CN109956987A - Ammonolysis method and ammonolysis composition - Google Patents
Ammonolysis method and ammonolysis composition Download PDFInfo
- Publication number
- CN109956987A CN109956987A CN201711342322.4A CN201711342322A CN109956987A CN 109956987 A CN109956987 A CN 109956987A CN 201711342322 A CN201711342322 A CN 201711342322A CN 109956987 A CN109956987 A CN 109956987A
- Authority
- CN
- China
- Prior art keywords
- ammonolysis
- alcohol
- synthesis column
- solid phase
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This application provides it is a kind of for after DNA synthesis in solid state carry out ammonolysis method, comprising the following steps: 1) to include in the synthesis column for the solid phase carrier of synthetic DNA segment be added ammonolysis composition；2) the synthesis column is placed in the resealable container equipped with ammonolysis buffer, and keeps the ullage for synthesizing column and being located at the ammonolysis buffer；And 3) with resealable container described in microwave treatment, so that the solid phase carrier is in the steam atmosphere of the ammonolysis buffer；4) the synthesis column is taken out, the solid phase carrier is handled with eluent and collects efflux.The present invention also provides the ammonolysis compositions for ammonolysis.Ammonolysis method provided by the invention only needs to can avoid cross contamination using less amount of ammonolysis reagent, shortens reaction time, solvent cleaning easy to clean, and be not necessarily to high-tension apparatus, is conducive to industrialize and automate to use.
Description
Technical field
The present invention relates to bioengineering fields, ammonolysis method especially relevant to DNA synthesis in solid state.The invention further relates to
Ammonolysis composition for ammonolysis.
Background technique
DNA synthesis (especially DNA primer synthesis) is to be mostly based on solid phase synthesis technique, passes through deprotection, condensation, oxygen
Phosphoramidite monomer is connected to control aperture glass by the sequence at 3 ' ends to 5 ' ends by the circulation of change and four steps of nut cap one by one
The surface glass ball (CPG).5 ' terminal hydroxy groups of each phosphoramidite monomer are by dimethoxytrityl (DMT) radical protection, base
On active amino respectively by radical protections such as acetyl group (Ac), benzoyl (Bz), phenodiazine methylrnethwirnidamide bases (dmf).Wherein
DMT group is that acid is unstable, can be removed in the solution such as the methylene chloride of 3% trichloroacetic acid, the groups such as Ac, Bz, dmf are
The unstable group of alkali can be removed in the solution such as saturation ammonium hydroxide.
The specific steps of synthesis are as follows:
A) the DMT group on the surface CPG is cut off using solution of trichloroacetic acid, exposes free hydroxyl；
B) using tetrazole as activator, the phosphorous acyl for 3 ' the end phosphate groups and the surface CPG for activating phosphoramidite monomer
5 ' terminal hydroxy groups of amine monomers are condensed, and form phosphodiester bond；
C) it uses iodine solution as oxidant, three valent phosphors unstable in primer skeleton is oxidized to stable pentavalent phosphorus；
D) it uses acetic anhydride and N-methyl imidazoles as nut cap reagent, the free hydroxyl second of reaction will be had neither part nor lot in step b)
It is acylated；
E) it repeats above a) to d) step until sequent synthesis terminates, and sloughs the last one DMT group.
After to be synthesized, CPG powder is immersed in saturation ammonia spirit and is placed on 55 DEG C of progress ammonolysis reactions.It should
Process mainly includes three-step reaction: i) cutting off primer from CPG；Ii) the amido protecting group in each base is cut off；iii)
By the phosphate group excision at 3 ' ends.It, can be different types of by selecting if 3 ' ends need to carry out phosphorylation modification in synthesis
CPG and to iii) step carries out selective omission.
When carrying out ammonolysis using saturation ammonium hydroxide, it usually needs react 16 hours at 55 DEG C, or reacted 8 hours at 65 DEG C.Make
Use the 1:1 mixed liquor (AMA) of saturation ammonium hydroxide and methylamine water solution the reaction time can be foreshortened to 15 as ammonolysis reagent
Minute or so.But cross contamination is easily caused since CPG powder need to be immersed in ammonolysis solution by above-mentioned ammonolysis mode, and
It needs to spend 2 hours or so after ammonolysis and drains solution, therefore there are certain difficulties in the application of the large-scale industrial production of primer.
The ammonolysis reaction time can be reduced to 1 hour or so by existing microwave ammonolysis mode.The microwave ammonolysis mode need by
CPG powder is soaked in the water and methyl alcohol mixed liquor of sodium hydroxide, is reacted under microwave condition.Since temperature raises may
Lead to solution bumping, therefore need that just reaction tube taking-up was placed in ice water every 6-10 second and cool down 1-2 seconds, to after reaction again
Solution is drained to obtain final product.This method has the disadvantage in that I) ammonolysis reagent is readily volatilized in the process and causes
Repeatability is poor；II it) cools down repeatedly, operation is excessively cumbersome, integrally takes a long time；III) primer can not carry out after reaction
Cleaning, and drain water and methyl alcohol mixed liquor takes a long time；IV) when 96 orifice plates of use or 384 orifice plates carry out extensive primer synthesis
When, compatibility is poor, is easy to produce cross contamination.
Even if two generation primers synthesis column use frit (i.e. CPG Frits) made of CPG and matrix instead of CPG powder as
Solid phase carrier improves primer synthesis quality by promoting the reagent permeability in synthesis process, but in such synthesis column
Solid phase carrier in ammonolysis it is more difficult taking-up and be immersed in ammonolysis reagent, also reduce the commercial viability of microwave ammonolysis.
The possibility of cross contamination can be significantly reduced using the mode of gas phase ammonolysis.Primer need to be synthesized column and put by the ammonolysis mode
It sets in high-pressure bottle, using gas ammonia is ammonolysis reagent, is reacted 30 minutes or so at high pressure (about 140psi).Although should
It is relatively simple that method post-processes link, but the ammonolysis mode is higher for the demand of equipment.
Summary of the invention
To solve the above-mentioned problems, on the one hand, the present invention provides one kind for carrying out ammonolysis after DNA synthesis in solid state
Method comprising following steps:
1) to include in the synthesis column for the solid phase carrier of synthetic DNA segment be added ammonolysis composition；
2) the synthesis column is placed in the resealable container equipped with ammonolysis buffer, and the synthesis column is kept to be located at institute
State the ullage of ammonolysis buffer；And
3) with resealable container described in microwave treatment, so that the solid phase carrier is in the steam gas of the ammonolysis buffer
In atmosphere；
4) the synthesis column is taken out, the solid phase carrier is handled with eluent and collects efflux.
In one embodiment, the solid phase carrier is CPG powder or CPG Frits.
In one embodiment, the quantity of the synthesis column is one.In another embodiment, the synthesis column
Quantity be more than one.
In one embodiment, it may be provided with the support that can be used for clamping the synthesis column in the resealable container
Object.
In another embodiment, the synthesis column is located on synthesis column holder.It correspondingly, can be in the resealable container
Interior setting is for holding the support of the synthesis column holder.In preferred embodiments, the synthesis column holder is 96 holes
Board mount or 384 hole board mounts.
In one embodiment, by volume, the dosage of ammonolysis composition described in step 1) is the solid phase carrier
0.3 to 5 times of volume.
In one embodiment, step 1) further includes allowing the ammonolysis composition of addition in institute by being centrifuged or pressurizeing
Flowing in synthesis column is stated, to be dispersed throughout in the solid phase carrier of the synthesis column.
It in a preferred embodiment, further include to the synthesis after above-mentioned centrifugation or pressurized treatments in step 1)
Add the ammonolysis composition in column and stand 1 minute or more.Preferably, the amount for the ammonolysis composition added is solid phase carrier body
Long-pending 0.3 to 5 times.
It in one embodiment, further include that the synthesis column is allowed to keep being inverted in the resealable container in step 2)
State.
In a specific embodiment, microwave treatment described in step 3) includes with 700W microwave treatment 5 to 20 minutes.
It in one embodiment, further include by being centrifuged and/or drying before eluent processing in step 4)
And/or microwave heating removes remaining small water droplet on the synthesis column.In preferred embodiments, be centrifuged off it is described small
The synthesis column is allowed to be centrifuged when water droplet with inversion state.
In one embodiment, in step 4) the eluent processing before further include cleaned with cleaning reagent described in
Synthesize column one or more times.Preferably, the cleaning reagent is methanol aqueous solution or acetonitrile.Preferably, the methanol is water-soluble
Liquid is 85% (v/v) methanol aqueous solution.
In one embodiment, the eluent is water, preferably sterile water.
In one embodiment, the ammonolysis composition is diethylenetriamines, the 1M alkali of 1:2-20:5-40 volume ratio
The mixed solution of property aqueous solution and alcohol.Preferably, the alkaline aqueous solution is selected from lithium hydroxide, sodium hydroxide, potassium hydroxide, hydrogen
Beryllium oxide, magnesium hydroxide, calcium hydroxide solution and combinations thereof.In one embodiment, the ammonolysis buffer is 1:5-80
The mixed solution of the alcohol and water of volume ratio.Preferably, the alcohol is selected from methanol, ethyl alcohol, propyl alcohol, isopropanol, n-butanol, isobutyl
Alcohol, sec-butyl alcohol, tert-butyl alcohol and combinations thereof.
In one embodiment, the DNA fragmentation length is 10-200 base.
In one embodiment, the DNA fragmentation length is 10-100 base.
In one embodiment, the DNA fragmentation length is 10-60 base.
In one embodiment, the DNA fragmentation is primer.
On the other hand, the present invention also provides ammonolysis compositions comprising the diethylidene three of 1:2-20:5-40 volume ratio
Amine, 1M alkaline aqueous solution and alcohol.Preferably, the alkaline aqueous solution is selected from lithium hydroxide, sodium hydroxide, potassium hydroxide, hydrogen-oxygen
Change beryllium, magnesium hydroxide, calcium hydroxide solution and combinations thereof.Preferably, the alcohol is selected from methanol, ethyl alcohol, propyl alcohol, isopropanol, just
Butanol, isobutanol, sec-butyl alcohol, tert-butyl alcohol and combinations thereof.
On the other hand, the purposes the present invention also provides the ammonolysis composition in ammonolysis reaction, including allow the ammonia
Solution composition is contacted with the solid phase carrier for completing DNA fragmentation synthesis.
Compared with existing ammonolysis mode, ammonolysis method provided by the invention is only needed using less amount of ammonolysis reagent, can
Avoid pollution of reporting to the leadship after accomplishing a task, shorten the reaction time, solvent cleaning easy to clean, and be not necessarily to high-tension apparatus, be conducive to industrialization and
Automation uses.
Detailed description of the invention
Fig. 1 shows the ultraviolet spectra of the different length primer handled through ammonolysis method of the present invention.
Fig. 2 shows the high-efficient liquid phase chromatogram of the different length primer handled through ammonolysis method of the present invention.
Fig. 3 shows the mass spectrogram of 25 base primers handled through ammonolysis method of the present invention.
Fig. 4 shows the mass spectrogram of 60 base primers handled through ammonolysis method of the present invention.
Fig. 5 shows the mass spectrogram of 100 base primers handled through ammonolysis method of the present invention.
Fig. 6 shows the ultraviolet spectra of the different length primer handled through traditional ammonolysis method.
Fig. 7 shows the high-efficient liquid phase chromatogram of the different length primer handled through traditional ammonolysis method.
Specific embodiment
Unless otherwise indicated, the technical and scientific term used in the present invention has ordinary skill people of the art
The meaning that member is generally understood.
The term as used herein " DNA synthesis in solid state " refers to a kind of common method of synthetic DNA chain in the art, comprising:
The terminal nucleotide (for example, 3 ' terminal nucleotides) for the DNA chain to be synthesized is fixed on a kind of insoluble solid phase carrier in advance
On, then since this end by other nucleotide spreading one by one in a predetermined order, until synthesizing entire DNA chain.Every spreading one
The identical operation (see background technology part) of one wheel of nucleotide residue experience, and the DNA chain in extension is kept to be fixed on always
On solid phase carrier.Excessive unreacted reactant or byproduct of reaction can be removed by the method for filtering or washing.It is blended into required length
DNA chain after degree can cut down from solid phase carrier and slough various protecting groups, then purified final product can be obtained.With
The DNA chain that this mode synthesizes is usually tens bases, or up to several hundred a bases, they can be used for example as PCR and draw
Object, connector or probe etc..
The term as used herein " synthesis column " generally includes solid phase carrier, sieve plate and void column pipe three parts.Void column pipe is usual
It is molded for polypropylene, suitable for reading bigger than lower mouth, solid phase carrier and sieve plate are loaded on wherein.Common solid phase carrier is powdered
Control aperture glass marble (Controlled Pore Glass, CPG).CPG ball interior has many irregular ducts, stream
Dynamic phase can flow wherein.Sieve plate usually uses UHMW-PE or HDPE is powder sintered to form.UHMW-PE powder is in certain temperature
It is in slush state down, puts up a bridge between particle and forms certain aperture.In DNA synthesis, the effect of sieve plate is to stop CPG not
Leak down and comes and synthetic agent can pass through.More often used at present is " second generation synthesis column ", and such synthesis column is by CPG Frits
(filter core of the aperture glass marble containing control) and void column pipe are constituted.CPG Frits is powder sintered by CPG and UHMW-PE or HDPE
At.UHMW-PE particle wraps up and fixes CPG particle, puts up a bridge between UHMW-PE particle and forms certain aperture.Mobile phase can be
It is flowed in hole between hole inside CPG and UHMW-PE particle, completes various chemical reactions (referring to Publication No.
The Chinese patent of CN204151332U).
When referring to synthesis column, the term " inversions " that uses or " inversion state " refer to herein, relative to synthesize column it is suitable for reading
Upper and lower common state of the mouth under, will synthesis column with it is suitable for reading under, lower mouth be placed on bracket or support in upper mode
On.
Terms used herein " ammonolysis (Ammonolysis) " or " ammonolysis reaction " refer to, in the last rank of DNA synthesis in solid state
Section is cut the DNA chain of synthesis by ammonia spirit (or other alkaline solutions) from solid phase carrier, by the amino in base
Chemical process blocking group excision and/or cut off the phosphate group of 3 ' ends.
Terms used herein " ammonolysis composition " refer to the composition for carrying out above-mentioned ammonolysis process, are referred to as ammonia
Solve reagent.In some embodiments of the present invention, which is the diethylidene three of 1:2-20:5-40 volume ratio
The mixed solution of amine, 1M alkaline aqueous solution and alcohol.The alkaline aqueous solution is, for example, lithium hydroxide, sodium hydroxide, potassium hydroxide, hydrogen
Beryllium oxide, magnesium hydroxide, calcium hydroxide solution etc..Alcohol used is generally lower alcohol, for example, methanol, ethyl alcohol, propyl alcohol, isopropyl
Alcohol, n-butanol, isobutanol, sec-butyl alcohol, tert-butyl alcohol etc..
Terms used herein " resealable container " refer in the container for wherein carrying out ammonolysis reaction, which can example
Such as it is sealed by covering.The resealable container is that microwave is transparent, such as is made of glass, ceramics, plastics etc..?
When carrying out ammonolysis reaction, it is previously added wherein ammonolysis buffer and generates steam under microwave treatment.Steam is upper by synthesis column
Mouthful and lower mouth and enter in the aperture of solid phase carrier (allow synthesis column be in " steam atmosphere "), promote ammonolysis composition and conjunction
At DNA chain carry out ammonolysis reaction.
The term as used herein " microwave " refers to that frequency is electricity of 300MHz to 300GHz, the i.e. wavelength between 1 millimeter to 1 meter
Magnetic wave.For glass, plastics and porcelain, microwave is almost penetrated and non-absorbent.Water and aqueous solution can absorb microwave and
Make self-heating.Metal substance then can microwave reflection.In some embodiments of the present invention, it can be produced using micro-wave oven
Raw microwave.In general, the frequency for the microwave that micro-wave oven generates is in 2450MHz or so.
Ammonolysis method provided by the invention, comprising the following steps:
1) to include in the synthesis column for the solid phase carrier of synthetic DNA segment be added ammonolysis composition；
2) synthesis column is placed in the resealable container equipped with ammonolysis buffer, and synthesis column is kept to be located at ammonolysis buffer
Ullage；
3) with resealable container described in microwave treatment, so that solid phase carrier is in the steam atmosphere of ammonolysis buffer；With
And
4) synthesis column is taken out, solid phase carrier is handled with eluent and collects efflux.
In some embodiments of step 1), a small amount of ammonolysis composition is added in Xiang Hecheng column, for example, solid phase carries
0.3 to 5 times of body volume, such as such as 0.5,0.6,0.8,1,2,3 times.In order to which ammonolysis composition can be effectively distributed in
Ammonolysis reaction is sufficiently participated in solid phase carrier, ammonolysis group as mobile phase can be allowed by way of being centrifuged or pressurizeing
It closes object to flow along solid phase carrier, to be dispersed throughout solid phase carrier.In some preferred embodiments, in order to prevent it is above-mentioned from
In the heart or press processes excessive ammonolysis composition be moved to solid phase carrier lower part (or even from the lower part of solid phase carrier flow
Out), cause the amount of the top ammonolysis composition of solid phase carrier very few, suitable ammonolysis composition can be added into synthesis column,
And a period of time is stood, such as 2-10 minutes.The amount for the ammonolysis composition added can be identical or different with the amount added before.
The support for being suitable for clamping synthesis column can be placed in some embodiments of step 2), in resealable container
Object.In this case, synthesis column be directly placed on support, and have on support be suitable for clamping synthesis column hole or
Other structures.In other cases, synthesis column can be placed on to synthesis column holder (for example, 96 orifice plates or 384 orifice plate branch
Frame) on, then the synthesis column holder is placed on the support in resealable container.These supports can keep synthesis column position
In the ullage of ammonolysis buffer, in case synthesis column is immersed in ammonolysis buffer.To the shape, size or knot of support
Structure has no special requirements, as long as being suitable for clamping synthesis column or holding synthesis column holder.In preferred implementation side of the invention
In case, allows synthesis column to be in inversion state (synthesis column is allowed to be inverted on the support) when carrying out ammonolysis reaction, steamed with facilitating
Vapour enters in solid phase carrier from the bottom up.
In some embodiments of step 3), pass through the microwave treatment resealable container of micro-wave oven generation.Used is micro-
Wave power can be 200W to 1000W, such as 500W, 600W, 700W, 800W etc..The microwave treatment on the one hand can be can be close
Steam is generated in envelope container, allows synthesis column to be in steam atmosphere, on the other hand can promote the DNA chain of ammonolysis composition and synthesis
Between ammonolysis reaction.In some embodiments of the present invention, the time of microwave treatment is 1 to 20 minute, such as 5 minutes, 6
Minute, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes etc..Obviously, microwave
The processing time is related with microwave power used, resealable container and desired ammonolysis reaction performance level, art technology
Personnel can easily obtain suitable microwave power and processing ageing by test.
In some embodiments of step 4), after taking out synthesis column, first it is centrifuged with inversion state residual on removal synthesis column
The small water droplet (being generated by steam condensation) stayed, then carry out subsequent elution step.In other embodiments, baking can be passed through
It is dry or remaining small water droplet is removed with microwave heating in micro-wave oven.It in some embodiments, can be with before elution
Synthesis column is cleaned with cleaning reagent, to remove unreacted reagent and byproduct of reaction.Common cleaning reagent includes methanol-water
Solution (preferably 85% (v/v) methanol aqueous solution) or acetonitrile etc..It can be cleaned with these cleaning reagents one or many.
The inventors discovered that the ammonolysis group of the diethylenetriamines of 1:2-20:5-40 volume ratio, 1M alkaline aqueous solution and alcohol
Closing object has preferable ammonolysis effect.Other compositions beyond this ratio range may also have ammonolysis effect to a certain degree,
But it might have other adverse effects simultaneously, for example, the concentration prepared of aqueous slkali can lead to the problem of deliquescent when too high, i.e., can
Precipitating is generated, and when alkali soluble liquid proportional is higher, the DNA fragmentation (primer) eluted later is easy to produce salt in Mass Spectrometer Method
Peak.In another example being likely to result in ammonolysis yield relatively low (OD value is smaller), primer, most appearance is whitened and (is led by salt after draining afterwards
Cause) and situations such as ammonolysis efficiency relatively low (each blocking group deprotection not exclusively etc.).
Some aspects of the invention are described in detail below in conjunction with specific embodiment.Unless otherwise indicated, hereafter
The method and material of the embodiment of description are the conventional products that can be obtained by purchase.
Embodiment 1
The purpose of the present embodiment is the primer that composition length is 25,60 and 100 bases, and sequence is respectively as follows:
5 '-AAACCCAGGGCCTCAAGGACAAACC-3 ' (target molecular weight 7623.0)
5’-
TTCTTTCCTCCCTAAACACTGACCTCCCGCAGTCTTCACTAGCAGGTGAGGTCACC TGTA-3 ' (target
18232.8) molecular weight is
5’-
GTACCGAGCTCGGATCCGCCACCATGGCTGAAAATAGTGTATTAACATCCACTACTGGGAGGACTAGCTTGGCAGAC
TCTTCCATTTTTGATTCTAAAGT-3 ' (target molecular weight 30782.0)
1. primer synthesizes
Using 50nmol synthesis column (being purchased from Beijing Di Naxingke Biotechnology Co., Ltd, C1001-50), tetrazole is
Activating reagent, 3% (v/v) trichloroacetic acid/methylene chloride are deprotecting regent, 20% (v/v) acetic anhydride/acetonitrile, 16% (v/v)
N-methyl imidazoles/acetonitrile is nut cap reagent, and 0.025M iodine solution is oxidising agent.It is synthesized on 192 synthesizer of Dr.Oligo corresponding
Primer sequence.
2. microwave ammonolysis
1) primer synthesis column is transferred on 96 hole board mounts, and 20 μ L microwave ammonolysis reagents (two is added into synthesis column
Ethylenetriamine: 1M lithium hydroxide aqueous solution: ethyl alcohol=1:3:6, volume ratio)；
2) 96 hole board mounts are faced up, in 300rpm/min revolving speed, (centrifuge is purchased from Shanghai Lu within 1 minute from lower centrifugation
Xiang Yi centrifuge Instrument Ltd., model L-550), and 20 μ L microwave ammonolysis reagents are added, then stand 3 minutes；.
3) it is added 80mL microwave buffer in Xiang Weibo ammonolysis glass guide channel (size 17cm × 12cm × 6cm), and by 96 holes
Board mount is inverted on ammonolysis bracket, covers tightly ammonolysis slot box cover, is put into 700W micro-wave oven fire reaction 12 minutes high；
4) after reaction, 96 hole board mounts are inverted in centrifuge, 300rpm/min is centrifuged 1 minute；
5) 96 orifice plate bracket sides are placed in micro-wave oven and are heated 1 minute, it is then 5 minutes cooling in draught cupboard；
6) 200 μ L acetonitriles are added into each synthesis column, 1600rpm/min is centrifuged 5-10 seconds, discards efflux, and repeat one
It is secondary；
7) aqueous solution of 200 μ L, 85% methanol is added into each synthesis column, 1600rpm/min is centrifuged 1 minute, discards stream
Liquid out；
8) 200 μ L acetonitriles are added into each synthesis column, 1600rpm/min is centrifuged 1 minute, discards efflux；
9) 96 hole board mounts are placed in 96 hole deep-well plates, 200 μ L aqua sterilisas is added into each synthesis column, stand 1 point
Zhong Hou, 1600rpm/min are centrifuged 1 minute, collect efflux.
10) primer solution of collection is subjected to HPLC, MS and UV analysis, is as a result respectively displayed on Fig. 1 into Fig. 5.By
Fig. 1 has apparent UV absorption as it can be seen that preferable ultraviolet spectra is presented in the primer of three kinds of different lengths at 260nm.By scheming
2 as it can be seen that preferable purity is presented in the primer of three kinds of different lengths on HPLC.By Fig. 3 to Fig. 5 as it can be seen that three kinds of different lengths
Primer shows correct molecular weight on mass spectrum.Above data illustrates that microwave ammonolysis composition provided by the invention can be preferably
Ground is applied to the ammonolysis of various length primers.
Embodiment 2
The purpose of the present embodiment is the primer that composition length is 25,60 and 100 bases, uses traditional microwave
Ammonolysis, and the composition of result and microwave ammonolysis provided by the invention is compared.The sequence of synthesis is respectively as follows:
5 '-AAACCCAGGGCCTCAAGGACAAACC-3 ' (target molecular weight 7623.0)
5’-
TTCTTTCCTCCCTAAACACTGACCTCCCGCAGTCTTCACTAGCAGGTGAGGTCACC TGTA-3 ' (target
18232.8) molecular weight is
5’-
GTACCGAGCTCGGATCCGCCACCATGGCTGAAAATAGTGTATTAACATCCACTACTGGGAGGACTAGCTTGGCAGAC
TCTTCCATTTTTGATTCTAAAGT-3 ' (target molecular weight 30782.0)
1. primer synthesizes
Using the synthesis column of 50nmol, tetrazole is activating reagent, and 3% (v/v) trichloroacetic acid/methylene chloride is deprotection
Reagent, 20% (v/v) acetic anhydride/acetonitrile, 16% (v/v) N-methyl imidazoles/acetonitrile are nut cap reagent, and 0.025M iodine solution is oxidation
Reagent.Corresponding primer sequence is synthesized on 192 synthesizer of Dr.Oligo.
2. traditional microwave ammonolysis
1) CPG in synthesis column and the frit of matrix are removed and placed in 15mL centrifuge tube, 4mL ammonolysis liquid (0.2M is added
NaOH, water: methanol=1:4, v/v), it screws pipe lid and seals；
2) the use of microwave output power is 700W micro-wave oven microwave heating 6s, takes out be put in ice water cooling 1s, weight immediately
Multiple aforesaid operations recycle for 40 totally；
3) 50 μ l acetic acid neutralization reactions after reaction, are added into ammonolysis liquid, are drained using speedvac；
4) primer is dissolved in 200 μ L aqua sterilisas, and carries out HPLC, MS and UV analysis, as the result is shown in figure 6 and figure 7.
As seen from Figure 6, the primer of three kinds of length is inhaled at 260nm in apparent ultraviolet feature after traditional microwave ammonolysis
Peak is received, but also has obvious Impurity Absorption at its 230nm.As seen from Figure 7, the primer of three kinds of length after traditional microwave ammonolysis
The purity presented on HPLC is poor, there is obvious division peak and miscellaneous peak.In addition, the primer of three kinds of length is through traditional microwave ammonolysis
Correct molecular weight can not be obtained by mass spectrum afterwards.It can be seen that the primer quality obtained via traditional microwave ammonolysis method
It is poor, and trivial operations, it is more difficult to it is used for industrialized production.
In embodiments of the present invention, the dosage of ammonolysis composition (or ammonolysis reagent) is usually to synthesize in column admittedly
0.3 to 5 times of phase carrier bulk.In the prior art, if using less amount of ammonolysis composition, ammonolysis composition can be
It volatilizees too quickly in microwave processing process, it is difficult to effectively complete ammonolysis reaction.The present inventor passes through the sealing in ammonolysis reaction
The steam of ammonolysis buffer is provided in environment and dexterously solves this problem.
Some clear superiorities of the method for the present invention include but is not limited to reduce ammonolysis composition dosage, are reduced costs；
Ammonolysis process is easy to operate without cooling down repeatedly without bumping problem；It is not necessary that multiple synthesis columns are immersed in ammonolysis solution, keep away
Cross contamination is exempted from；Without draining ammonolysis solution, the ammonolysis time is shortened.In embodiments of the present invention, it is also not required to
CPG powder or CPG Frits are taken out out of synthesis column, so subsequent cleaning solvent is facilitated to wash.In addition, with use
The gas phase ammonolysis of high-tension apparatus is compared, and device needed for the method for the present invention (resealable container, micro-wave oven etc.) is apparently more simple.
Thus, it is thus evident that ammonolysis method provided by the invention can be used for industrializing on a large scale and automated production.
Fields technician of the present invention should be understood that process as described above and material, be merely exemplary, without that should regard
To limit the scope of the invention.
Claims (15)
1. a kind of method for carrying out ammonolysis after DNA synthesis in solid state, comprising the following steps:
1) to include in the synthesis column for the solid phase carrier of synthetic DNA segment be added ammonolysis composition；
2) the synthesis column is placed in the resealable container equipped with ammonolysis buffer, and the synthesis column is kept to be located at the ammonia
Solve the ullage of buffer；And
3) with resealable container described in microwave treatment, so that the solid phase carrier is in the steam atmosphere of the ammonolysis buffer
In；
4) the synthesis column is taken out, the solid phase carrier is handled with eluent and collects efflux.
2. the method as described in claim 1, wherein the solid phase carrier is CPG powder or CPG Frits.
3. the method as described in claim 1, wherein the synthesis column is one or more.
4. the method for claim 1, wherein by volume, the dosage of ammonolysis composition described in step 1) is described
0.3 to 5 times of solid phase carrier volume.
5. the method as described in claim 1, wherein microwave treatment described in step 3) includes with 5 to 20 points of 700W microwave treatment
Clock.
6. the method as described in claim 1 further includes wherein with cleaning reagent before eluent processing in step 4)
Clean the synthesis column one or more times.
7. method as claimed in claim 6, wherein the cleaning reagent is methanol aqueous solution or acetonitrile.
8. the method as described in claim 1, wherein the ammonolysis composition is the diethylidene three of 1:2-20:5-40 volume ratio
The mixed solution of amine, 1M alkaline aqueous solution and alcohol.
9. method according to claim 8, wherein the alkaline aqueous solution be selected from lithium hydroxide, sodium hydroxide, potassium hydroxide,
Beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution and combinations thereof.
10. the method as described in claim 1, wherein the ammonolysis buffer is molten for the mixing of the alcohol and water of 1:5-80 volume ratio
Liquid.
11. such as claim 8 or 10 or the method, wherein the alcohol is selected from methanol, ethyl alcohol, propyl alcohol, isopropanol, positive fourth
Alcohol, isobutanol, sec-butyl alcohol, tert-butyl alcohol and combinations thereof.
12. the method as described in claim 1, wherein the DNA fragmentation length is 10-200 base.
13. a kind of ammonolysis composition, diethylenetriamines, 1M alkaline aqueous solution and alcohol including 1:2-20:5-40 volume ratio.
14. ammonolysis composition as claimed in claim 13, the alkaline aqueous solution is selected from lithium hydroxide, sodium hydroxide, hydrogen-oxygen
Change potassium, beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution and combinations thereof.
15. ammonolysis composition as claimed in claim 13, wherein the alcohol is selected from methanol, ethyl alcohol, propyl alcohol, isopropanol, positive fourth
Alcohol, isobutanol, sec-butyl alcohol, tert-butyl alcohol and combinations thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711342322.4A CN109956987B (en) | 2017-12-14 | 2017-12-14 | Ammonolysis process and ammonolysis composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711342322.4A CN109956987B (en) | 2017-12-14 | 2017-12-14 | Ammonolysis process and ammonolysis composition |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109956987A true CN109956987A (en) | 2019-07-02 |
| CN109956987B CN109956987B (en) | 2022-05-17 |
Family
ID=67018448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711342322.4A Active CN109956987B (en) | 2017-12-14 | 2017-12-14 | Ammonolysis process and ammonolysis composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109956987B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922434A (en) * | 2019-12-05 | 2020-03-27 | 武汉金开瑞生物工程有限公司 | Deoxynucleotide primer synthesis method |
| CN111704644A (en) * | 2020-08-18 | 2020-09-25 | 苏州金唯智生物科技有限公司 | Ammonolysis solution and ammonolysis method |
| CN113004359A (en) * | 2021-02-25 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Method for purifying primer by oligonucleotide rapid deprotection group |
| CN113041967A (en) * | 2021-02-26 | 2021-06-29 | 通用生物系统（安徽）有限公司 | Synthesis production process of ultralong-chain nucleic acid |
| WO2021174925A1 (en) * | 2020-03-06 | 2021-09-10 | 苏州金唯智生物科技有限公司 | Ammonolysis purifier |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5656741A (en) * | 1992-03-30 | 1997-08-12 | Barrskogen, Inc. | Process and reagents for processing synthetic oligonucleotides |
| WO1999064434A1 (en) * | 1998-06-11 | 1999-12-16 | Isis Pharmaceuticals, Inc. | Synthetic methods and intermediates for triester oligonucleotides |
| CN1345328A (en) * | 1999-03-29 | 2002-04-17 | 安德鲁·戈尔兹伯勒 | Cleavage of nucleic acid from solid supports |
| WO2002072864A2 (en) * | 2001-03-08 | 2002-09-19 | Applera Corporation | Reagents for oligonucleotide cleavage and deprotection |
| WO2004007748A2 (en) * | 2002-07-12 | 2004-01-22 | Sirna Therapeutics, Inc. | Deprotection and purification of oligonucleotides and their derivatives |
| CN1479745A (en) * | 2000-12-05 | 2004-03-03 | 艾夫西亚有限公司 | Process for preparation of thiophosphate oligonucleotides |
-
2017
- 2017-12-14 CN CN201711342322.4A patent/CN109956987B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5656741A (en) * | 1992-03-30 | 1997-08-12 | Barrskogen, Inc. | Process and reagents for processing synthetic oligonucleotides |
| WO1999064434A1 (en) * | 1998-06-11 | 1999-12-16 | Isis Pharmaceuticals, Inc. | Synthetic methods and intermediates for triester oligonucleotides |
| CN1345328A (en) * | 1999-03-29 | 2002-04-17 | 安德鲁·戈尔兹伯勒 | Cleavage of nucleic acid from solid supports |
| CN1479745A (en) * | 2000-12-05 | 2004-03-03 | 艾夫西亚有限公司 | Process for preparation of thiophosphate oligonucleotides |
| WO2002072864A2 (en) * | 2001-03-08 | 2002-09-19 | Applera Corporation | Reagents for oligonucleotide cleavage and deprotection |
| WO2004007748A2 (en) * | 2002-07-12 | 2004-01-22 | Sirna Therapeutics, Inc. | Deprotection and purification of oligonucleotides and their derivatives |
Non-Patent Citations (1)
| Title |
|---|
| NIKOLAI N.POLUSHIN: ""On the rapid deprotection of synthetic oligonucleotides and analogs"", 《NUCLEIC ACIDS RESEARCH》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922434A (en) * | 2019-12-05 | 2020-03-27 | 武汉金开瑞生物工程有限公司 | Deoxynucleotide primer synthesis method |
| CN110922434B (en) * | 2019-12-05 | 2021-03-23 | 武汉金开瑞生物工程有限公司 | Deoxynucleotide primer synthesis method |
| WO2021174925A1 (en) * | 2020-03-06 | 2021-09-10 | 苏州金唯智生物科技有限公司 | Ammonolysis purifier |
| CN111704644A (en) * | 2020-08-18 | 2020-09-25 | 苏州金唯智生物科技有限公司 | Ammonolysis solution and ammonolysis method |
| WO2022036862A1 (en) | 2020-08-18 | 2022-02-24 | 苏州金唯智生物科技有限公司 | Ammonolysis solution and ammonolysis method |
| CN113004359A (en) * | 2021-02-25 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Method for purifying primer by oligonucleotide rapid deprotection group |
| CN113041967A (en) * | 2021-02-26 | 2021-06-29 | 通用生物系统（安徽）有限公司 | Synthesis production process of ultralong-chain nucleic acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109956987B (en) | 2022-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109956987A (en) | Ammonolysis method and ammonolysis composition | |
| CA2156717C (en) | Solution and solid-phase formation of glycosidic linkages | |
| Pistorio et al. | HPLC-assisted automated oligosaccharide synthesis: implementation of the autosampler as a mode of the reagent delivery | |
| CN104192827A (en) | Method for synthesizing carbon quantum dots on basis of organic micromolecule microwave solid-phase reaction | |
| CN104017576A (en) | Method for synthesizing nitrogen-doped carbon quantum dots based on calcium citrate and urea microwave reaction | |
| CN104415740B (en) | Hydrophilic chromatographic packing as well as preparation method and application thereof | |
| CN103055816A (en) | Novel class of calixarene crown ether bond-type silicon-based adsorption materials and preparation method thereof | |
| CN105566671A (en) | Preparation method of organic-inorganic hybrid porous integral material | |
| CN103785853B (en) | A kind of preparation method of hydridization carbon silver composite material | |
| CN102617660B (en) | Preparation method of full benzyl-protected beta-alkylglucoside | |
| CN110270133A (en) | A kind of integral post plate preparation method and application based on PE sieve plate conjugation chemistry group | |
| CN105289558B (en) | The preparation and application of multicomponent block hydrophile copolymers silica gel hybridization chromatograph packing material | |
| Huang et al. | Recent developments in solid-phase glycan synthesis | |
| CN107868164B (en) | Preparation method and application of nitrosamine disinfection byproduct molecularly imprinted polymer | |
| CN106467563A (en) | The synthetic method of chondroitin sulfate tetrose and its midbody compound | |
| CN107651658A (en) | A kind of preparation method of sodium-ion battery stratiform polyhedral structure hydroxyl cupric phosphate electrode material | |
| CN113004359A (en) | Method for purifying primer by oligonucleotide rapid deprotection group | |
| CN104177451A (en) | Non-natural difunctional saccharides, and preparing methods and applications thereof | |
| Zhang et al. | Efficient and practical syntheses of mannose tri-, tetra-, penta-, hexa-, hepta-, and octasaccharides existing in N-glycans | |
| CN108610360B (en) | Phosphoramidite ester and preparation method and application thereof | |
| CN110342530A (en) | A kind of mesoporous silicon oxide and preparation method thereof | |
| CN112321489B (en) | Electrophilic molecular probe based on active sulfydryl and report ions and preparation method and application thereof | |
| CN108912331B (en) | Synthesis method of low-viscosity room-temperature vulcanized methyl silicone rubber | |
| CN104177453B (en) | A kind of synthetic method of nano grain surface dressing agent | |
| CN102580582A (en) | Aperture-adjustable pollution-resistant nanofiltration membrane and preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |