrition 0.000 description 1
- 238000013401 experimental design Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 230000001376 precipitating effect Effects 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 235000019833 protease Nutrition 0.000 description 1
- 235000019419 proteases Nutrition 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 230000000391 smoking effect Effects 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the detection primers and its application of a kind of abdominal aneurvsm associated SNP positions rs10757278, the primer in specificity matching rs10757278 site of the present invention by many experiments design verification based on ARMS-qPCR method, optimizing reaction system and reaction condition, each each condition of step cooperates, so that it is successfully completed amplification and distinguishes function, the high specific and sensitivity for significantly improving detection have broad application prospects and huge market value.
Description
Technical field
The invention belongs to field of biotechnology, are related to the detection of abdominal aneurvsm associated SNP positions rs10757278 a kind of
Primer and its application.
Background technique
Abdominal aneurvsm (abdominal aortic aneurysm, AAA) refers to that abdominal aorta is in Ectasia, usually
Diameter increases 50% or more；The mechanism of the disease is very complicated, genetic predisposition, atherosclerosis and various protease etc.
Have with it directly related；Age, sex, race, family history, smoking etc. are the pathogenetic common risk factors.West
The statistical data of side shows in adult that < 60 years old patient's AAA disease incidence < 0.1% 60-70 years old was for 0.7%, > 70 years old
5%-10%；Male's disease incidence is overall 6 times higher than women, thus is directed to people at highest risk, establishes a kind of efficient, quick, susceptibility
High detection method is very necessary.
Single nucleotide polymorphism (SNPs) is a kind of important genetic marker, has density high, typical, higher
The features such as genetic stability, is widely used in the clinical diagnosis and medication treatment of various diseases.The site rs10757278 is located at
The region Chr9p21.3, the region do not have known encoding gene, close with CDKN2A/2B gene.Studies have shown that abdominal aorta
The generation of tumor and the mutation in the site have certain contact.
ARMS-qPCR method combination amplification refractory mutation system (ARMS) and Real-Time Fluorescent Quantitative PCR Technique design equipotential
Gene specific PCR amplification primer, under strict conditions, only 3 ' base of primer and template match clock synchronization completely, and PCR can just go out
It now expands, to will there is the template of certain point mutation to distinguish with normal template.Compared with traditional sequencing methods, ARMS-
QPCR method has high specific and sensitivity, quick and easy economic advantage.
Therefore, research and develop a kind of detection abdominal aneurvsm associated SNP positions rs10757278's based on ARMS-qPCR method
Primer and its application, have broad application prospects with it is huge be market value.
Summary of the invention
To solve the deficiencies in the prior art with meet the needs of market, it is related that the present invention provides a kind of abdominal aneurvsms
The detection primer and its application of SNP site rs10757278, specificity matching of the design verification based on ARMS-qPCR method
The primer in the site rs10757278, optimizing reaction system and reaction condition make it successfully complete amplification and distinguish function, have wide
Wealthy application prospect and huge market value.
To achieve the above object, the present invention adopts the following technical scheme:
In a first aspect, the present invention provides the detection primer of abdominal aneurvsm associated SNP positions rs10757278 a kind of, it is described
Primer include 1 forward primer and 2 reverse primers, 1 forward primer have the sequence as shown in SEQ ID NO.1 or
Its complementary series, 2 reverse primers have the sequence as shown in SEQ ID NO.2 and SEQ ID NO.3 or its complementary sequence
Column.
Wherein, 2 reverse primers respectively correspond the polymorphism of the site rs10757278 (A/G).
SEQ ID NO.1 is as follows: CAGCCAATTTGTGGAGTGTCA.
SEQ ID NO.2 is as follows: CTTGATTCTGCATCGCTTCC.
SEQ ID NO.3 is as follows: GTCTTGATTCTGCATCGCTTCT.
Preferably, the primer is the detection primer of ARMS-qPCR method.
In the present invention, inventor is during long-term research practice, to improve detection sensitivity and accuracy, by a large amount of
The primer in specificity matching rs10757278 site of the experimental design verifying based on ARMS-qPCR method, saltant type reverse primer
3 ' ends are weak mispairing (G/T), therefore increase strong mispairing (C/T) in primer third last base；Optimizing reaction system and reaction
Condition: annealing temperature adjusts about 58 degrees Celsius；Each each condition of step cooperates, and so that it is successfully completed amplification and distinguishes function
Can, the high specific and sensitivity of detection are significantly improved, is had broad application prospects and huge market value.
Primer provided by the invention is based on amplification Refracting Mutation system (amplification refractory
Mutation system, ARMS) it is designed, design of primers can determine the sensitivity of the detection system；In design of primers, the
One principle is: 3 ' terminal bases are fallen on the position of mutation, the base and wildtype gene sequence complete complementary, and with it is prominent
Modification mismatches；Second principle is: 3 ' ends introduce second base mismatch, and the introducing of this base to a certain extent can be with
The specificity of primer being improved, but the height of specificity additionally depends on the mispairing type of base, mispairing type includes " strong ", " in
Degree ", and " weak " mispairing.For example: if 3 ' ends are " strong " mispairing (A/G or C/T), needing to introduce the mispairing (C/A of " weak "
Or G/T) or do not need to introduce mispairing；And so on, when 3 ' ends are that " moderate " mispairing (A/A, C/C, G/G or T/T) then needs to draw
Enter the mispairing of " moderate ".This PCR atopic design of primers and screening based on amplification retardance and mispairing technology is this hair
Key in bright technology, introducing second base mismatch in primer can be improved the accuracy and sensitivity of detection.
Second aspect, the present invention provide the primer of one kind as described in relation to the first aspect and are used to prepare detection abdominal aneurvsm correlation
The kit of SNP site rs10757278 and/or the application of detection architecture.
The third aspect, the present invention provide a kind of detection architecture, and the detection architecture includes primer as described in relation to the first aspect.
Preferably, the system further includes the water and buffer of no RNA enzyme.
Preferably, the buffer includes 2 × SYBR Green Master Mix.
Preferably, the concentration of the primer is 4-6 μM, such as can be 4 μM, 5 μM or 6 μM.
Preferably, the detection architecture further includes positive quality control and negative Quality Control.
Preferably, the positive quality control is the positive plasmid pUC57-3040 for verifying correct 450-550 copy number, example
It such as can be 450,470,490,500,520,540 or 500.
Preferably, the negative Quality Control is seedless sour water.
Fourth aspect, the present invention provide a kind of kit, and the kit includes primer described in first aspect.
5th aspect, the present invention provide a kind of kit as described in fourth aspect and are used to prepare detection as described in the third aspect
The application of system.
6th aspect, the present invention provides the detection method of abdominal aneurvsm associated SNP positions rs10757278 a kind of, described
Method using as described in relation to the first aspect primer, in kit described in detection architecture, fourth aspect described in the third aspect
Any one or at least two combination.
Preferably, the detection method includes the following steps:
(1) sample DNA is extracted；
(2) reaction system is prepared, ARMS-qPCR, the rs10757278 loci gene type of test sample DNA are carried out；
(3) testing result validity is judged.
As optimal technical scheme, a kind of detection method of abdominal aneurvsm associated SNP positions rs10757278 is specific to wrap
Include following steps:
(1) sample DNA is extracted；
(2) reaction system is prepared, ARMS-qPCR, the rs10757278 loci gene type of test sample DNA are carried out；
The reaction system include: the water of no RNA enzyme, 2 × SYBR Green Master Mix, 5 μM of Primer Mix,
It is correct to additionally incorporate verifying for sequence primer as shown in SEQ ID NO.1 and the sequence primer as shown in SEQ ID NO.2
The positive plasmid and seedless sour water of 500 copy numbers are as positive quality control and negative Quality Control；
The reaction condition of the ARMS-qPCR are as follows: maintain 50 DEG C of 2min, 95 DEG C of 2min；40 circulations 95 DEG C of 15s, 56 DEG C
15s, 72 DEG C of 60s；
(3) testing result validity is judged；
Validity judges criterion are as follows: there are amplification curve and Ct < 37 for positive quality control；Negative Quality Control is without amplification curve or Ct
> 37.
The extracting method of step (1) described DNA are as follows: sample to be tested DNA is extracted using QIAGEN kit, draws 20 μ L eggs
White enzyme K is in microcentrifugation tube bottom, then draws 200 μ L blood samples in above-mentioned centrifuge tube, and 200 μ L buffer solution A L are added, and is vortexed
15sec is shaken, 10min is incubated at 56 DEG C, 200 μ L dehydrated alcohols are added in of short duration centrifugation, are vortexed and mix centrifugation, are transferred to
On QIAamp Mini spin column pillar, 6000g is centrifuged 1min；Buffer solution A W1 and AW2 is added, respectively 6000g centrifugation
1min, 20000g are centrifuged 3min, are eventually adding 200 μ L buffer solution A E eluted samples.
The PCR reaction system of step (2) includes: RNase Free water, PowerUpTM Green Master
Mix (2 ×), 5 μM of Primer Mix, totally 20 μ L；PCR reaction condition are as follows: Holding 50 DEG C of 2min, 95 DEG C of 2min；40
Cycling 95 DEG C of 15sec, 56 DEG C of 15sec, 72 DEG C of 60sec.
In the present invention, invention hot radical in ARMS-qPCR method specificity matching the site rs10757278 primer, and from
Primer sets out, optimizing reaction system and reaction condition, and under strict conditions, only 3 ' base of primer is matched completely with template
When, PCR just will appear amplification, thus will there is the template of certain point mutation to distinguish with normal template, each each condition phase of step
Mutually cooperation makes it successfully complete amplification and distinguishes function, significantly improves the high specific and sensitivity of detection.
Compared with prior art, the present invention has the advantage that
The present invention extracts DNA using QIAGEN kit, designs specific primer, optimizing detection system and reaction condition,
Each each condition of step cooperates, synergistic, detects rs10757278 loci gene type by ARMS-qPCR method, compares
Existing SNP site PCR combines Sanger detection method, not only reduces cost and shortens detection time, but also increases inspection
The specificity and sensitivity of survey, the minimum applied sample amount that can detecte 100copies.
Specific embodiment
Further to illustrate technological means and its effect adopted by the present invention, below in conjunction with preferred implementation of the invention
Example to further illustrate the technical scheme of the present invention, but the present invention is not limited in scope of embodiments.
Embodiment 1
The ARMS-qPCR detection method of the abdominal aneurvsm associated SNP positions rs10757278 of the present embodiment, specifically includes
Following steps:
1. extracting sample DNA
The present embodiment extracts sample DNA using QIAGEN commercial kit, and this method is simple and convenient, sample DNA matter
Measure higher, specific extraction steps are as follows:
Take 1.6mL saliva sample in 2mL centrifuge tube, 50 DEG C of water-bath 15min, 12000g centrifugation 5min remove supernatant, add
180 μ LPBS wash precipitating, and 20 μ L Proteinase Ks and 200 μ L buffer solution A L are then added, and are vortexed and mix, 56 DEG C of incubation 60min, then
200 μ L dehydrated alcohols are added, is vortexed and mixes centrifugation, be transferred on QIAamp Mini spin column pillar, 6000g centrifugation
1min, the collecting pipe renewed；500 μ L buffer solution A W1,6000g are added and are centrifuged 1min, the collecting pipe renewed；500 μ L buffering is added
Liquid AW2,20000g are centrifuged 3min, and the collecting pipe renewed is centrifuged at full speed, is eventually adding 60 μ L buffer solution A E eluted samples.
2.PCR amplification
The primer of PCR reaction are as follows:
Forward primer: SEQ ID NO.1:CAGCCAATTTGTGGAGTGTCA
Reverse primer: SEQ ID NO.2:CTTGATTCTGCATCGCTTCC and SEQ ID NO.3:
GTCTTGATTCTGCATCGCTTCT.
PCR reaction reagent includes: RNase Free water, PowerUpTM Green Master Mix (2 ×), 5 μ
M Primer Mix, totally 20 μ L.
PCR amplification
The corresponding 2 PCR reaction of each sample, each reaction setting is dual multiple, additionally incorporates correct 500 copies of verifying
Several positive plasmids and seedless sour water are as positive quality control and negative Quality Control.
It is expanded with ARMS-qPCR, PCR reaction condition are as follows: Holding 50 DEG C of 2min, 95 DEG C of 2min；Cycling 95
DEG C 15sec, 56 DEG C of 15sec, 72 DEG C of 60sec.
Testing result must simultaneously meet following validity and judge criterion: 1) there are amplification curve and Ct < for positive quality control
37；2) negative Quality Control is without amplification curve or Ct > 37；If meeting above-mentioned validity judges criterion, detection sample can be further assessed
This, judges the genotype for detecting sample.
The detection limit verifying of embodiment 2
Plasmid pUC57-3040 of this verifying to synthesize is diluted to 5000copies/ μ L as detection sample respectively,
500copies/ μ L, 50copies/ μ L carries out detection limit confirmatory experiment, using the method for embodiment 1, with ARMS-qPCR technology
Detection, the minimum applied sample amount that can detecte 100copies.
In conclusion the present invention provide a kind of abdominal aneurvsm associated SNP positions rs10757278 detection primer and its
Using utilizing QIAGEN kit to extract DNA, design specific primer, optimizing detection system and reaction condition, each each item of step
Part cooperates, synergistic, detects rs10757278 loci gene type by ARMS-qPCR method, compares existing SNP
Point PCR combines Sanger detection method, not only reduces and cost and shortens detection time, and increase detection specificity and
Sensitivity.
The Applicant declares that the present invention is explained by the above embodiments method detailed of the invention, but the present invention not office
Be limited to above-mentioned method detailed, that is, do not mean that the invention must rely on the above detailed methods to implement.Technical field
Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention
Addition, selection of concrete mode etc., all of which fall within the scope of protection and disclosure of the present invention.
Sequence table
<110>QIAGEN (Suzhou) Translational Medicine Company
<120>a kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278
<130>2019 years
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial synthesized ()
<400> 1
cagccaattt gtggagtgtc a 21
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized ()
<400> 2
cttgattctg catcgcttcc 20
<210> 3
<211> 22
<212> DNA
<213>artificial synthesized ()
<400> 3
gtcttgattc tgcatcgctt ct 22
Claims (10)
1. a kind of detection primer of abdominal aneurvsm associated SNP positions rs10757278, which is characterized in that the primer includes 1
Forward primer and 2 reverse primers, wherein 1 forward primer has the sequence such as SEQ ID NO.1 shown in or it is mutual
Complementary series, the reverse primer have sequence or its complementary series as shown in SEQ ID NO.2 and SEQ ID NO.3.
2. primer according to claim 1, which is characterized in that the primer is the detection primer of ARMS-qPCR method.
3. a kind of primer as claimed in claim 1 or 2 is used to prepare detection abdominal aneurvsm associated SNP positions rs10757278
Kit and/or detection architecture application.
4. a kind of detection architecture, which is characterized in that the detection architecture includes primer as claimed in claim 1 or 2.
5. detection architecture according to claim 4, which is characterized in that the system further includes the water and buffering of no RNA enzyme
Liquid；
Preferably, the buffer includes 2 × SYBR Green Master Mix；
Preferably, the concentration of the primer is 4-6 μM.
6. detection architecture according to claim 4 or 5, which is characterized in that the detection architecture further include positive quality control and
Negative Quality Control；
Preferably, the positive quality control is the positive plasmid for verifying correct 450-550 copy number；
Preferably, the negative Quality Control is seedless sour water.
7. a kind of kit, which is characterized in that the kit includes primer of any of claims 1 or 2.
8. a kind of kit as claimed in claim 7 is used to prepare answering for detection architecture described in any one of claim 4-6
With.
9. a kind of detection method of abdominal aneurvsm associated SNP positions rs10757278, which is characterized in that the method is using such as
Detection architecture or reagent as claimed in claim 7 described in any one of primer of any of claims 1 or 2, claim 4-6
In box any one or at least two combination；
Preferably, the detection method includes the following steps:
(1) sample DNA is extracted；
(2) reaction system is prepared, ARMS-qPCR, the rs10757278 loci gene type of test sample DNA are carried out；
(3) testing result validity is judged.
10. according to the method described in claim 9, it is characterized in that, described method includes following steps:
(1) sample DNA is extracted；
(2) reaction system is prepared, ARMS-qPCR, the rs10757278 loci gene type of test sample DNA are carried out；
The reaction system includes: the water of no RNA enzyme, 2 × SYBR Green Master Mix, 5 μM of Primer Mix, sequences
The primer as shown in SEQ ID NO.1 and the sequence primer as shown in SEQ ID NO.2 additionally incorporate verifying correct 500
The positive plasmid of copy number and seedless sour water are as positive quality control and negative Quality Control；
The reaction condition of the ARMS-qPCR are as follows: maintain 50 DEG C of 2min, 95 DEG C of 2min；40 circulations 95 DEG C of 15s, 56 DEG C of 15s,
72℃60s；
(3) testing result validity is judged；
Validity judges criterion are as follows: there are amplification curve and Ct < 37 for positive quality control；Negative Quality Control is without amplification curve or Ct > 37.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910353438.0A CN109971859A (en) | 2019-04-29 | 2019-04-29 | A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 |
| PCT/CN2019/123740 WO2020220678A1 (en) | 2019-04-29 | 2019-12-06 | Detection primer set for snp site rs10757278 related to abdominal aortic aneurysm and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910353438.0A CN109971859A (en) | 2019-04-29 | 2019-04-29 | A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109971859A true CN109971859A (en) | 2019-07-05 |
Family
ID=67086891
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910353438.0A Pending CN109971859A (en) | 2019-04-29 | 2019-04-29 | A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109971859A (en) |
| WO (1) | WO2020220678A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254201A (en) * | 2020-03-28 | 2020-06-09 | 中国医学科学院北京协和医院 | Application of DENND1C as molecular marker for diagnosis and treatment of abdominal aortic aneurysm |
| WO2020220678A1 (en) * | 2019-04-29 | 2020-11-05 | 迈杰转化医学研究(苏州)有限公司 | Detection primer set for snp site rs10757278 related to abdominal aortic aneurysm and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103725776A (en) * | 2013-12-08 | 2014-04-16 | 北京工业大学 | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation |
| CN105506068A (en) * | 2014-10-20 | 2016-04-20 | 江苏所罗门兄弟医学科技有限公司 | AMRMS-qPCR detection kit and detection method for MMP2 genotyping |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010033825A2 (en) * | 2008-09-18 | 2010-03-25 | Geisinger Clinic | Genetic variants associated with abdominal aortic aneurysms |
| CN109971859A (en) * | 2019-04-29 | 2019-07-05 | 凯杰（苏州）转化医学研究有限公司 | A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 |
-
2019
- 2019-04-29 CN CN201910353438.0A patent/CN109971859A/en active Pending
- 2019-12-06 WO PCT/CN2019/123740 patent/WO2020220678A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103725776A (en) * | 2013-12-08 | 2014-04-16 | 北京工业大学 | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation |
| CN105506068A (en) * | 2014-10-20 | 2016-04-20 | 江苏所罗门兄弟医学科技有限公司 | AMRMS-qPCR detection kit and detection method for MMP2 genotyping |
Non-Patent Citations (5)
| Title |
|---|
| ANDREW R THOMPSON等: "Sequence variant on 9p21 is associated with the presence of abdominal aortic aneurysm disease but does not have an impact on aneurysmal expansion", 《EUROPEAN JOURNAL OF HUMAN GENETICS》 * |
| AREZOU SAYAD等: "Association of ANRIL Gene Polymorphisms with Acute Myeloid Leukemia in an Iranian Population", 《INT J CANCER MANAG.》 * |
| ERIK BIROS等: "Association of an allele on chromosome 9 and abdominal aortic aneurysm", 《ATHEROSCLEROSIS》 * |
| HAMID REZA KHORSHIDI, M.D.等: "ANRIL Genetic Variants in Iranian Breast Cancer Patients", 《CELL JOURNAL》 * |
| 陆国辉主编: "《产前遗传病诊断》", 31 October 2002, 广东科技出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020220678A1 (en) * | 2019-04-29 | 2020-11-05 | 迈杰转化医学研究(苏州)有限公司 | Detection primer set for snp site rs10757278 related to abdominal aortic aneurysm and application thereof |
| CN111254201A (en) * | 2020-03-28 | 2020-06-09 | 中国医学科学院北京协和医院 | Application of DENND1C as molecular marker for diagnosis and treatment of abdominal aortic aneurysm |
| CN111254201B (en) * | 2020-03-28 | 2020-10-27 | 中国医学科学院北京协和医院 | Application of DENND1C as molecular marker for diagnosis and treatment of abdominal aortic aneurysm |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020220678A1 (en) | 2020-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110643680B (en) | Joint suitable for ultra-trace DNA sequencing and application thereof | |
| CN105648085B (en) | A kind of method and application for quickly establishing the slow plumage system of Beijing Fatty Chicken | |
| CN109971859A (en) | A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278 | |
| CN103849687A (en) | Molecular biological identification method of fritillaria taipaiensis | |
| CN103540679A (en) | Primers, probes and detection kit for detecting human HCC (Hepatocellular Carcinoma) marker | |
| CN104073550B (en) | A kind of SCAR molecular marker differentiating Fructus Momordicae sex | |
| CN107557461B (en) | Detection method of nucleic acid mass spectrum for early screening of liver cancer susceptibility genes | |
| CN106811517A (en) | It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation | |
| CN105543352A (en) | Method of detecting copy number variation of Qinchuan cattle FGF13 genes and application thereof | |
| CN106834287A (en) | A kind of SNP marker for detecting RhD negative phenotypes | |
| CN108707654A (en) | Francolin early sex PCR identification kits, application and method | |
| CN113025738A (en) | SNP molecular marker related to drug resistance of eimeria coccidioides halofuginone and application thereof | |
| CN117004745A (en) | CRISPR-Cas9 detection method for natural PAM-deleted tuberculosis drug-resistant mutation and application | |
| CN108588205B (en) | It is a kind of for the primer sets of HLA-DRB1 High Resolution Gene Typing, kit and method | |
| CN109810982A (en) | The specific gene and its method for identifying molecules of short hairs Storehouse midge | |
| CN102094081B (en) | Method for detecting single nucleotide polymorphism of cattle SH2B1 gene | |
| CN107674911A (en) | A kind of method for detecting lactose and fructose metabolism related gene | |
| CN108624589A (en) | Circular rna circ-ERBB2 and its detection reagent and application | |
| CN106480218A (en) | A kind of method that leukocyte telomere length is detected based on qPCR method | |
| CN104046621A (en) | Porcine anti-porcine reproductive and respiratory syndrome related SNP label in tyrosine protein kinase JAK2 gene and application thereof | |
| CN105838798A (en) | Chicken MHC B-G seat complete sequence determination and SNP detection method and kit | |
| CN110172521A (en) | The molecular labeling of one breeder Eimeria Tenella resistance indirect selections and application | |
| CN109371114A (en) | HLA-DQB1 genotyping kit | |
| CN107236792B (en) | Marker for detecting intestinal cancer and application thereof | |
| CN109762905A (en) | It is a kind of for assist detection prostate cancer ddPCR Primer composition and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190705 |