CN109956987B

CN109956987B - Ammonolysis process and ammonolysis composition

Info

Publication number: CN109956987B
Application number: CN201711342322.4A
Authority: CN
Inventors: 王建鹏; 贺玉卓; 范玉峰; 赵禹
Original assignee: Nanjing Jinsirui Science and Technology Biology Corp
Current assignee: Nanjing Jinsirui Science and Technology Biology Corp
Priority date: 2017-12-14
Filing date: 2017-12-14
Publication date: 2022-05-17
Anticipated expiration: 2037-12-14
Also published as: CN109956987A

Abstract

The present application provides a method for aminolysis after solid phase synthesis of DNA comprising the steps of: 1) adding an ammonolysis composition to a synthesis column comprising a solid support for synthesizing DNA fragments; 2) placing the synthesis column in a sealable container containing an ammonolysis buffer solution and maintaining the synthesis column above the surface of the ammonolysis buffer solution; and 3) microwaving the sealable container such that the solid support is in a vapor atmosphere of the aminolysis buffer; 4) the synthesis column is removed, the solid phase support is treated with an eluent and the effluent is collected. The invention also provides an ammonolysis composition for ammonolysis. The ammonolysis method provided by the invention only needs a small amount of ammonolysis reagent, can avoid cross contamination, shorten the reaction time, is convenient for cleaning a solvent, does not need high-pressure equipment, and is beneficial to industrial and automatic use.

Description

Ammonolysis process and ammonolysis composition

Technical Field

The invention relates to the field of bioengineering, in particular to an ammonolysis method related to DNA solid phase synthesis. The invention also relates to an ammonolysis composition for ammonolysis.

Background

DNA synthesis, particularly DNA primer synthesis, is mostly based on solid phase synthesis technology, in which phosphoramidite monomers are attached to the surface of a controlled pore glass sphere (CPG) one by one in a sequence from 3 'end to 5' end through a cycle of four steps of deprotection, condensation, oxidation, and capping. The hydroxyl group at the 5' end of each phosphoramidite monomer is protected by a Dimethoxytriphenyl (DMT) group, and the active amino groups on the bases are respectively protected by acetyl (Ac), benzoyl (Bz), diazomethide (dmf) and the like. Wherein DMT group is acid labile and can be cleaved in 3% trichloroacetic acid in dichloromethane, etc., and groups of Ac, Bz, dmf, etc. are base labile and can be cleaved in saturated ammonia solution, etc.

The synthesis comprises the following specific steps:

a) using trichloroacetic acid solution to cut off DMT groups on the surface of CPG, and exposing free hydroxyl;

b) with tetrazole as an activating agent, condensing the activated 3 'end phosphate group of the phosphoramidite monomer and the 5' end hydroxyl of the phosphoramidite monomer on the surface of the CPG to form a phosphodiester bond;

c) using iodine solution as oxidant to oxidize unstable trivalent phosphorus in the primer skeleton into stable pentavalent phosphorus;

d) acetylating the free hydroxyl groups which do not participate in the reaction in step b) by using acetic anhydride and azomethimazole as capping reagents;

e) repeating the steps a) to d) until the sequence synthesis is finished, and removing the last DMT group.

After the synthesis is finished, soaking CPG powder in a saturated ammonia water solution and placing the solution at 55 ℃ for ammonolysis reaction. The process mainly comprises three steps of reactions: i) cutting the primer from the CPG; ii) cleaving the amino protecting group at each base; iii) cleaving the phosphate group at the 3' end. In the synthesis, if the 3' end needs phosphorylation modification, the step iii) can be selectively omitted by selecting different types of CPG.

When the ammonolysis is carried out using saturated aqueous ammonia, it is usually necessary to carry out the reaction at 55 ℃ for 16 hours or at 65 ℃ for 8 hours. The reaction time can be shortened to about 15 minutes by using a 1:1 mixed solution (AMA) of saturated ammonia water and methylamine water solution as an ammonolysis reagent. However, the above-mentioned ammonolysis method requires immersing the CPG powder in the ammonolysis solution, which is likely to cause cross contamination, and it takes about 2 hours to drain the solution after the ammonolysis, so that it is difficult to apply the primer to mass production.

The existing microwave ammonolysis mode can reduce the ammonolysis reaction time to about 1 hour. In the microwave ammonolysis mode, CPG powder is soaked in a mixed solution of water and methanol of sodium hydroxide, and the reaction is carried out under the microwave condition. Because the solution may be subjected to bumping due to temperature rise, the reaction tube needs to be taken out every 6 to 10 seconds and placed in ice water for cooling for 1 to 2 seconds, and the solution is pumped to dryness after the reaction is finished to obtain the final product. This method has the following disadvantages: I) the ammonolysis reagent is easy to volatilize in the process, so that the repeatability is poor; II) repeated cooling, too cumbersome operation and long overall time consumption; III) after the reaction is finished, the primer cannot be cleaned, and the time for pumping out the mixed solution of water and methanol is long; IV) when a 96-well plate or a 384-well plate is used for large-scale primer synthesis, the compatibility is poor, and cross contamination is easy to generate.

Even if the second generation primer synthesis column uses the frit (i.e. CPG Frits) made of CPG and matrix instead of CPG powder as the solid phase carrier, the synthesis quality of the primer is improved by improving the permeability of the reagent in the synthesis process, but the solid phase carrier in the synthesis column is difficult to take out and immerse in the ammonolysis reagent during ammonolysis, and the industrial feasibility of microwave ammonolysis is also reduced.

The use of gas phase ammonolysis can significantly reduce the potential for cross-contamination. The ammonolysis method requires placing a primer synthesis column in a high-pressure container, using gaseous ammonia gas as an ammonolysis reagent, and reacting for about 30 minutes under high pressure (about 140 psi). Although the post-treatment process of the method is simpler, the requirement of the ammonolysis mode on equipment is higher.

Disclosure of Invention

In order to solve the above problems, in one aspect, the present invention provides a method for aminolysis after solid phase synthesis of DNA, comprising the steps of:

1) adding an ammonolysis composition to a synthesis column comprising a solid support for synthesizing DNA fragments;

2) placing the synthesis column in a sealable container containing an ammonolysis buffer solution and maintaining the synthesis column above the surface of the ammonolysis buffer solution; and

3) treating the sealable container with microwaves such that the solid support is in a vapor atmosphere of the aminolysis buffer;

4) the synthesis column is removed, the solid phase support is treated with an eluent and the effluent is collected.

In one embodiment, the solid support is CPG powder or CPG Frits.

In one embodiment, the number of synthesis columns is one. In another embodiment, the number of synthesis columns is more than one.

In one embodiment, a support that can be used to hold the synthesis column can be disposed within the sealable container.

In another embodiment, the synthesis column is located on a synthesis column scaffold. Accordingly, a holder for holding the synthesis column holder may be provided in the sealable container. In a preferred embodiment, the synthetic column scaffold is a 96-well plate scaffold or a 384-well plate scaffold.

In one embodiment, the ammonolysis composition of step 1) is used in an amount of 0.3 to 5 times the volume of the solid support, by volume.

In one embodiment, step 1) further comprises flowing the added aminolysis composition through the synthesis column by centrifugation or pressurization so as to be distributed throughout the solid support of the synthesis column.

In a preferred embodiment, step 1) further comprises supplementing said synthesis column with said ammonolysis composition after said centrifugation or pressurization and allowing to stand for more than 1 minute. Preferably, the additional aminolysis composition is present in an amount of from 0.3 to 5 times the volume of the solid support.

In one embodiment, step 2) further comprises holding the synthesis column in an inverted state within the sealable container.

In a particular embodiment, the microwave treatment in step 3) comprises microwave treatment at 700W for 5 to 20 minutes.

In one embodiment, step 4) further comprises removing residual water droplets on the synthesis column by centrifugation and/or drying and/or microwave heating prior to the eluent treatment. In a preferred embodiment, the synthesis column is centrifuged in an inverted state while centrifuging to remove the water droplets.

In one embodiment, step 4) further comprises washing the synthesis column with a washing reagent one or more times prior to the eluent treatment. Preferably, the cleaning reagent is aqueous methanol or acetonitrile. Preferably, the aqueous methanol solution is an 85% (v/v) aqueous methanol solution.

In one embodiment, the eluent is water, preferably sterile water.

In one embodiment, the aminolysis composition is a mixed solution of diethylenetriamine, a 1M alkaline aqueous solution and an alcohol in a volume ratio of 1:2 to 20:5 to 40. Preferably, the basic aqueous solution is selected from the group consisting of lithium hydroxide, sodium hydroxide, potassium hydroxide, beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution, and combinations thereof. In one embodiment, the ammonolysis buffer is a mixed solution of alcohol and water in a volume ratio of 1:5 to 80. Preferably, the alcohol is selected from the group consisting of methanol, ethanol, propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol and combinations thereof.

In one embodiment, the DNA fragment is 10 to 200 bases in length.

In one embodiment, the DNA fragment is 10 to 100 bases in length.

In one embodiment, the DNA fragment is 10-60 bases in length.

In one embodiment, the DNA fragment is a primer.

In another aspect, the invention also provides an ammonolysis composition comprising diethylenetriamine, a 1M aqueous alkaline solution and an alcohol in a volume ratio of 1:2 to 20:5 to 40. Preferably, the basic aqueous solution is selected from the group consisting of lithium hydroxide, sodium hydroxide, potassium hydroxide, beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution, and combinations thereof. Preferably, the alcohol is selected from the group consisting of methanol, ethanol, propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol and combinations thereof.

In another aspect, the invention also provides the use of the ammonolysis composition in an ammonolysis reaction comprising contacting the ammonolysis composition with a solid support on which the synthesis of DNA fragments has been performed.

Compared with the existing ammonolysis mode, the ammonolysis method provided by the invention only needs a small amount of ammonolysis reagent, can avoid cross contamination, shortens the reaction time, is convenient for cleaning a solvent, does not need high-pressure equipment, and is beneficial to industrial and automatic use.

Drawings

FIG. 1 shows UV spectra of primers of different lengths treated by the ammonolysis process of the invention.

FIG. 2 shows a high performance liquid chromatogram of primers of different lengths treated by the ammonolysis method of the invention.

FIG. 3 shows a mass spectrum of a 25 base primer treated by the ammonolysis method of the invention.

FIG. 4 shows a mass spectrum of a 60-base primer treated by the ammonolysis method of the invention.

FIG. 5 shows a mass spectrum of a 100 base primer treated by the ammonolysis method of the invention.

FIG. 6 shows UV spectra of primers of different lengths treated by conventional ammonolysis methods.

FIG. 7 shows a high performance liquid chromatogram of primers of different lengths processed by a conventional ammonolysis method.

Detailed Description

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "solid phase synthesis of DNA" as used herein refers to a method of synthesizing DNA strands commonly used in the art, comprising: the terminal nucleotide (for example, 3' -terminal nucleotide) of the DNA strand to be synthesized is immobilized in advance on an insoluble solid phase support, and the other nucleotides are sequentially grown in a predetermined order from this end until the entire DNA strand is synthesized. One nucleotide residue per extension undergoes the same round of operation (see background section) and the DNA strand being extended remains immobilized on the solid support at all times. Excess unreacted or reaction by-products can be removed by filtration or washing. The DNA chain synthesized to the required length can be cut off from the solid phase carrier, various protecting groups are removed, and the final product can be obtained after purification. The DNA strands synthesized in this manner are usually several tens of bases, or up to several hundreds of bases, which can be used, for example, as PCR primers, linkers, probes, or the like.

The term "synthetic column" as used herein generally includes three sections, a solid support, a sieve plate and an empty column tube. The hollow column tube is usually injection molded from polypropylene, with an upper port larger than a lower port, and the solid support and sieve plate are packed therein. A commonly used solid support is a powdered Controlled Pore Glass (CPG). The CPG sphere has many irregular pores inside, and the mobile phase can flow in the pores. The sieve plate is usually made by sintering UHMW-PE or HDPE powder. The UHMW-PE powder is in a semi-molten state at a certain temperature, and the particles are bridged to form a certain pore size. In DNA synthesis, the sieve plate serves to prevent CPG from leaking and synthetic reagents from passing through. Currently, the most commonly used "second generation synthesis columns" are composed of CPG Frits (filter elements containing glass spheres with controlled pore size) and hollow column tubes. CPG Frits are sintered from CPG and UHMW-PE or HDPE powders. The UHMW-PE particles wrap and fix the CPG particles, and the UHMW-PE particles are bridged to form a certain pore diameter. The mobile phase can flow in the pores inside the CPG and the pores between the UHMW-PE particles to complete various chemical reactions (see chinese patent publication No. CN 204151332U).

The term "inverted" or "inverted state" as used herein in reference to a synthesis column refers to placement of the synthesis column on a support or holder with the upper port on the lower port and the lower port on the upper port, relative to the common state of a synthesis column with the upper port on the lower port and the lower port on the lower port.

The term "aminolysis" or "aminolysis reaction" as used herein refers to a chemical process in which, at the final stage of solid phase synthesis of DNA, the synthesized DNA strand is cleaved from the solid support by aqueous ammonia solution (or other alkaline solution), the amino protecting group on the base is cleaved, and/or the phosphate group at the 3' end is cleaved.

The term "ammonolysis composition" as used herein refers to a composition used to carry out the above described ammonolysis process, and may also be referred to as an ammonolysis agent. In some embodiments of the invention, the ammonolysis composition is a mixed solution of diethylenetriamine, 1M alkaline aqueous solution and alcohol in a volume ratio of 1:2 to 20:5 to 40. Examples of the alkaline aqueous solution include lithium hydroxide, sodium hydroxide, potassium hydroxide, beryllium hydroxide, magnesium hydroxide, and calcium hydroxide solution. The alcohol used is generally a lower alcohol, for example, methanol, ethanol, propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, etc.

The term "sealable container" as used herein refers to a container for carrying out an ammonolysis reaction therein, which container may be sealed, for example by capping. The sealable container is microwave transparent, for example made of glass, ceramic, plastic, etc. When the ammonolysis reaction is carried out, the ammonolysis buffer is added in advance to generate steam under the microwave treatment. The vapor enters the pores of the solid support through the top and bottom ports of the synthesis column (i.e., the synthesis column is placed in a "vapor atmosphere") to facilitate the aminolysis reaction of the aminolysis composition with the synthesized DNA strands.

The term "microwave" as used herein refers to electromagnetic waves having a frequency of 300MHz to 300GHz, i.e. a wavelength of between 1 mm to 1 m. For glass, plastic and porcelain, microwaves are almost transmitted without being absorbed. Water and aqueous solutions absorb microwaves and heat themselves. The metal substance reflects the microwave. In some embodiments of the invention, a microwave oven may be employed to generate microwaves. Generally, the frequency of the microwave generated by the microwave oven is about 2450 MHz.

The ammonolysis method provided by the invention comprises the following steps:

2) placing the synthesis column in a sealable container filled with an ammonolysis buffer solution, and keeping the synthesis column above the liquid level of the ammonolysis buffer solution;

3) treating the sealable container with microwaves such that the solid support is in a vapor atmosphere of an aminolysis buffer; and

4) the synthesis column is removed, the solid phase carrier is treated with an eluent and the effluent is collected.

In some embodiments of step 1), a small amount of the ammonolysis composition is added to the synthesis column, for example 0.3 to 5 times, e.g. 0.5, 0.6, 0.8, 1, 2, 3 times the volume of the solid support. In order to allow the ammonolysis composition to be efficiently distributed in the solid carrier to sufficiently participate in the ammonolysis reaction, the ammonolysis composition as a mobile phase may be caused to flow along the solid carrier by centrifugation or pressurization so as to be distributed over the solid carrier. In some preferred embodiments, to prevent too much ammonolysis composition from moving to the lower portion of the solid support (and even out of the lower portion of the solid support) during the centrifugation or pressurization process described above, resulting in too little ammonolysis composition in the upper portion of the solid support, the synthesis column can be supplemented with an appropriate amount of ammonolysis composition and allowed to stand for a period of time, such as 2-10 minutes. The amount of supplemental ammonolysis composition may be the same or different than the amount previously added.

In some embodiments of step 2), a support suitable for holding a synthesis column may be placed within the sealable container. In this case, the synthesis column is placed directly on the support and the support has a well or other structure suitable for holding the synthesis column. In other cases, the synthesis column may be placed on a synthesis column holder (e.g., a 96-well or 384-well plate holder) which is then placed on a support within a sealable container. These supports may keep the synthesis column above the surface of the ammonolysis buffer so as not to soak the column in the ammonolysis buffer. There is no particular requirement on the shape, size or structure of the support, as long as it is suitable for holding the synthetic column or holding the synthetic column holder. In a preferred embodiment of the invention, the ammonolysis reaction is carried out with the synthesis column in an inverted position (i.e.with the synthesis column inverted on the support) to facilitate the passage of the vapour from the bottom up into the solid support.

In some embodiments of step 3), the container is sealable by microwave treatment generated by a microwave oven. The microwave power used may be 200W to 1000W, for example 500W, 600W, 700W, 800W, etc. The microwave treatment can generate steam in a sealable container, leaving the synthesis column in a steam atmosphere, on the one hand, and can promote the aminolysis reaction between the aminolysis composition and the synthesized DNA strands, on the other hand. In some embodiments of the invention, the time of the microwave treatment is 1 to 20 minutes, such as 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, and the like. It is clear that the microwave treatment time is dependent on the microwave power used, the sealable container and the desired degree of completion of the ammonolysis reaction, and that a suitable combination of microwave power and treatment time can easily be obtained by the skilled person by experimentation.

In some embodiments of step 4), after removal of the synthesis column, the remaining water droplets (resulting from condensation of the vapor) on the synthesis column are centrifuged off in an inverted state before the subsequent elution step. In other embodiments, the residual water droplets may be removed by drying or microwave heating in a microwave oven. In some embodiments, the synthesis column may be washed with a washing reagent prior to elution to remove unreacted reagents and reaction byproducts. Commonly used washing reagents include aqueous methanol (preferably 85% (v/v) aqueous methanol) or acetonitrile, and the like. These washing reagents may be used for washing one or more times.

The inventor finds that the ammonolysis composition of diethylenetriamine, 1M alkaline aqueous solution and alcohol with the volume ratio of 1:2-20:5-40 has better ammonolysis effect. Other compositions outside this range may also have some aminolysis effect, but may also have other adverse effects, such as solubility problems, i.e., precipitation, when the concentration of the alkaline solution is too high, and salt peaks of the DNA fragments (primers) eluted later in mass spectrometry when the ratio of the alkaline solution is high. For example, the aminolysis yield may be low (OD value is small), the appearance of the primer becomes white after the primer is finally drained (due to salt), and the aminolysis efficiency may be low (e.g., each protecting group is not completely deprotected).

Some aspects of the invention are described in detail below with reference to specific embodiments. Unless otherwise indicated, the methods and materials of the examples described below are all conventional products available through purchase.

Example 1

The purpose of this example was to synthesize primers of 25, 60 and 100 bases in length, the sequences being:

5'-AAACCCAGGGCCTCAAGGACAAACC-3' (molecular weight 7623.0)

5’-

TTCTTTCCTCCCTAAACACTGACCTCCCGCAGTCTTCACTAGCAGGTGAGGTCACCTGTA-3' (target molecular weight 18232.8)

5’-

GTACCGAGCTCGGATCCGCCACCATGGCTGAAAATAGTGTATTAACATCCACTACTGGGAGGACTAGCTTGGCAGACTCTTCCATTTTTGATTCTAAAGT-3' (target molecular weight 30782.0)

1. Primer synthesis

A50 nmol synthesis column (purchased from Beijing Dinaghachi Biotechnology Co., Ltd., C1001-50), tetrazole as an activating reagent, 3% (v/v) trichloroacetic acid/dichloromethane as a deprotecting reagent, 20% (v/v) acetic anhydride/acetonitrile, 16% (v/v) azomethimazole/acetonitrile as a capping reagent, and 0.025M iodine solution as an oxidizing reagent were used. The corresponding primer sequences were synthesized on a dr. oligo 192 synthesizer.

2. Microwave ammonolysis

1) The primer synthesis column was transferred to a 96-well plate holder, and 20 μ L of a microwave ammonolysis reagent (diethylenetriamine: 1M aqueous lithium hydroxide solution: ethanol 1:3:6 by volume);

2) centrifuging a 96-well plate bracket at a rotation speed of 300rpm/min for 1 minute (the centrifuge is purchased from Shanghai Luxiang apparatus, Inc., model L-550), adding 20 μ L of microwave ammonolysis reagent, and standing for 3 minutes; .

3) Adding 80mL of microwave buffer solution into a microwave ammonolysis glass tank (with the size of 17cm multiplied by 12cm multiplied by 6cm), inverting a 96-pore plate bracket on the ammonolysis bracket, covering a box cover of the ammonolysis tank tightly, and placing the ammonolysis tank in a 700W microwave oven for high-fire reaction for 12 minutes;

4) after the reaction is finished, the 96-hole plate bracket is placed in a centrifuge upside down and centrifuged for 1 minute at 300 rpm/min;

5) the 96-well plate holder side was heated in a microwave oven for 1 minute, followed by cooling in a fume hood for 5 minutes;

6) adding 200 mu L acetonitrile into each synthetic column, centrifuging at 1600rpm/min for 5-10 s, discarding the effluent, and repeating once;

7) adding 200 μ L of 85% methanol water solution into each synthetic column, centrifuging at 1600rpm/min for 1 min, and discarding the effluent;

8) adding 200 mu L acetonitrile into each synthetic column, centrifuging at 1600rpm/min for 1 min, and discarding the effluent liquid;

9) the 96-well plate holder was placed on a 96-well deep-well plate, 200. mu.L of sterilized water was added to each synthesis column, and after standing for 1 minute, centrifugation was carried out at 1600rpm/min for 1 minute, and the effluent was collected.

10) The collected primer solutions were subjected to HPLC, MS and UV analysis, and the results are shown in fig. 1 to 5, respectively. As can be seen from FIG. 1, the primers with three different lengths all exhibit better ultraviolet spectra, and have obvious ultraviolet absorption at 260 nm. As can be seen from FIG. 2, the three primers of different lengths exhibited better purity on HPLC. As can be seen from FIGS. 3 to 5, the primers of three different lengths all showed the correct molecular weight on the mass spectrum. The above data show that the microwave ammonolysis composition provided by the invention can be better applied to ammonolysis of primers with various lengths.

Example 2

The purpose of this example was to synthesize primers of 25, 60 and 100 bases in length, use conventional microwave ammonolysis, and compare the results with the microwave ammonolysis compositions provided by the invention. The sequences synthesized were:

5'-AAACCCAGGGCCTCAAGGACAAACC-3' (molecular weight 7623.0)

5’-

1. Primer synthesis

A50 nmol synthesis column was used, tetrazole as the activating reagent, 3% (v/v) trichloroacetic acid/dichloromethane as the deprotecting reagent, 20% (v/v) acetic anhydride/acetonitrile, 16% (v/v) azomethimazole/acetonitrile as the capping reagent, and 0.025M iodine solution as the oxidizing reagent. The corresponding primer sequences were synthesized on a dr. oligo 192 synthesizer.

2. Conventional microwave ammonolysis

1) The frit of CPG and matrix in the synthesis column was removed and placed in a 15mL centrifuge tube, and 4mL of ammonolysis solution (0.2M NaOH, water: methanol 1:4, v/v), screwing the tube cap and sealing;

2) microwave heating for 6s by using a microwave oven with the microwave output power of 700W, immediately taking out, placing in ice water for cooling for 1s, and repeating the above operations for 40 cycles;

3) after the reaction is finished, adding 50 mu l of acetic acid into the ammonolysis solution for neutralization reaction, and pumping and drying by using speedvac;

4) the primers were dissolved in 200. mu.L of sterile water and subjected to HPLC, MS and UV analysis, the results are shown in FIGS. 6 and 7.

As can be seen from FIG. 6, the primers with three lengths all show obvious ultraviolet characteristic absorption peaks at 260nm after traditional microwave ammonolysis, but have obvious impurity absorption at 230 nm. As can be seen from FIG. 7, the primers with three lengths showed poor purity on HPLC after conventional microwave ammonolysis, and there were distinct cleavage peaks and hetero-peaks. In addition, the primers with three lengths can not obtain the correct molecular weight through mass spectrometry after the traditional microwave ammonolysis. Therefore, the primer obtained by the traditional microwave ammonolysis method has poor quality, is complex to operate and is difficult to be used for industrial production.

In embodiments of the methods of the invention, the aminolysis composition (or aminolysis reagent) is typically used in an amount of 0.3 to 5 times the volume of solid support in the synthesis column. In the prior art, if a relatively small amount of aminolysis composition is used, the aminolysis composition may volatilize too quickly during the microwave treatment, making it difficult to effectively complete the aminolysis reaction. The present inventors have ingeniously addressed this problem by providing vapors of an aminolysis buffer in a sealed environment for the aminolysis reaction.

Some significant advantages of the process of the present invention include, but are not limited to, reduced ammonolysis composition usage, reduced cost; the ammonolysis process has no bumping problem, repeated cooling is not needed, and the operation is simple; a plurality of synthesis columns do not need to be immersed in the ammonolysis solution, so that cross contamination is avoided; the ammonolysis solution does not need to be pumped out, and the ammonolysis time is shortened. In embodiments of the process of the invention, it is also not necessary to remove the CPG powder or CPG Frits from the synthesis column, so that subsequent clean solvent washing is facilitated. In addition, the apparatus required for the process of the invention (sealable vessels, microwave ovens, etc.) is significantly simpler than gas phase ammonolysis using high pressure equipment. Thus, it is apparent that the ammonolysis process provided by the present invention can be used for large-scale industrial and automated production.

It will be appreciated by those skilled in the art that the methods and materials described above are exemplary only, and should not be taken as limiting the scope of the invention.

Claims

1. A method for aminolysis following solid phase synthesis of DNA comprising the steps of:

4) taking out the synthetic column, treating the solid phase carrier with eluent and collecting effluent liquid;

wherein the ammonolysis composition is a mixed solution of diethylenetriamine, a 1M alkaline aqueous solution and an alcohol in a volume ratio of 1:2 to 20:5 to 40, the alkaline aqueous solution is selected from the group consisting of lithium hydroxide, sodium hydroxide, potassium hydroxide, beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution and combinations thereof, and the alcohol is selected from the group consisting of methanol, ethanol, propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol and combinations thereof;

wherein the ammonolysis buffer solution is a mixed solution of alcohol and water with the volume ratio of 1: 5-80.

2. The method of claim 1, wherein the solid support is CPG powder or CPG Frits.

3. The method of claim 1, wherein the synthesis column is one or more.

4. The method of claim 1, wherein the ammonolysis composition of step 1) is used in an amount of 0.3 to 5 times the volume of the solid support, by volume.

5. The method of claim 1, wherein the microwave treatment in step 3) comprises microwave treatment at 700W for 5 to 20 minutes.

6. The method of claim 1 wherein step 4) further comprises washing the synthesis column with a washing reagent one or more times prior to the eluent treatment.

7. The method of claim 6, wherein the washing reagent is aqueous methanol or acetonitrile.

8. The method of claim 1, wherein the ammonolysis composition is a mixed solution of diethylenetriamine, 1M lithium hydroxide aqueous solution and ethanol in a 1:3:6 volume ratio.

9. The method of claim 1, wherein the DNA fragments are 10-200 bases in length.

10. An ammonolysis composition which is a mixed solution of diethylenetriamine, a 1M alkaline aqueous solution and an alcohol in a volume ratio of 1:2 to 20:5 to 40, wherein the alkaline aqueous solution is selected from lithium hydroxide, sodium hydroxide, potassium hydroxide, beryllium hydroxide, magnesium hydroxide, calcium hydroxide solution and a combination thereof, and the alcohol is selected from methanol, ethanol, propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol and a combination thereof.

11. The ammonolysis composition of claim 10 which is a mixed solution of diethyltriamine, 1M aqueous lithium hydroxide and ethanol in a 1:3:6 volume ratio.