CN107674911A - A kind of method for detecting lactose and fructose metabolism related gene - Google Patents

A kind of method for detecting lactose and fructose metabolism related gene Download PDF

Info

Publication number
CN107674911A
CN107674911A CN201710802852.6A CN201710802852A CN107674911A CN 107674911 A CN107674911 A CN 107674911A CN 201710802852 A CN201710802852 A CN 201710802852A CN 107674911 A CN107674911 A CN 107674911A
Authority
CN
China
Prior art keywords
seq
sites
snp
gene
template
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710802852.6A
Other languages
Chinese (zh)
Inventor
韦玉军
李航
崔俊生
刘伟
顾鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yinchuan Anlong Gene Technology Co Ltd
Original Assignee
Yinchuan Anlong Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yinchuan Anlong Gene Technology Co Ltd filed Critical Yinchuan Anlong Gene Technology Co Ltd
Priority to CN201710802852.6A priority Critical patent/CN107674911A/en
Publication of CN107674911A publication Critical patent/CN107674911A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of method for detecting lactose and fructose metabolism related gene, comprise the following steps that：DNA is extracted with the Oral Mucosal Cells of tester；Enter performing PCR reaction by template of the DNA of Oral Mucosal Cells extraction；By above-mentioned 4 pairs of primers carry out regular-PCR amplification after, by pcr amplification product with 1% agarose gel electrophoresis；By 1% agarose gel electrophoresis band day with Ago-Gel QIAquick Gel Extraction Kit reclaim purpose band；Carry out sequencing reaction；Sequencing reaction product is purified；Denaturation, upper 3730 sequencer；6 SNP genotype are analyzed according to sequencing result.The present invention has the advantages that easy to operate, detection efficiency is higher, safe and reliable.

Description

A kind of method for detecting lactose and fructose metabolism related gene
Technical field
The present invention relates to field of biological detection, a kind of specifically side for detecting lactose and fructose metabolism related gene Method.
Background technology
For the whole world, the problem of with the presence of population alactasia more than half, particularly Asians, to dairy digestive Malabsorption person's proportion is bigger, and lactose intolerance can be endangered each age population composition, and this is not only a medical problem, And be also to be related to world population nutrition and health problem, how to solve this problem, received more and more many both at home and abroad The attention of more scholars.
Mankind's lactase is different from other disaccharidases, and non-induible enzyme, is not adjusted by substrate specificity directly, it is impossible to by prolonging Long nursing period or continuous drink breast are allowed to activity and maintain down, and lactase is enzyme caused by a kind of small intestinal cells, and this enzyme depends on Lactose is simultaneously split into galactolipin and glucose molecule, and glucose is absorbed at once, but if can not produce enough breasts Carbohydrase, it will be gone wrong in metabolising lactose, lactose intolerance can be caused by lacking lactase, show as abdominal distension, flatulence With diarrhoea etc. symptom.
The research for the mechanism of action transcribed with the regulation lactase gene to MCM6 gene polymorphism sites deepens continuously, There is scholar to propose that there is different ability of regulation and control, Olds LC etc. to pass through in gene transcription process by allele T and C external real Test, cloned the genetic fragment in mankind C/T-13910 sites using luciferase reporter carrier, and by recombinant vector transfected with human In intestinal epithelial cell, it is found that the pleomorphism site is located at the enhancer region of LCT genes, and -13910T sites compared with - 13910C sites can improve the activity of 4 times of lactase gene promoter, and -13910 section protein are detected using electrophoretic mobility With DNA interaction situation, find in transcription, nuclear factor is combined stronger with -13910T, and is combined with -13910C Weaker, this result of study lacks for MCM6 genes rs4988235 (C/T-13910) loci polymorphisms with lactase gene to be provided Foundation in terms of more multiple gene transcription, at present in some laboratories in Europe, change gene polynorphisms site as breast The heredity mark of sugar tolerance carries out routine clinical diagnosis.
Hereditary fructose intolerance is one kind of fructose metabolism disease, is autosomal recessive hereditary diseases, is due to aldehyde contracting Enzyme 1 B gene (ALDOB genes) mutation causes Type B deficiency of aldolase or activity to reduce, so as to cause patient the metabolism of fructose occur It is abnormal, the European incidence of disease about 1:26100, and China's incidence of disease it is not immediately clear, with the improvement of people's living standards, to sugar Consumption it is more and more, the fructose intolerance incidence of disease can gradually increase.
Clinically hereditary fructose intolerance infant is more rare, due to containing sucrose mostly in various formula milks, institute It is acute after birth to be that vomiting, diarrhoea, dehydration, shock and hemorrhagic tendency etc. occurred in 2-3 days in the neonate of artificial feeding Liver failure symptom, this sick clinical diagnosis need to rely on blood biochemistry checking and fructose tolerance test, but both sides Method is damaging, and accuracy in detection is not very high, it is necessary to be further improved.
The content of the invention
The technical problems to be solved by the invention are of the prior art damaging, accuracy in detection be present not to overcome The defects of high, and a kind of method for detecting lactose and fructose metabolism related gene is provided.
The present invention solves the technical scheme that above-mentioned technical problem provides：The invention discloses one kind detection lactose and fructose The method of metabolism related gene, is comprised the following steps that：
(1), DNA is extracted with the Oral Mucosal Cells of tester；
(2), performing PCR reaction is entered by template of the DNA of Oral Mucosal Cells extraction, respectively with SEQ NO 1 and SEQ NO 2 MCM6 gene SNP rs4988235 sites are expanded for primer, are that primer expands MCM6 gene SNPs with SEQ NO 3 and SEQ NO 4 Rs182549 sites, it is that primer expands ALDOB gene SNP rs1800588 sites with SEQ NO 5 and SEQ NO 6, uses SEQ NO 7 and SEQ NO 8 is that primer expands ALDOB gene SNP rs4994 sites；
(3) it is after above-mentioned 4 pairs of primers, are carried out into regular-PCR amplification, pcr amplification product is electric with 1% Ago-Gel Swimming；
(4), by 1% agarose gel electrophoresis band day with Ago-Gel QIAquick Gel Extraction Kit reclaim purpose bar Band；
(5) sequencing reaction, is carried out；
(6), sequencing reaction product is purified：
Add 3ul EDTA and 18ul absolute ethyl alcohols in sequencing reaction product, 3700r/min, centrifuge 30min, be then inverted, 800r/min centrifuges 10s, then takes out, and adds the ethanol of 50ul 80%, 3700r/min, centrifuges 15min, be then inverted, 800r/ Min centrifugations 10s takes out；
(7), it is denatured, upper 3730 sequencer：
In sample after sequencing reaction product purification plus 10ul Hidi, upper PCR instrument denaturation, condition are 94 DEG C of denaturation 2min, 4 DEG C preserve upper 3730 sequencer after 3min；
(8) 6 SNP genotype, are analyzed according to sequencing result.
Preferably, in described step (1), DNA is extracted using buccal swab DNA extraction kit.
Preferably, in described step (1), the DNA concentration of extraction is not less than 10ng/ul, 260/280=1.9 ± 2.
Preferably, in described step (2), PCR reaction systems are 25uL, and it includes：
Template：2uL、SEQ NO 1:1uL、SEQ NO 2：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 3:1uL、SEQ NO4：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、 Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 5:1uL、SEQ NO 6：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 7:1uL、SEQ NO 8：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL.
Preferably, in described step (2), for SNP rs4988235 sites, SNP rs182549 sites, SNP Rs1800588 sites, the primer sets in SNP rs4994 sites are as follows：
For MCM6 gene SNPs rs4988235 primer sets：
SEQ NO 1：CAATGTACTAGTAGGCCTCTGC
SEQ NO 2：CCACTGACCTATCCTCGTGG
For MCM6 gene SNPs rs182549 primer sets：
SEQ NO 3：TCTTGAGTAGCTGGGACCACA
SEQ NO 4：CCTGGGAAGGGTGCTGTATAA
For ALDOB gene SNPs rs1800588 primer sets：
SEQ NO 5：GACTTGCAGGGCTTGATGG
SEQ NO 6：GCTGACAGATGCTGGCGTA
For ALDOB gene SNPs rs4994 primer sets：
SEQ NO 7：GACCAAATCTTTCCCTACCACA
SEQ NO 8：TTGCCGACCAGTGTCCATC.
Preferably, in described step (2), PCR reaction conditions are：
Enter circular response after 95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 40 Individual circulation, 72 DEG C extend 5min, 4 DEG C of preservations afterwards.
Preferably, in described step (5), sequencing reaction system is 5ul：Primer 1uL, glue reclaim product be template and Water common 3ul, bigdye 1ul；
Preferably, in described step (5), sequencing reaction condition is as follows：95 DEG C of pre-degeneration 5min, subsequently enter and follow Ring, 95 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 35 circulations, afterwards, continues 72 DEG C of extension 5min, 4 DEG C of guarantors Deposit.
Preferably, in described step (8), with 6 SNP genotype of Chromas software analysis.
Compared with prior art, the present invention has following advantageous benefits：
The present invention provides a kind of method for detecting lactose and fructose metabolism related gene, comprises the following steps：Acquisition is examined Person's nucleic acid, the nucleic acid include DNA fragmentation, and described DNA fragmentation is using buccal swab scraping Oral Mucosal Cells, with day with mouth Empty swab extracts kit extracts DNA；Detect the base of the rs4988235 and rs182549 of lactose MCM6 genes 2 SNP sites Because of type, the genotype of the rs1800546 and rs76917243 of fructose ALDOB genes 2 SNP sites, including 4 pairs of primers Amplification includes the DNA fragmentation of 4 SNP sites, determines the base type of the SNP site；
The research of the mechanism of action of regulation lactase gene transcription to MCM6 gene polymorphism sites deepens continuously, and has Person proposes that there is different ability of regulation and control, Olds LC etc. to pass through experiment in vitro, profit in gene transcription process by allele T and C The genetic fragment in mankind C/T-13910 sites is cloned with luciferase reporter carrier, and by recombinant vector transfected with human small intestine In epithelial cell, it is found that the pleomorphism site is located at the enhancer region of LCT genes, and -13910T sites are compared with -13910C positions Point can improve the activity of 4 times of lactase gene promoter, and -13910 section protein and DNA phase are detected using electrophoretic mobility Interaction situation, is found in transcription, and nuclear factor is combined stronger with -13910T, and is combined with -13910C weaker, this grinds Study carefully result and provide more polygenes for MCM6 genes rs4988235 (C/T-13910) loci polymorphisms and lactase gene shortage Foundation in terms of transcription, hereditary fructose intolerance be fructose metabolism disease one kind, be autosomal recessive hereditary diseases, be by Type B deficiency of aldolase or activity is caused to reduce in aldolase B gene (ALDOB genes) mutation, so as to cause patient fructose occur Metabolic disorder；
The present invention separately designs a pair of spies for the rs4988235 and rs182549 of lactose MCM6 genes 2 SNP sites Specific primer, for the rs1800546 and rs76917243 of fructose ALDOB genes 2 SNP sites separately design a pair it is special Property primer, can same PCR system expand and under the conditions of be tested, this method is that a kind of cost is low, and speed is fast, lossless Wound property, the method that parting is carried out to lactose and fructose related gene of high accuracy.
Brief description of the drawings
Fig. 1 is to be carried out commonly in embodiment 1 so that Lee is carried out into 4 pairs of primers in lactose and the detection of fructose metabolism related gene Pcr amplification product is with 2% agarose gel electrophoresis figure obtained after 1% agarose gel electrophoresis after PCR amplifications；
Fig. 2 is MCM6 gene SNP rs4988235 sites Chromas analysis result figures；
Fig. 3 is MCM6 gene SNP rs182549 sites Chromas analysis result figures；
Fig. 4 is ALDOB gene SNP rs1800588 sites Chromas analysis result figures；
Fig. 5 is for ALDOB gene SNP rs4994 sites Chromas analysis result figures.
Embodiment
The invention discloses a kind of method for detecting lactose and fructose metabolism related gene, comprise the following steps that：
(1), DNA is extracted with the Oral Mucosal Cells of tester；
(2), performing PCR reaction is entered by template of the DNA of Oral Mucosal Cells extraction, respectively with SEQ NO 1 and SEQ NO 2 MCM6 gene SNP rs4988235 sites are expanded for primer, are that primer expands MCM6 gene SNPs with SEQ NO 3 and SEQ NO 4 Rs182549 sites, it is that primer expands ALDOB gene SNP rs1800588 sites with SEQ NO 5 and SEQ NO 6, uses SEQ NO 7 and SEQ NO 8 is that primer expands ALDOB gene SNP rs4994 sites；
(3) it is after above-mentioned 4 pairs of primers, are carried out into regular-PCR amplification, pcr amplification product is electric with 1% Ago-Gel Swimming；
(4), by 1% agarose gel electrophoresis band day with Ago-Gel QIAquick Gel Extraction Kit reclaim purpose bar Band；
(5) sequencing reaction, is carried out；
(6), sequencing reaction product is purified：
Add 3ul EDTA and 18ul absolute ethyl alcohols in sequencing reaction product, 3700r/min, centrifuge 30min, be then inverted, 800r/min centrifuges 10s, then takes out, and adds the ethanol of 50ul 80%, 3700r/min, centrifuges 15min, be then inverted, 800r/ Min centrifugations 10s takes out；
(7), it is denatured, upper 3730 sequencer：
In sample after sequencing reaction product purification plus 10ul Hidi, upper PCR instrument denaturation, condition are 94 DEG C of denaturation 2min, 4 DEG C preserve upper 3730 sequencer after 3min；
(8) 6 SNP genotype, are analyzed according to sequencing result.
Preferably, in described step (1), DNA is extracted using buccal swab DNA extraction kit.
Preferably, in described step (1), the DNA concentration of extraction is not less than 10ng/ul, 260/280=1.9 ± 2.
Preferably, in described step (2), PCR reaction systems are 25uL, and it includes：
Template：2uL、SEQ NO 1:1uL、SEQ NO 2：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 3:1uL、SEQ NO4：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、 Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 5:1uL、SEQ NO 6：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 7:1uL、SEQ NO 8：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL.
Preferably, in described step (2), for SNP rs4988235 sites, SNP rs182549 sites, SNP Rs1800588 sites, the primer sets in SNP rs4994 sites are as follows：
For MCM6 gene SNPs rs4988235 primer sets：
SEQ NO 1：CAATGTACTAGTAGGCCTCTGC
SEQ NO 2：CCACTGACCTATCCTCGTGG
For MCM6 gene SNPs rs182549 primer sets：
SEQ NO 3：TCTTGAGTAGCTGGGACCACA
SEQ NO 4：CCTGGGAAGGGTGCTGTATAA
For ALDOB gene SNPs rs1800588 primer sets：
SEQ NO 5：GACTTGCAGGGCTTGATGG
SEQ NO 6：GCTGACAGATGCTGGCGTA
For ALDOB gene SNPs rs4994 primer sets：
SEQ NO 7：GACCAAATCTTTCCCTACCACA
SEQ NO 8：TTGCCGACCAGTGTCCATC.
Preferably, in described step (2), PCR reaction conditions are：
Enter circular response after 95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 40 Individual circulation, 72 DEG C extend 5min, 4 DEG C of preservations afterwards.
Preferably, in described step (5), sequencing reaction system is 5ul：Primer 1uL, glue reclaim product be template and Water common 3ul, bigdye 1ul；
Preferably, in described step (5), sequencing reaction condition is as follows：95 DEG C of pre-degeneration 5min, subsequently enter and follow Ring, 95 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 35 circulations, afterwards, continues 72 DEG C of extension 5min, 4 DEG C of guarantors Deposit.
Preferably, in described step (8), with 6 SNP genotype of Chromas software analysis.
Embodiment 1
Lee is subjected to lactose and the detection of fructose metabolism related gene
(1) DNA, is extracted with buccal swab DNA extraction kit with the Oral Mucosal Cells of Lee, tests to obtain DNA concentration 30ng/ul, 260/280=1.85；
(2), extract DNA using Oral Mucosal Cells and enter performing PCR reaction as template：It is with SEQ NO 1 and SEQ NO 2 respectively Primer amplification MCM6 gene SNP rs4988235 sites, it is that primer expands MCM6 genes with SEQ NO 3 and SEQ NO 4 SNPrs182549 sites, it is that primer expands ALDOB gene SNP rs1800588 sites with SEQ NO 5 and SEQ NO 6, uses SEQNO 7 and SEQ NO 8 is that primer expands ALDOB gene SNP rs4994 sites；
By taking 25uL PCR reaction systems as an example, it includes：
Template：2uL、SEQ NO 1:1uL、SEQ NO 2：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 3:1uL、SEQ NO4：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、 Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 5:1uL、SEQ NO 6：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
Template：2uL、SEQ NO 7:1uL、SEQ NO 8：1uL、10×MSP buffer：2.5uL、20mM dNTP： 2ul、Hot start taq：0.3ul, deionized water：16.2uL；
PCR reaction conditions are as follows：
Enter the denaturation of 95 DEG C of circular response 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s after 95 DEG C of pre-degeneration 5min, totally 40 Individual circulation, 72 DEG C extend 5min, 4 DEG C of preservations afterwards；
(3), by pcr amplification product 1% agarose gel electrophoresis, glue after the progress regular-PCR amplification of above-mentioned 4 pairs of primers Figure below figure 1；
(4), it is by 1% agarose gel electrophoresis MCM6 gene SNP rs4988235 sites purpose band size 151bp, MCM6 gene SNP rs182549 sites purpose band size are 491bp, ALDOB gene SNP rs1800588 sites Purpose band size is 168bp, is 302bp for ALDOB gene SNP rs4994 sites purpose band size, with day with fine jade Sepharose QIAquick Gel Extraction Kit reclaims；
(5), sequencing reaction
Sequencing reaction 5ul systems：Primer 1uL, glue reclaim product are template and water common 3ul, bigdye 1ul；
Sequencing reaction condition is as follows：95 DEG C of pre-degeneration 5min, circulation is subsequently entered, 95 DEG C are denatured 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 25 circulations, afterwards, continue 72 DEG C of extension 5min, 4 DEG C of preservations；
(6), sequencing reaction product purification
Add 3ul EDTA and 18ul absolute ethyl alcohols in sequencing reaction product, 3700r/min, centrifuge 30min, be then inverted, 800r/min centrifugation 10s after, take out plus the ethanol of 50ul 80%, 3700r/min, centrifuge 15min, be then inverted, 800r/min from Heart 10s takes out；
(7), it is denatured, upper 3730 sequencer：
10ul Hidi, upper PCR instrument denaturation will be added in sample after sequencing reaction product purification, 94 DEG C of condition is denatured 2min, 4 DEG C preserve upper 3730 sequencing after 3min；
(8) sequencing result 4 SNP genotype of Chromas software analysis, analysis result, are shown in into Fig. 2-5；
(9), 2 SNP site genotyping results of 2 SNP sites of Lee's lactose MCM6 genes and fructose ALDOB genes are as follows Table 1：
Table 1
(10), lactose and fructose testing result
Lactose metabolism is weak：Lactose intolerance risk is high, repeatedly should use on a small quantity；Fructose metabolism is normal, normal diet.
The above-described embodiments merely illustrate the principles and effects of the present invention, not for the limitation present invention.It is any ripe Know the personage of this technology all can carry out modifications and changes under the spirit and scope without prejudice to the present invention to above-described embodiment.Cause This, those of ordinary skill in the art is complete without departing from disclosed spirit and institute under technological thought such as Into all equivalent modifications or change, should by the present invention claim be covered.

Claims (6)

  1. A kind of 1. method for detecting lactose and fructose metabolism related gene, it is characterised in that：Comprise the following steps that：
    (1), DNA is extracted with the Oral Mucosal Cells of tester；
    (2), enter performing PCR reaction by template of the DNA of Oral Mucosal Cells extraction, be respectively to draw with SEQ NO 1 and SEQ NO 2 Thing amplification MCM6 gene SNP rs4988235 sites, it is that primer expands MCM6 gene SNPs with SEQ NO 3 and SEQ NO 4 Rs182549 sites, it is that primer expands ALDOB gene SNP rs1800588 sites with SEQ NO 5 and SEQ NO 6, uses SEQ NO 7 and SEQ NO 8 is that primer expands ALDOB gene SNP rs4994 sites；
    (3), by above-mentioned 4 pairs of primers carry out regular-PCR amplification after, by pcr amplification product with 1% agarose gel electrophoresis；
    (4), by 1% agarose gel electrophoresis band day with Ago-Gel QIAquick Gel Extraction Kit reclaim purpose band；
    (5) sequencing reaction, is carried out；
    (6), sequencing reaction product is purified：
    Add 3ul EDTA and 18ul absolute ethyl alcohols in sequencing reaction product, 3700r/min, centrifuge 30min, be then inverted, 800r/ Min centrifuges 10s, then takes out, and adds the ethanol of 50ul 80%, 3700r/min, centrifuges 15min, be then inverted, 800r/min centrifugations 10s takes out；
    (7), it is denatured, upper 3730 sequencer：
    In sample after sequencing reaction product purification plus 10ul Hidi, upper PCR instrument denaturation, condition is 94 DEG C of denaturation 2min, 4 DEG C preserve 3min after upper 3730 sequencer；
    (8) 6 SNP genotype, are analyzed according to sequencing result.
    Preferably, in described step (1), DNA is extracted using buccal swab DNA extraction kit.
    Preferably, in described step (1), the DNA concentration of extraction is not less than 10ng/ul, 260/280=1.9 ± 2.
    Preferably, in described step (2), PCR reaction systems are 25uL, and it includes：
    Template：2uL、SEQ NO 1:1uL、SEQ NO 2：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、Hot start taq：0.3ul, deionized water：16.2uL；
    Template：2uL、SEQ NO 3:1uL、SEQ NO4：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、Hot start taq：0.3ul, deionized water：16.2uL；
    Template：2uL、SEQ NO 5:1uL、SEQ NO 6：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、Hot start taq：0.3ul, deionized water：16.2uL；
    Template：2uL、SEQ NO 7:1uL、SEQ NO 8：1uL、10×MSP buffer：2.5uL、20mM dNTP：2ul、Hot start taq：0.3ul, deionized water：16.2uL.
  2. A kind of 2. method for detecting lactose and fructose metabolism related gene according to claim 1, it is characterised in that：It is described The step of (2) in, for SNP rs4988235 sites, SNP rs182549 sites, SNP rs1800588 sites, SNP The primer sets in rs4994 sites are as follows：
    For MCM6 gene SNPs rs4988235 primer sets：
    SEQ NO 1：CAATGTACTAGTAGGCCTCTGC
    SEQ NO 2：CCACTGACCTATCCTCGTGG
    For MCM6 gene SNPs rs182549 primer sets：
    SEQ NO 3：TCTTGAGTAGCTGGGACCACA
    SEQ NO 4：CCTGGGAAGGGTGCTGTATAA
    For ALDOB gene SNPs rs1800588 primer sets：
    SEQ NO 5：GACTTGCAGGGCTTGATGG
    SEQ NO 6：GCTGACAGATGCTGGCGTA
    For ALDOB gene SNPs rs4994 primer sets：
    SEQ NO 7：GACCAAATCTTTCCCTACCACA
    SEQ NO 8：TTGCCGACCAGTGTCCATC.
  3. A kind of 3. method for detecting lactose and fructose metabolism related gene according to claim 1 or 2, it is characterised in that： In described step (2), PCR reaction conditions are：
    Enter circular response after 95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 40 are followed Ring, 72 DEG C extend 5min, 4 DEG C of preservations afterwards.
  4. A kind of 4. method for detecting lactose and fructose metabolism related gene according to claim 1, it is characterised in that：It is described The step of (5) in, sequencing reaction system is 5ul：Primer 1uL, glue reclaim product are template and water common 3ul, bigdye 1ul.
  5. 5. the method for a kind of the detection lactose and fructose metabolism related gene according to claim 1 or 4, it is characterised in that： In described step (5), sequencing reaction condition is as follows：95 DEG C of pre-degeneration 5min, subsequently enter circulation, 95 DEG C of denaturation 30s, 57 DEG C Anneal 30s, 72 DEG C of extension 45s, totally 35 circulations, afterwards, continues 72 DEG C of extension 5min, 4 DEG C of preservations.
  6. A kind of 6. method for detecting lactose and fructose metabolism related gene according to claim 1, it is characterised in that：It is described The step of (8) in, with 6 SNP genotype of Chromas software analysis.
CN201710802852.6A 2017-09-08 2017-09-08 A kind of method for detecting lactose and fructose metabolism related gene Pending CN107674911A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710802852.6A CN107674911A (en) 2017-09-08 2017-09-08 A kind of method for detecting lactose and fructose metabolism related gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710802852.6A CN107674911A (en) 2017-09-08 2017-09-08 A kind of method for detecting lactose and fructose metabolism related gene

Publications (1)

Publication Number Publication Date
CN107674911A true CN107674911A (en) 2018-02-09

Family

ID=61135175

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710802852.6A Pending CN107674911A (en) 2017-09-08 2017-09-08 A kind of method for detecting lactose and fructose metabolism related gene

Country Status (1)

Country Link
CN (1) CN107674911A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109880901A (en) * 2019-04-24 2019-06-14 杭州云鼎基因生物科技有限公司 The detection method in lactose metabolism associated gene mutation site
CN113436741A (en) * 2021-07-16 2021-09-24 四川大学华西医院 Lung cancer recurrence prediction method based on tissue specific enhancer region DNA methylation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105586395A (en) * 2014-11-17 2016-05-18 武汉白原科技有限公司 Detection kit and method for assessing response of human body to daily diet

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105586395A (en) * 2014-11-17 2016-05-18 武汉白原科技有限公司 Detection kit and method for assessing response of human body to daily diet

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DEISE C. FRIEDRICH ET AL.: "Several Different Lactase Persistence Associated Alleles and High Diversity of the Lactase Gene in the Admixed Brazilian Population", 《PLOS ONE》 *
SANTER R ET AL.: "The spectrum of aldolase B (ALDOB) mutations and the prevalence of hereditary fructose intolerance in Central Europe", 《HUMAN MUTATION》 *
VALADARES ER ET AL.: "Hereditary fructose intolerance in Brazilian patients", 《MOLECULAR GENETICS AND METABOLISM REPORTS》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109880901A (en) * 2019-04-24 2019-06-14 杭州云鼎基因生物科技有限公司 The detection method in lactose metabolism associated gene mutation site
CN113436741A (en) * 2021-07-16 2021-09-24 四川大学华西医院 Lung cancer recurrence prediction method based on tissue specific enhancer region DNA methylation

Similar Documents

Publication Publication Date Title
Baez-Duarte et al. Glutathione peroxidase 3 serum levels and GPX3 gene polymorphisms in subjects with metabolic syndrome
CN103911374B (en) The molecule marker relevant to Milk Fat Percentage in Dairy Cows proterties and application thereof
CN109825573A (en) A kind of multiple gene detection kit and its application method for antidepressant medication guide
CN113981066A (en) Mutant dilated cardiomyopathy pathogenic gene TTN and application thereof
CN107674911A (en) A kind of method for detecting lactose and fructose metabolism related gene
CN110257503A (en) Detect the primer sets and multi-PCR detection method of vitamin E metabolic gene TTPA
Kui et al. The relationship between polymorphisms at 17 gene sites and hypertension among the Aboriginal Tibetan people
CN108796042B (en) Nucleic acid composition for genetic anemia detection, detection kit and use method
CN106834287A (en) A kind of SNP marker for detecting RhD negative phenotypes
CN109576799A (en) The construction method and primer sets and kit of FH sequencing library
CN116334223B (en) Application of detection reagent of alternative splicing functional site rs61746794 in preparation of colorectal cancer auxiliary diagnosis kit
CN105018602B (en) Susceptibility gene of antipsychotic drug-related metabolic syndrome and application thereof
WO2013037154A1 (en) Diagnose kit useful for diagnosing p.v37i mutation of gjb2 gene related to tardive deafness
CN109971859A (en) A kind of detection primer and its application of abdominal aneurvsm associated SNP positions rs10757278
CN113549689B (en) Kit and method for detecting PROS1 gene exon
MXPA04004385A (en) Growth hormone variations in humans and their uses.
WO2013078690A1 (en) Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof
Alharbi et al. Lack of association between UBE2E2 gene polymorphism (rs7612463) and type 2 diabetes mellitus in a Saudi population
CN102839170B (en) Single nucleotide polymorphism of microRNA-431 genes associated with lactation yield of dairy goats and detection and application thereof
CN107974496A (en) A kind of detection method of obesity-related gene
Li et al. Contribution of mitochondrial gene variants in diabetes and diabetic kidney disease
CN107760780A (en) A kind of amplimer and application for detecting Iron in Children and absorbing gene pleiomorphism
CN112430655A (en) Detection primer and kit for detecting central precocity of children and application
CN110951858A (en) Primer-probe combination for guiding detection of genes related to glibenclamide drug personalized administration, kit and application
CN110484623A (en) A kind of RB1 mutated gene, primer, detection method, kit and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180209