CN110257503A - Detect the primer sets and multi-PCR detection method of vitamin E metabolic gene TTPA - Google Patents

Abstract

The present invention provides the primer sets and multi-PCR detection method of detection vitamin E metabolic gene TTPA, the primer sets include: at least two be respectively used in 5 primer pairs of detection vitamin E metabolic gene TTPA 1-5 exon, and the nucleotide sequence of the upstream and downstream primer of this 5 primer pairs is respectively as shown in SEQ ID NO.1-10.When carrying out multiplex PCR detection using the primer sets, the gene mutation of at least two exons can be detected simultaneously by primary first-order equation, so that detection flux improves.

Description

Detect the primer sets and multi-PCR detection method of vitamin E metabolic gene TTPA

Technical field

The present invention relates to technical field of biological, in particular to the primer sets of detection vitamin E metabolic gene TTPA and Multi-PCR detection method.

Background technique

Vitamin E can be divided into 8 kinds because of its structure difference: alpha-tocopherol, betatocopherol, Gamma-Tocopherol, Delta-Tocopherol, α- Tocotrienols, β-tocotrienols, γ-tocotrienols, δ-tocotrienols, wherein with physiological function predominantly Alpha-tocopherol.

Vitamin E is present in the membranous structure of cell and the fat drips and lipoprotein of fat cell, by blocking peroxidating The chain type oxidation reaction of unsaturated fatty acid in free radical and biomembrane reaches antioxidation.And vitamin E can assist Sulfydryl removes free radical, has research to think that vitamin E can also protect maincenter and surrounding by adjusting the neurotoxicity of glutamic acid Nerve.

The vitamin E transhipment of normal person is by being incorporated into chylomicron after small intestine absorbed into serum, and the latter is in lipoprotein lipase Catalysis under discharge sub-fraction tocopherol and fatty acid, after remainder obtains apo E by high-density lipoprotein (HDL) Enter liver cell through receptor-mediated, in conjunction with lysosome, lipoprotein carriers are hydrolyzed, and free tocopherol enters endochylema, is integrated to Blood is entered by row's grain process afterwards by the very low density lipoprotein (VLDL) of endoplasmic reticulum and golgiosome assembling processing and forms recycling. The normal level of plasma vitamin E is (8.7 ± 3.7) μ g/ml.

It is believed that the content of vitamin E can maintain human normal physiological activity, the amount stored in vivo enough in diet It makes one that vitamin e deficiency does not occur when being deficient in vitamin E intake for a period of time enough.Vitamin E is liposoluble vitamin, Therefore its shortage is found in various rouge malabsorption syndromes, such as lipoprotein deficiency,β and Cholestasis.

Incoordination is with vitamin e deficiency (Ataxia with vitamin E deficiency, AVED), also known as family The simple vitamin e deficiency of race's property.AVED is that the gene mutation of alpha-tocopherol transport protein (α-TTP) leads to the transhipment of α-TTP Dysfunction causes vitamin E concentration in blood and tissue to decline, to cause a series of damage of nervous systems and its hetero-organization Wound.The Clinical symptoms of AVED is incoordination, and tendon reflex weakens or disappears, and deep sensory obstacle, dysarthrosis and vitamin E lack It is weary.The clinical manifestation variation of AVED is very big, and clinical characters include: to fall ill for 2~52 years old, and most≤20 years old, no men and women is poor It is different.28% AVED case is slow with head and neck motion, and 13% case is with myodystony.Patient's AVED plasma vitamin E level is below 5 μ g/ml.

α-TTP encoding gene is the TTPA gene positioned at No. 8 chromosome.At present it has been reported that TTPA gene pathogenic mutation It is predominantly located at the 1-5 exon of TTPA gene, is corresponding with 25 kinds of Disease-causing gene mutation, specific mutational site can see below table 1。

Table 1

Number	Mutational site	Number	Mutational site
				1	c.-1C>T	14	c.421G>T/A
2	c.2T>C/G	15	c.486delT
				3	c.175C>T	16	c.513insTT
4	c.191A>G	17	c.530_532delinsGTAAGT
				5	c.205-1G>C	18	c.548T>C
6	c.219insAT	19	c.552G>A
				7	c.227_229delinsATT	20	c.561C>T
8	c.302_309delATGGAGTC	21	c.575G>A
				9	c.303T>G	22	c.661C>T
10	c.306A>G	23	c.733G>A
				11	c.358G>A	24	c.736G>C
12	c.358+1G>A	25	c.744delA
				13	c.400C>T

PCR (Polymerase Chain Reaction, polymerase chain reaction) has been widely used in medicine, heredity It learns, in microbiology or even entire life science.Currently, the 1-5 exon of above-mentioned TTPA gene can be directed to, separately design PCR detection test, to carry out the detection of gene mutation situation.Since each PCR reaction is just for an exon, therefore detect logical It measures lower.

Summary of the invention

The present invention provides the primer sets and multi-PCR detection method of detection vitamin E metabolic gene TTPA, are beneficial to examine Survey the raising of flux.

In order to achieve the above object, the present invention is achieved through the following technical solutions:

Multiplex PCR is a kind of novel amplification technique developed on the basis of Standard PCR, can be added in a reaction system Enter two pairs and two pairs or more of primer, while expanding multiple nucleic acid fragments.Multiplex PCR is in microorganism, hereditary disease, tumour medicine base Because group has important application.It, can be for the mutational site of the 1-5 exon of TTPA gene, to design based on this The upstream and downstream primer in specific amplification gene mutation site region.

Firstly, the present invention provides the primer sets of detection vitamin E metabolic gene TTPA, including in following 5 primer pairs At least two: for detecting the primer pair of the 1st exon of vitamin E metabolic gene TTPA, the nucleotides sequence of upstream primer Column are as shown in SEQ ID NO.1, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO.2；For detecting vitamin E metabolic The primer pair of the 2nd exon of gene TTPA, the nucleotide sequence of upstream primer as shown in SEQ ID NO.3, downstream primer Nucleotide sequence is as shown in SEQ ID NO.4；For detecting the primer pair of the 3rd exon of vitamin E metabolic gene TTPA, on The nucleotide sequence of primer is swum as shown in SEQ ID NO.5, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.6；With In the primer pair of detection the 4th exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ ID Shown in NO.7, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.8；For detecting vitamin E metabolic gene TTPA the 5th The primer pair of exon, the nucleotide sequence of upstream primer as shown in SEQ ID NO.9, the nucleotide sequence of downstream primer by Shown in SEQ ID NO.10.

Preferably, primer sets include 5 primer pairs, detect flux with the raising of relative maximum degree.Specifically, this is used When primer sets carry out multiplexed PCR amplification reaction, five exons of TTPA gene are expanded in an amplification system simultaneously, 5 exons comprising 25 pathogenic sites in TTPA gene are expanded simultaneously.

Under normal conditions, TTPA gene is expanded using upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2 1 exon when, the fragment length of corresponding amplified production is 398bp；Drawn using upstream primer SEQ ID NO.3 and downstream When 2 exon of the object SEQ ID NO.4 to expand TTPA gene, the fragment length of corresponding amplified production is 311bp；It utilizes It is corresponding to expand when 3 exon to expand TTPA gene of upstream primer SEQ ID NO.5 and downstream primer SEQ ID NO.6 The fragment length for increasing production object is 516bp；It is expanded using upstream primer SEQ ID NO.7 and downstream primer SEQ ID NO.8 When 4 exon of TTPA gene, the fragment length of corresponding amplified production is 803bp；Utilize upstream primer SEQ ID NO.9 When 5 exon with downstream primer SEQ ID NO.10 to expand TTPA gene, the fragment length of corresponding amplified production is 204bp。

In this way, can produce the DNA fragmentation of different length, after carrying out multiplexed PCR amplification using above-mentioned primer sets in order to rear It is continuous can electrophoresis differentiate the segment of different length.And then gel extraction can be carried out to the DNA of different fragments, and carry out the survey of sequence It is fixed.

Based on above content, the present invention also provides a kind of the multiple outer aobvious of synchronous detection vitamin E metabolic gene TTPA The multi-PCR detection method of son, comprising: design above-mentioned primer sets；Genomic DNA is extracted from sample to be tested, as amplification mould Plate；Multi-PRC reaction system of the configuration comprising the primer sets and the amplification template；To the multi-PRC reaction system into The reaction of row multiplexed PCR amplification, obtains PCR product；According to the PCR product, the TTPA gene extron of the sample to be tested is measured The gene mutation situation of son.Certainly, this method is the method for non-diagnostic purpose.

In an embodiment of the invention, described according to the PCR product, it measures outside the TTPA gene of the sample to be tested Show the gene mutation situation of son, comprising: PCR product described in electrophoresis detection, to verify the amplified fragments size of the PCR product； Sequencing is carried out to the PCR product after verifying is correct, to obtain the gene of the TTPA gene extron of the sample to be tested Catastrophe.In detail, the segment of different length can be differentiated with agarose gel electrophoresis or polyacrylamide gel electrophoresis.

In an embodiment of the invention, the above-mentioned primer sets of design, comprising: above-mentioned design includes 5 primer pairs Primer sets.In this way, can relative maximum degree raising detect flux.

In an embodiment of the invention, the multi-PRC reaction system further include: archaeal dna polymerase, PCR buffer, 4 The mixture and ultrapure water of kind dNTP (deoxy-ribonucleoside triphosphate, deoxyribonucleoside triphosphate)； Wherein, the dosage of archaeal dna polymerase is 0.5-5U, and the final concentration of every kind of dNTP is 50-500 μM, every primer in 5 primer pairs Final concentration be 20-300nM.

Archaeal dna polymerase can select the archaeal dna polymerases such as Taq, KOD FX, in this way, PCR buffer is and selected DNA The corresponding concentrating buffer solution of polymerase, specific concentrating degree can be selected 2 ×, 5 × or 10 ×.

For example, the dosage of archaeal dna polymerase can for 0.5U, 1U, 1.5U, 2U, 2.5U, 3U, 3.5U, 4U, 4.5U or 5U；The final concentration of every kind of dNTP all can be 50 μM, 100 μM, 150 μM, 200 μM, 250 μM, 300 μM, 350 μM, 400 μM, 450 μM or 500 μM；In 5 primer pairs the final concentration of every primer all can be 20nM, 30nM, 40nM, 50nM, 100nM, 150nM, 200nM, 250nM, 280nM or 300nM.

For example, select this archaeal dna polymerase of KOD FX, and select 2 × concentrating buffer solution when, for configure it is above-mentioned more Weight PCR reaction system, the dosage of each component can be in system are as follows: 0.5~2 μ l of archaeal dna polymerase, 18~30 μ l of PCR buffer, Mixture 2-10 μ l, 5 DNA~1000ng and the appropriate ultrapure water of 1~10 μ l of mixture of various dNTP, 5 primer pairs, With moisturizing to 50 μ l.It and can be other volume sizes configured according to same ratio.

In an embodiment of the invention, the reaction condition of the multiplexed PCR amplification reaction are as follows: 94 DEG C of 1~10min；98 DEG C 5~30s, 50~66 DEG C of 10~120s, 68~72 DEG C of 5~120s, totally 25~45 circulations；68~72 DEG C of 0~30min.

For example, for this value range of 1~10min, specific value can be 1,3,6,9 or 10；For 5~ This value range of 30s, specific value can be 5,10,15,20,25 or 30；For 50~66 DEG C of this value ranges, specifically Value can be 50,53,56,59,62 or 66；For this value range of 10~120s, specific value can for 10,20,40, 80,110 or 120；For 68~72 DEG C of this value ranges, specific value can be 68,69,70,71 or 72；For 5~ This value range of 120s, specific value can be 5,10,20,40,70,100,110 or 120；For 25~45 this take It is worth range, specific value can be 25,30,35,40 or 45；For this value range of 0~30min, specific value can be 0,5,10,15,20,25 or 30.

In an embodiment of the invention, described that genomic DNA is extracted from sample to be tested, comprising: to select manual extraction Or kit extracting method, processing is extracted to sample to be tested and obtains human genome DNA；The sample to be tested is containing someone Blood, cell, tissue or the buccal swab sample of the mankind of type genomic dna.

In addition, the primer pair is above-mentioned 5 the present invention also provides the primer pair of detection vitamin E metabolic gene TTPA Any one in a primer pair.

In addition, the present invention also provides above-mentioned primer sets or any of the above-described primer pair in preparation for detecting vitamin E generation The reagent for thanking to gene TTPA or the application in kit.

It is examined in addition, the present invention also provides above-mentioned primer sets or any of the above-described primer pair in vitamin E metabolic gene TTPA Application in survey.

Compared with the existing technology, the present invention at least can have following the utility model has the advantages that (1) improves detection flux: regular-PCR Each reaction is just for an exon, and multiplex PCR can detect 5 exons simultaneously, can be to 5 by primary first-order equation The gene mutation of exon is detected.In this way, 90 many cases samples can be detected simultaneously, detection efficiency is not only increased, also very Big degree has saved cost.(2) reduce cost: the present invention can be by PCR reaction system by 5 system/program shrinks To 1 system/program, therefore reduce the usage amount of the reagents such as archaeal dna polymerase, dNTP and consumptive material, can be greatly lowered detection at This.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is the present invention Some embodiments for those of ordinary skill in the art without creative efforts, can also basis These attached drawings obtain other attached drawings.

Fig. 1 is the agarose gel electrophoresis testing result that one embodiment of the invention provides；

Fig. 2 is the part that a mutational site is directed in the PCR product sequencing results of one embodiment of the invention offer；

Fig. 3 is the part that another mutational site is directed in the PCR product sequencing results of one embodiment of the invention offer；

Fig. 4 is the part that another mutational site is directed in the PCR product sequencing results of one embodiment of the invention offer.

Specific embodiment

No special explanation, reagent used by the present invention is implemented are commercial goods, data used by the present invention is implemented Library is disclosed online database.Following embodiment is exemplary, and for explaining only the invention, and should not be understood as to this The limitation of invention.

Embodiment 1

Design and synthesize primer sets, comprising the following steps:

Step 1.1: specific amplification gene is designed in 25 mutational sites of the 1-5 exon based on TTPA gene The upstream and downstream primer in mutational site region.

For design primer, primer is designed using Primer Quest and Primer Premier 5.0 and dimerization Body, stem ring mispairing analysis, in the both ends design primer comprising the site SNP (Single Nucleotide Polymorphism), 5 The annealing temperature of primer is consistent substantially.

Primer sets provided by the present embodiment cover TTPA gene 1-5 exon and pathogenic sites therein.By It will lead to the significant decrease of primer amplification efficiency, specificity variation in small sequence variation, therefore be directed to different loci/exon respectively Multiple PCR primer group is separately designed, and after preliminary experiment screens, condensation products fragment length and site/exon include Situation has chosen the optimal primer sets of expanding effect as described in Table 2.Exon, i.e. exon.

Table 2

Sequence number	Primer	5’-3’
			1	Exon1F	cacgcacgcttacccgcca
2	Exon1R	gtttcctttaagaggcagctctgct
			3	Exon2F	gatggatggcaaagtttatacacaatgc
4	Exon2R	aacacaactgaactggaggagagga
			5	Exon3F	cacttcctcttagcattgttgaattctacac
6	Exon3R	aggcacatgttcttggacgccagt
			7	Exon4F	ccgagaaacttgacattaggtatcagattg
8	Exon4R	catctactgtagttcacacctcttctc
			9	Exon5F	aggaagccattcacatgacataacttctc
10	Exon5R	cagattcacatgcatgggaacaactac

Step 1.2: designed primer sets in synthesis 1.1.

Embodiment 2

Genomic DNA is extracted from sample to be tested, is included the following steps:

Step 2.1: collecting mouth desquamated cells or fresh peripheral blood sample with buccal swab.

In the present embodiment, samples sources are normal human, i.e. non-A/V patient ED.

Step 2.2: use Tiangeng buccal swab genome DNA extracting reagent kit (DP322), or, using blood/cell/ Tissue gene group DNA extraction kit (DP304) extracts genomic DNA from sample, and using NP80-touch (Germany IMPLEN the concentration and purity for) measuring DNA, save genomic DNA.

Embodiment 3

The multi-PCR detection method of 5 exons of synchronous detection vitamin E metabolic gene TTPA, comprising the following steps:

Step 3.1: being amplification template with genomic DNA obtained in step 2.2, and drawn using what is synthesized in step 1.2 Object group, to configure multi-PRC reaction system.

The present embodiment spins archaeal dna polymerase in (TOYOBO) company KOD FX enzyme system (article No.: KFX-101) using Japan and delays Fliud flushing is base stock, in enzyme system specification on the basis of amplification system, by adjusting primer concentration, dNTP concentration, buffering Liquid concentration, enzyme dosage, to prepare multiplexed PCR amplification system, the concrete composition of this reaction system is as described in Table 3.Certainly, Reaction system equal proportion amplification/diminution is in the protection scope of the embodiment of the present invention；Other archaeal dna polymerase systems are replaced, are passed through Proper proportion adjustment also can achieve amplification purpose.

Table 3

Agent formulations	Volume
		2×PCR buffer for FX	25μl
2mM dNTP	5μl
		Primer Mix (every kind of 1 μM of primer)	5μl
KOD FX(1U/μl)	1μl
		DNA	1μl
Water	13μl

Each primer equimolar mixing, total primer concentration is 10 micromoles；DNA profiling amount is adjustable, gene in the present embodiment 20ng can be used in group DNA.

Step 3.2: according to multi-PRC reaction condition shown in following table 4, the program of PCR instrument is set.

Table 4

Step 3.3: the PCR instrument set using program carries out more the multi-PRC reaction system configured in step 3.1 Weight pcr amplification reaction, obtains PCR product.

Embodiment 4

Electrophoresis detection, comprising the following steps:

Step 4.1: PCR product obtained in agarose gel electrophoresis detecting step 3.3, to verify PCR product segment Size.

Testing result as shown in Figure 1, ZHF, DJL, SLP shown in Fig. 1 etc. be mainly used for distinguishing it is different to test sample This, the leftmost column of Fig. 1 illustrates scale item, and rightmost side column illustrate the electrophoresis result of the PCR product of blank control group, intermediate Each column illustrate the electrophoresis result of the PCR product of different samples.

According to the comparison of each product bright band position and left side scale item, it can identify that each product bright band institute is right What is answered is the amplified production of which exon.For example, 5 bright bands from up to down, are usually to correspond respectively to the 4th, 3,1,2,5 The pcr amplification product of exon.

Referring to FIG. 1, according to the electrophoresis result of blank group it is found that environmental factor to the electrophoresis detection result of sample to be tested without Adverse effect.According to the electrophoresis result of each sample to be tested it is found that existing 5 bright bands correspond respectively to 5 of TTPA gene The pcr amplification product of exon, bright band quantity are consistent with theory；5 bright bands are clear and interval is obvious, nothing between different bright bands It is overlapped, without smear etc., bright band works well.So, it may be said that bright to carry out PCR amplification using the primer sets designed in step 1.1 When, the set goal product is only generated, and other unrelated products are not generated, primer sets design is reasonable.

Step 4.2: after the size of verifying PCR product segment is correct, sequencing can be carried out for PCR product.

Embodiment 5

Sequencing, comprising the following steps:

Step 5.1: after the size of verifying PCR product segment is correct in step 4.2, by PCR product obtained in step 3.3 It send to sequencing company (Sinogenomax Co., Ltd.) and carries out sequencing, obtain the sequencing knot of .ab1 format Fruit.

Step 5.2: by sequencing result obtained in Chromas sequence analysis software analytical procedure 5.1, obtaining TTPA base Because of the gene mutation situation in 1-5 exon.

Part sequencing result is as in Figure 2-4.

Referring to FIG. 2, Fig. 2 shows at gene mutation site c.219insAT (number 6 in table 1) and its upstream and downstream Nucleotide base sequence.Please refer to the wire part in Fig. 2, it is known that be not inserted into base T and base A at the 219th, that is, exist Gene mutation does not occur at the gene mutation site.This gene mutation situation and samples sources are this premise of normal human guarantor It holds consistent.

Referring to FIG. 3, Fig. 3 show gene mutation site c.400C > T (number 13 in table 1) at and its upstream and downstream Nucleotide base sequence.Please refer to the wire part in Fig. 3, it is known that the base at the 400th is C, rather than T, i.e., in the base Because gene mutation does not occur at mutational site.This gene mutation situation and samples sources are that this premise of normal human keeps one It causes.

Referring to FIG. 4, Fig. 4 show gene mutation site c.575G > A (number 21 in table 1) at and its upstream and downstream Nucleotide base sequence.Please refer to the wire part in Fig. 4, it is known that the base at the 575th is G, rather than A, i.e., at this Gene mutation does not occur at gene mutation site.This gene mutation situation and samples sources are the holding of this premise of normal human Unanimously.

It should be noted that, in this document, the terms "include", "comprise" or its any other variant are intended to non-row His property includes, so that the process, method, article or equipment for including a series of elements not only includes those elements, and And further include other elements that are not explicitly listed, or further include for this process, method, article or equipment institute it is intrinsic Element.In the absence of more restrictions, the element limited by sentence " including one ", it is not excluded that There is also other identical factors in the process, method, article or apparatus that includes the element.

Finally, it should be noted that the foregoing is merely presently preferred embodiments of the present invention, it is merely to illustrate skill of the invention Art scheme, is not intended to limit the scope of the present invention.Any modification for being made all within the spirits and principles of the present invention, Equivalent replacement, improvement etc., are included within the scope of protection of the present invention.

SEQUENCE LISTING

<110>Beijing and conjunction medical diagnostic techniqu limited liability company

<120>primer sets and multi-PCR detection method of vitamin E metabolic gene TTPA are detected

<130> 2019.6.5

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the upstream primer of the 1st exon of vitamin E metabolic gene TTPA

<400> 1

cacgcacgct tacccgcca 19

<210> 2

<211> 25

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the downstream primer of the 1st exon of vitamin E metabolic gene TTPA

<400> 2

gtttccttta agaggcagct ctgct 25

<210> 3

<211> 28

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the upstream primer of the 2nd exon of vitamin E metabolic gene TTPA

<400> 3

gatggatggc aaagtttata cacaatgc 28

<210> 4

<211> 25

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the downstream primer of the 2nd exon of vitamin E metabolic gene TTPA

<400> 4

aacacaactg aactggagga gagga 25

<210> 5

<211> 31

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the upstream primer of the 3rd exon of vitamin E metabolic gene TTPA

<400> 5

cacttcctct tagcattgtt gaattctaca c 31

<210> 6

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the downstream primer of the 3rd exon of vitamin E metabolic gene TTPA

<400> 6

aggcacatgt tcttggacgc cagt 24

<210> 7

<211> 30

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the upstream primer of the 4th exon of vitamin E metabolic gene TTPA

<400> 7

ccgagaaact tgacattagg tatcagattg 30

<210> 8

<211> 27

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the downstream primer of the 4th exon of vitamin E metabolic gene TTPA

<400> 8

catctactgt agttcacacc tcttctc 27

<210> 9

<211> 29

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the upstream primer of the 5th exon of vitamin E metabolic gene TTPA

<400> 9

aggaagccat tcacatgaca taacttctc 29

<210> 10

<211> 27

<212> DNA

<213>artificial sequence (Artificial sequence)

<220>

<223>for detecting the downstream primer of the 5th exon of vitamin E metabolic gene TTPA

<400> 10

cagattcaca tgcatgggaa caactac 27

Claims (10)

1. detecting the primer sets of vitamin E metabolic gene TTPA, which is characterized in that including at least two in following 5 primer pairs It is a:

For detecting the primer pair of the 1st exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ Shown in ID NO.1, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.2；

For detecting the primer pair of the 2nd exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ Shown in ID NO.3, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.4；

For detecting the primer pair of the 3rd exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ Shown in ID NO.5, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.6；

For detecting the primer pair of the 4th exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ Shown in ID NO.7, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.8；

For detecting the primer pair of the 5th exon of vitamin E metabolic gene TTPA, the nucleotide sequence of upstream primer is by SEQ Shown in ID NO.9, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.10.

2. a kind of multi-PCR detection method of multiple exons of synchronous detection vitamin E metabolic gene TTPA, feature exist In, comprising:

Design primer sets as described in claim 1；

Genomic DNA is extracted from sample to be tested, as amplification template；

Multi-PRC reaction system of the configuration comprising the primer sets and the amplification template；

Multiplexed PCR amplification reaction is carried out to the multi-PRC reaction system, obtains PCR product；

According to the PCR product, the gene mutation situation of the TTPA gene extron of the sample to be tested is measured.

3. according to the method described in claim 2, it is characterized in that,

It is described according to the PCR product, measure the gene mutation situation of the TTPA gene extron of the sample to be tested, comprising:

PCR product described in electrophoresis detection, to verify the amplified fragments size of the PCR product；

After verifying is correct sequencing is carried out to the PCR product, to obtain the TTPA gene extron of the sample to be tested Gene mutation situation.

4. according to the method described in claim 2, it is characterized in that,

The design primer sets as described in claim 1, comprising: design includes 5 primer pairs as described in claim 1 Primer sets.

5. according to the method described in claim 4, it is characterized in that,

The multi-PRC reaction system further include: archaeal dna polymerase, PCR buffer, 4 kinds of dNTP mixture and ultrapure water；

Wherein, the dosage of archaeal dna polymerase is 0.5-5U, and the final concentration of every kind of dNTP is 50-500 μM, every in 5 primer pairs The final concentration of primer is 20-300nM.

6. according to the method described in claim 4, it is characterized in that,

The reaction condition of the multiplexed PCR amplification reaction are as follows: 94 DEG C of 1~10min；98 DEG C of 5~30s, 50~66 DEG C of 10~120s, 68~72 DEG C of 5~120s, totally 25~45 recycle；68~72 DEG C of 0~30min.

7. according to the method any in claim 2 to 6, which is characterized in that

It is described that genomic DNA is extracted from sample to be tested, comprising: to select manual extraction or kit extracting method, treat test sample Originally it extracts processing and obtains human genome DNA；

The sample to be tested is blood, cell, tissue or the buccal swab sample of the mankind containing human genome DNA.

8. detecting the primer pair of vitamin E metabolic gene TTPA, which is characterized in that the primer pair is described in claim 1 5 primer pairs in any one.

9. primer sets described in claim 1 or primer pair according to any one of claims 8 are in preparation for detecting vitamin E metabolic base Because of the application in the reagent or kit of TTPA.

10. primer sets described in claim 1 or primer pair according to any one of claims 8 are detected in vitamin E metabolic gene TTPA In application.