CN106480218A - A kind of method that leukocyte telomere length is detected based on qPCR method - Google Patents
A kind of method that leukocyte telomere length is detected based on qPCR method Download PDFInfo
- Publication number
- CN106480218A CN106480218A CN201611143456.9A CN201611143456A CN106480218A CN 106480218 A CN106480218 A CN 106480218A CN 201611143456 A CN201611143456 A CN 201611143456A CN 106480218 A CN106480218 A CN 106480218A
- Authority
- CN
- China
- Prior art keywords
- telomere length
- detection
- dna
- rnase
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of method that leukocyte telomere length is detected based on qPCR method, comprise the steps：1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to make complete genome DNA template after merging mixing；2) first time real-time quantitative PCR detection, the telomeric primer of detection telomere repeat sequence are carried out；3) carry out second real-time quantitative PCR detection, the list copy of transcription RNase P enzyme is with reference to RNase P gene；4) calculate relative telomere length T/S.The a kind of of the present invention has been had the advantage that based on the method that qPCR method detects leukocyte telomere length：Not high to sample and genomic DNA concentration requirement, experimental implementation flow process simple possible, credible result degree is high it is adaptable to scientific research is promoted the use of with clinical, and the prevention for old and feeble, cancer and disease plays an important role.
Description
Technical field
The present invention relates to molecular genetics field, particularly to a kind of side detecting leukocyte telomere length based on qPCR method
Method.
Background technology
The end that telomere (Telomeres) is located at chromosome is be present in eukaryotic cell wire end of chromosome a bit of
DNA- protein complex, is about 5-15kb, by " TTAGGG " the short-movie section repetitive sequence in a string 5 ' -3 ' direction and in combination
Albumen composition, produce the special construction of the referred to as telomere body stability to protect chromosome, prevent its end from melting
Close and degrade.It, except providing the buffering beyond the region of objective existence of non-transcribed DNA moreover it is possible to protection end of chromosome avoids merging and degenerates, is contaminating
Colour solid positioning, replicate, protection and control cell growth and life-span aspect to have important function, and with apoptosis, cell transformation
Closely related with immortalization.
People's telomere albumen includes telomere binding protein and Telomeric Protein, telomere binding protein include TRF1, TRF2,
hPOT1；Telomeric Protein includes TIN2, TERT, Ku70, TPP1, RAP1, TANK1, TANK2, Pinx1, hRap1 etc..Electronic Speculum
It has been observed that normal telomere forms stable T ring (T-loop) structure in end of chromosome, 3 ' the single-stranded revolution of DNA is stretched
Entering DNA double chain makes partially double stranded uncoiling, combines one stable G4 conjuncted structure of rear formation, such knot with complementary strand pairing
Structure make the end of chromosome be wrapped protect and prevent degraded and terminal fusion.
With the periodic repetitions of chromosome in cell mitogen, telomere length can be gradually shortened, and environmental factorss are as inhaled
Cigarette, oxidative stress, diet and obesity all can accelerate the shortening of telomere, thus affecting the stability of chromosome.Research finds, telomere
Length increases with the age and is gradually shortened, and the consume of the telomere length of nonage is very fast, is in a plateau, 30-50 year,
50-80 year this two age brackets telomere length consume slack-off, telomere length shortens.Telomere length there is also sex difference, female
Property telomere length to be longer than male, and with the Effect of estrogen day after tomorrow, the telomere loss ratio male of women is slow, but women
Telomere consume after menopause accelerates before comparing.
Numerous studies show, the telomere of shortening and kinds of tumors, such as carcinoma of prostate, cancer of pancreas, the onset risk of breast carcinoma
And mortality rate is relevant, also age-related property disease and metabolic disease are related, such as alzheimer syndrome, heart infarction,
Type ii diabetes, vascular dementia, atherosclerosiss and senilism syndrome etc..Therefore, telomere length is considered as a kind of permanent
The important indicator of amount function of human body, sets up a kind of general effective telomere length assay method to prevention human senility and tumor etc.
Facilitate significant.
Scientists begin to study the mensure of telomere length from the eighties in last century, and establish a series of detections successively
The method of telomere length, such as FISH, Southern Blot, Flow-FISH etc., in these methods Southern Blot compare
Intuitively, but require genome larger (＞ 1ug), its operation is comparatively laborious simultaneously, and time-consuming.And using FISH platform is
Although row detection method rapid and convenient, the requirement to sample is higher.It is unfavorable for the popularization and application of technology.
Content of the invention
In order to solve above technical problem, the present invention provides a kind of side detecting leukocyte telomere length based on qPCR method
Method, carries out the detection of high-throughout leukocyte telomere length (LTL), the method using quantitative polyase chain reaction (q-PCR)
Not high to sample and genomic DNA concentration requirement, experimental implementation flow process simple possible, credible result degree high it is adaptable to scientific research and
Clinical promotes the use of, and the prevention for old and feeble, cancer and disease plays an important role.
A kind of method detecting leukocyte telomere length based on qPCR method of the present invention, comprises the steps：
1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to merge
Complete genome DNA template is made after mixing；
2) carry out first time real-time quantitative PCR detection, the telomeric primer of detection telomere repeat sequence is：
SEQ ID NO.1：CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT；
SEQ ID NO.2：GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT；
3) carry out second real-time quantitative PCR detection, the list copy of transcription RNase P enzyme is with reference to RNase P gene；
4) calculate relative telomere length T/S.
Further, described step 1) extracting genome DNA autoblood, tissue, saliva, sperm or ovum tissue thin
Born of the same parents.
Further, described step 1) extracting method include phenol/chloroform method, automatic extracting instrument extraction method or cross post centrifugation
RNA isolation kit.
Further, described step 2) first time real-time quantitative PCR detection and step 3) second real-time quantitative PCR
The dyestuff that detection adopts is SYBR Green I.
Further, described step 2) first time real-time quantitative PCR detection and step 3) second real-time quantitative PCR
Detection is detection sample and arranges three parallel holes, and arranges five gradient concentrations of template DNA, ratio is 1,0.5,0.25,
1.25th, 0.625, each gradient arranges three parallel holes, makes standard curve.
Further, described step 2) telomere repeat sequence detection PCR reaction system be certain proportioning
SuperReal Premix Plus, SEQ ID NO.1, SEQ ID NO.2, DNA mixture；Total reaction volume is 10ul；Reaction
Condition is：98 DEG C, mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations.
Further, described step 3) transcription RNase P enzyme list copy with reference to RNase P gene PCR reactant
It is the Taqman Expression Master Mix for certain proportioning, RNase P, DNA mixture, total reaction volume is
10ul；Reaction condition is：98 DEG C, mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations.
The invention provides a kind of method that leukocyte telomere length is detected based on qPCR method, there is provided detection telomere length
Primer and single gene copy reference.Telomere repeat sequence copy number (Telomere repeat copy number, T) and list
The ratio (T/S ratio) of copy gene copy number (Single-gene copy number, S) and telomere length are directly proportional pass
System, the relatively average telomere length of the present invention is obtained by the ratio calculating T/S.Computing formula is：LTL=mean
Quantity (LTL group)/mean Quantity (RNase P group).
The present invention is a kind of have been had the advantage that based on the method that qPCR method detects leukocyte telomere length：To sample and
Genomic DNA concentration requirement is not high, experimental implementation flow process simple possible, and credible result degree is high it is adaptable to scientific research pushes away with clinical
Wide use, the prevention for old and feeble, cancer and disease plays an important role.
Specific embodiment
Below the embodiment it is clear that described is clearly and completely described to the technical scheme in the embodiment of the present invention
It is only a part of embodiment of the present invention, rather than whole embodiments.Based on the embodiment in the present invention, the common skill in this area
The every other embodiment that art personnel are obtained under the premise of not making creative work, broadly falls into the model of present invention protection
Enclose.
Embodiment 1
A kind of method detecting leukocyte telomere length based on qPCR method of the present embodiment, comprises the steps：
1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to merge
Complete genome DNA template is made after mixing；
Extract complete genome DNA：Genomic DNA comes autoblood, tissue, saliva, sperm or ovum, using phenol/chloroform method
Extract comprising the following steps that of complete genome DNA：
(1) by frozen anticoagulation in thaw at RT, mixing；
(2) 200ul fresh blood is taken to put in 1.5ml centrifuge tube；
(3) add 200ul cell pyrolysis liquid, 30ul Proteinase K, vortex 15s mix, water-bath in 55 DEG C
10min；
(4) add equal-volume phenol, about 500ul, vortex 15s, 12000rpm are centrifuged 5min；
(5) take supernatant, add equal-volume phenol/chloroform/isoamyl alcohol, about 500ul, vortex 15s, 12000rpm are centrifuged
5min；
(6) take supernatant, add equal-volume chloroform, about 500ul, vortex 15s, 12000rpm are centrifuged 5min；
(7) take supernatant, add the dehydrated alcohol of 2 times of volumes, about 800ul, vortex 15s, 12000rpm are centrifuged 8min；
(8) remove supernatant, add 1ml 75% ethanol, suspend precipitation, 12000rpm is centrifuged 5min；
(9) remove supernatant, place 10min and dry；
(10) add 100ul ddH2O, room temperature places 5min, piping and druming mixes the DNA liquid as carrying；
2) first time real-time quantitative PCR detection is carried out with dye method, in PCR course of reaction, often form a DNA double chain
Just there is a certain amount of dyestuff to combine up and produce fluorescence signal, SYBR Green I is attached to DNA double spiral ditch region, letter
Number intensity and DNA molecular sum are proportional, and used by the present invention, telomere length detection primer is as follows：
SEQ ID NO.1：CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
SEQ ID NO.2：GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
Reaction system is：4.3ul 2 × SuperReal Premix Plus, 0.3ul SEQ ID NO.1 (10uM),
0.3ul SEQ ID NO.2 (10uM), 5ul DNA (1-5ng/ul), total reaction volume is 10ul, and reaction condition is：98℃
Mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations；
During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve.
3) second real-time quantitative PCR detection is carried out with dye method, the list copy of transcription RNase P enzyme is with reference to RNase P
Gene；Reaction system is：4.7ul 2 × Taqman Expression Master Mix, 0.3ul RNase P, 5ul DNA
(5ng/ul).Total reaction volume is 10ul；Reaction condition is：Mono- circulation of 98 DEG C of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45
Individual circulation；During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve；
4) calculate relative telomere length T/S；Relatively average telomere length is obtained by the ratio calculating T/S, computing formula
For：LTL=mean Quantity (LTL group)/mean Quantity (RNase P group).
The present embodiment is a kind of have been had the advantage that based on the method that qPCR method detects leukocyte telomere length：To sample
Not high with genomic DNA concentration requirement, experimental implementation flow process simple possible, credible result degree high it is adaptable to scientific research and clinical
Promote the use of, the prevention for old and feeble, cancer and disease plays an important role.
Embodiment 2
A kind of method detecting leukocyte telomere length based on qPCR method of the present embodiment, comprises the steps：
1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to merge
Complete genome DNA template is made after mixing；
Extract complete genome DNA：Genomic DNA comes autoblood, tissue, saliva, sperm or ovum, adopts
QuickGene610L automatic extracting instrument extracts comprising the following steps that of complete genome DNA：
1) by frozen anticoagulation in thaw at RT, mixing；
2) take new 15ml centrifuge tube, sequentially add 300ml EDB solution, 2ml whole blood, 2.5ml LDB solution；
3) turn upside down mixing, vortex 15s, water-bath 10min in 55 DEG C；
4) add 2.5ml dehydrated alcohol, mix, vortex 15s；
5) whole blood processing is poured in the QuickGene sleeve pipe with film for the 610L；
6) upper machine, extracting selection pattern " DNA WHOLE BLOOD ", is started by start for the first time；
7) second extracting selection pattern " INSOLUTION A "；
8) obtain sample DNA solution after terminating；
2) first time real-time quantitative PCR detection is carried out with dye method, in PCR course of reaction, often form a DNA double chain
Just there is a certain amount of dyestuff to combine up and produce fluorescence signal, SYBR Green I is attached to DNA double spiral ditch region, letter
Number intensity and DNA molecular sum are proportional, and used by the present invention, telomere length detection primer is as follows：
SEQ ID NO.1：CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
SEQ ID NO.2：GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
Reaction system is：4.3ul 2 × SuperReal Premix Plus, 0.3ul SEQ ID NO.1 (10uM),
0.3ul SEQ ID NO.2 (10uM), 5ul DNA (1-5ng/ul), total reaction volume is 10ul, and reaction condition is：98℃
Mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations；
During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve.
3) second real-time quantitative PCR detection is carried out with dye method, the list copy of transcription RNase P enzyme is with reference to RNase P
Gene；Reaction system is：4.7ul 2 × Taqman Expression Master Mix, 0.3ul RNase P, 5ul DNA
(5ng/ul).Total reaction volume is 10ul；Reaction condition is：Mono- circulation of 98 DEG C of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45
Individual circulation；During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve；
4) calculate relative telomere length T/S；Relatively average telomere length is obtained by the ratio calculating T/S, computing formula
For：LTL=mean Quantity (LTL group)/mean Quantity (RNase P group).
The present embodiment is a kind of have been had the advantage that based on the method that qPCR method detects leukocyte telomere length：To sample
Not high with genomic DNA concentration requirement, experimental implementation flow process simple possible, credible result degree high it is adaptable to scientific research and clinical
Promote the use of, the prevention for old and feeble, cancer and disease plays an important role.
Embodiment 3
A kind of method detecting leukocyte telomere length based on qPCR method of the present embodiment, comprises the steps：
1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to merge
Complete genome DNA template is made after mixing；
Extract complete genome DNA：Genomic DNA comes autoblood, tissue, saliva, sperm or ovum, using QIAamp DNA
Mini Kit test kit extracts comprising the following steps that of complete genome DNA：
1) 200ul fresh blood is taken to be placed in 1.5ml centrifuge tube；
2) add 200ul cell pyrolysis liquid, 30ul Proteinase K, vortex 15s mix, water-bath in 55 DEG C
10min；
3) add 200ul dehydrated alcohol toward in centrifuge tube, vortex 15s mixes；
4) centrifugation liquid in pipe is transferred in new QIAamp Mini spin column；
5) 8000rpm centrifugation 1min, abandons liquid, adds 500ul Buffer AW1；
6) 8000rpm centrifugation 1min, abandons liquid, adds 500ul Buffer AW2；
7) 13000rpm centrifugation 3min, abandons liquid；
8) 13000rpm centrifugation 3min, abandons liquid；
9) spin pipe is transferred in new clean 1.5ml centrifuge tube, adds 200ul Buffer AE, room temperature is placed
5-10min；
10) 8000rpm centrifugation 1min, under liquid be tissue DNA solution；
2) first time real-time quantitative PCR detection is carried out with dye method, in PCR course of reaction, often form a DNA double chain
Just there is a certain amount of dyestuff to combine up and produce fluorescence signal, SYBR Green I is attached to DNA double spiral ditch region, letter
Number intensity and DNA molecular sum are proportional, and used by the present invention, telomere length detection primer is as follows：
SEQ ID NO.1：CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
SEQ ID NO.2：GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
Reaction system is：4.3ul 2 × SuperReal Premix Plus, 0.3ul SEQ ID NO.1 (10uM),
0.3ul SEQ ID NO.2 (10uM), 5ul DNA (1-5ng/ul), total reaction volume is 10ul, and reaction condition is：98℃
Mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations；
During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve.
3) second real-time quantitative PCR detection is carried out with dye method, the list copy of transcription RNase P enzyme is with reference to RNase P
Gene；Reaction system is：4.7ul 2 × Taqman Expression Master Mix, 0.3ul RNase P, 5ul DNA
(5ng/ul).Total reaction volume is 10ul；Reaction condition is：Mono- circulation of 98 DEG C of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45
Individual circulation；During detection, each detection sample three parallel hole of setting, and five gradient concentrations of template DNA are set, ratio is
(1,0.5,0.25,1.25,0.625), each gradient arranges three parallel holes, makes standard curve；
4) calculate relative telomere length T/S；Relatively average telomere length is obtained by the ratio calculating T/S, computing formula
For：LTL=mean Quantity (LTL group)/mean Quantity (RNase P group).
The present embodiment is a kind of have been had the advantage that based on the method that qPCR method detects leukocyte telomere length：To sample
Not high with genomic DNA concentration requirement, experimental implementation flow process simple possible, credible result degree high it is adaptable to scientific research and clinical
Promote the use of, the prevention for old and feeble, cancer and disease plays an important role.
Moreover, it will be appreciated that although this specification is been described by according to embodiment, not each embodiment only wraps
Containing an independent technical scheme, only for clarity, those skilled in the art should for this narrating mode of description
Using description as an entirety, the technical scheme in each embodiment can also form those skilled in the art through appropriately combined
Understandable other embodiment.
Claims (7)
1. a kind of method based on qPCR method detection leukocyte telomere length is it is characterised in that comprise the steps：
1) extract the genomic DNA of different tissues, dilution DNA concentration of specimens, to 5ng/ul, takes each tissue samples 5ul to merge mixing
After make complete genome DNA template；
2) carry out first time real-time quantitative PCR detection, the telomeric primer of detection telomere repeat sequence is：
SEQ ID NO.1：CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT；
SEQ ID NO.2：GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT；
3) carry out second real-time quantitative PCR detection, the list copy of transcription RNase P enzyme is with reference to RNase P gene；
4) calculate relative telomere length T/S.
2. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 1) extracting genome DNA autoblood, tissue, the histiocyte of saliva, sperm or ovum.
3. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 1) extracting method include phenol/chloroform method, automatic extracting instrument extraction method or cross post centrifugation RNA isolation kit.
4. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 2) the detection of first time real-time quantitative PCR and step 3) the dyestuff that adopts of second real-time quantitative PCR detection be
SYBR Green I.
5. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 2) the detection of first time real-time quantitative PCR and step 3) the detection of second real-time quantitative PCR be detection sample and set
Put three parallel holes, and five gradient concentrations of template DNA are set, ratio is 1,0.5,0.25,1.25,0.625, each gradient
Three parallel holes of setting, make standard curve.
6. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 2) telomere repeat sequence detection PCR reaction system be certain proportioning SuperReal Premix Plus, SEQ
ID NO.1, SEQ ID NO.2, DNA mixture；Total reaction volume is 10ul；Reaction condition is：98 DEG C, mono- circulation of 10min；
95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations.
7. according to claim 1 a kind of based on qPCR method detect leukocyte telomere length method it is characterised in that：Institute
State step 3) transcription RNase P enzyme list copy with reference to RNase P gene PCR reaction system be certain proportioning Taqman
Expression Master Mix, RNase P, DNA mixture, total reaction volume is 10ul；Reaction condition is：98 DEG C,
Mono- circulation of 10min；95 DEG C of 30s, 60 DEG C of 1min, totally 45 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611143456.9A CN106480218A (en) | 2016-12-13 | 2016-12-13 | A kind of method that leukocyte telomere length is detected based on qPCR method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611143456.9A CN106480218A (en) | 2016-12-13 | 2016-12-13 | A kind of method that leukocyte telomere length is detected based on qPCR method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106480218A true CN106480218A (en) | 2017-03-08 |
Family
ID=58285317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611143456.9A Pending CN106480218A (en) | 2016-12-13 | 2016-12-13 | A kind of method that leukocyte telomere length is detected based on qPCR method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106480218A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113957136A (en) * | 2021-10-27 | 2022-01-21 | 中科解码(北京)生物技术有限公司 | Telomere length detection primer composition, kit and application thereof |
| CN116555402A (en) * | 2023-06-27 | 2023-08-08 | 成都云测医学生物技术有限公司 | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2513747A1 (en) * | 2003-01-24 | 2004-08-12 | University Of Utah | Methods of predicting mortality risk by determining telomere length |
| CN103173560A (en) * | 2013-04-10 | 2013-06-26 | 北京博海通达生物科技有限公司 | Telomere length detection method based on fluorescent quantitative PCR |
| WO2014152676A1 (en) * | 2013-03-15 | 2014-09-25 | New York University | A method for a single cell analysis of telomer length |
| CN105283559A (en) * | 2013-05-22 | 2016-01-27 | 端粒诊断公司 | Measures of short telomere abundance |
| CN105662482A (en) * | 2011-12-31 | 2016-06-15 | 端粒诊断公司 | Saliva-derived measures of telomere abundance and sample collection device |
-
2016
- 2016-12-13 CN CN201611143456.9A patent/CN106480218A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2513747A1 (en) * | 2003-01-24 | 2004-08-12 | University Of Utah | Methods of predicting mortality risk by determining telomere length |
| CN105662482A (en) * | 2011-12-31 | 2016-06-15 | 端粒诊断公司 | Saliva-derived measures of telomere abundance and sample collection device |
| WO2014152676A1 (en) * | 2013-03-15 | 2014-09-25 | New York University | A method for a single cell analysis of telomer length |
| CN103173560A (en) * | 2013-04-10 | 2013-06-26 | 北京博海通达生物科技有限公司 | Telomere length detection method based on fluorescent quantitative PCR |
| CN105283559A (en) * | 2013-05-22 | 2016-01-27 | 端粒诊断公司 | Measures of short telomere abundance |
Non-Patent Citations (2)
| Title |
|---|
| NENDIX L. ET.AL: "Longitudinal Changes in Leukocyte Telomere Length and Mortality in Humans", 《J. GERONTOL.A BIOL.SCI.MED.SCI.》 * |
| 陈智龙: "《个体化用药基因检测的临床应用》", 31 March 2016, 云南科技出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113957136A (en) * | 2021-10-27 | 2022-01-21 | 中科解码(北京)生物技术有限公司 | Telomere length detection primer composition, kit and application thereof |
| CN116555402A (en) * | 2023-06-27 | 2023-08-08 | 成都云测医学生物技术有限公司 | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose |
| CN116555402B (en) * | 2023-06-27 | 2023-09-26 | 成都云测医学生物技术有限公司 | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105586427B (en) | Primers, kit and method for detecting human BRCA1 and BRCA2 gene mutation | |
| CN103540679B (en) | Primers, probes and detection kit for detecting human HCC (Hepatocellular Carcinoma) marker | |
| US10519484B2 (en) | Lytic composition and application thereof, kit, method for preparing nucleic acid by utilizing lytic composition, and nucleic acid analysis method | |
| WO2010108325A1 (en) | Loop-shaped primer employed in nucleic acid amplification and the use thereof | |
| CN104328164A (en) | Kit for detecting human EGFR gene mutation by using fluorescence probe hybridization method | |
| CN109790568B (en) | Multiplex allele-specific PCR assay for detecting ESR1 mutation at estrogen receptor | |
| CN106480218A (en) | A kind of method that leukocyte telomere length is detected based on qPCR method | |
| CN106811517A (en) | It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation | |
| CN105177118B (en) | Detect the primer and probe system and kit of Human epidermal growth factor receptor gene mutation | |
| CN110484625A (en) | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation | |
| CN109371124A (en) | Application of the miR-6802-3p in postmenopausal osteoporosis early diagnosis | |
| US20230304081A1 (en) | Primer and probe design method, detection composition, and kit for mirna detection | |
| CN110373454A (en) | A kind of kit and method of joint-detection EGFR genetic mutation | |
| CN110055258B (en) | Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof | |
| CN108950015B (en) | Multiplex PCR detection kit for identifying Pomacea canaliculata hybrid type and detection method thereof | |
| US11021756B2 (en) | MiRNA markers for the diagnosis of osteosarcoma | |
| CN112280861A (en) | Detection system for detecting homologous recombination gene mutation HRRm | |
| CN106701961B (en) | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pestivirus | |
| US10131956B2 (en) | Marker used for detection of colon cancer, and application thereof | |
| CN111321224A (en) | miRNA biomarker combination for diagnosis or auxiliary diagnosis of gastric cancer and kit thereof | |
| CN108977524A (en) | A kind of detection method and detection kit of HLA-B*5801 gene | |
| CN116732171B (en) | Primer probe combination for screening colorectal cancer methylation double sites and kit thereof | |
| CN107858427B (en) | Application of miR-429 in preparation of breast cancer diagnosis and detection kit | |
| RU2800265C1 (en) | Method of predicting the development of relapse in patients with human papillomavirus and non-muscle-invasive bladder cancer | |
| CN114990142B (en) | FYCO1-ALK fusion gene, detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170308 |
|
| WD01 | Invention patent application deemed withdrawn after publication |