CN109953903A - A kind of skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide - Google Patents

Abstract

The invention discloses a kind of, and the skin-moisturizing, skin containing Yeast-like conidium exocellular polysaccharide is newborn.The preparation process of the Yeast-like conidium exocellular polysaccharide are as follows: take the supernatant of Yeast-like conidium fermentation liquid, dehydrated alcohol precipitating is added；Then it takes supernatant to remove removing protein with Sevage method after precipitating being dissolved in water, is centrifuged to obtain supernatant, add ethyl alcohol precipitating, can be prepared by Yeast-like conidium exocellular polysaccharide after precipitating is freeze-dried.The present invention therefrom separates using the fermentation liquid of Yeast-like conidium as raw material, extracts the exocellular polysaccharide with moisture-keeping function, by exocellular polysaccharide after purification there is good moisture-keeping function or even moisture-keeping function to be better than glycerol；Also there is good antioxidation simultaneously, the exocellular polysaccharide can be used as moisturizing active constituent and oxidation-resistant active ingredient is applied to prepare skin care item；The skin care item of preparation not only have good moisture-keeping function, while also having the function of cellular damage caused by repairing UVB radiation.

Description

A kind of skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide

Technical field

The present invention relates to technical field of skin care, more particularly, to a kind of moisturizing containing Yeast-like conidium exocellular polysaccharide Milky lotion.

Background technique

Tremella polysaccharides are a kind of extractions from fructification, submerged fermentation spore liquid of tremella etc., purify obtained heteroglycan, Neutral polysaccharide, acidic polysaccharose, exocellular polysaccharide, cell wall polysaccharide and five kinds of acid oligosaccharides can be divided into according to property and source, it can To promote the immune function of body, tumor presence is inhibited to deteriorate, reduce blood pressure and blood lipoid content, removed body free radical and slow down body Aging, while also having the function of that body not raying is protected to damage.

But when extraction polysaccharide is utilized from the fructification of tremella, needs are on the one hand grown up to due to Tremella fructification Longer time；On the other hand, the content of polysaccharide is lower in Tremella fructification, so that extracting from Tremella fructification useful Polysaccharide is not only at high cost, time-consuming and laborious, but also efficiency is extremely low, limits the application of Tremella fructification polysaccharide.Moreover, and at present It is less for the research of tremella exocellular polysaccharide, there is very big exploration space.

Therefore, it is necessary to provide it is a kind of can the high efficiency method that obtains tremella polysaccharides, and to the extraction purification of tremella polysaccharides The research of technique, and the foundation of related structure-activity relationship are conducive to promote added value of the tremella as nutriment, widen existing disappear Take market, to further promote the industrialized development of tremella effect product, there is considerable market value.

Summary of the invention

The purpose of the present invention is to provide a kind of, and the skin-moisturizing, skin containing Yeast-like conidium exocellular polysaccharide is newborn.The present invention is from tremella It separated in gemma strain fermentating liquid, extract the exocellular polysaccharide with moisture-keeping function, had by exocellular polysaccharide after purification fine Moisture-keeping function, while also have good antioxidation, exocellular polysaccharide be can be used as into moisturizing active constituent and anti-oxidant work Property ingredient be applied to prepare skin-moisturizing, skin cream, product have good moisture-keeping function, antioxidation and have reparation UVB spoke Cellular damage caused by penetrating has expanded the application value, approach and market of Yeast-like conidium exocellular polysaccharide.

Above-mentioned purpose of the invention is achieved by following scheme:

A kind of skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide, the Yeast-like conidium comprising being prepared by following methods are extracellular Polysaccharide: taking the supernatant of Yeast-like conidium fermentation liquid, and the dehydrated alcohol precipitating of 3 times of volumes is added；Then after precipitating being dissolved in water It takes supernatant to remove removing protein with Sevage method, is centrifuged to obtain supernatant, add the ethyl alcohol precipitating of 3 times of volumes, precipitate chilled dry It can be prepared by Yeast-like conidium exocellular polysaccharide after dry.

Inventor separates from Yeast-like conidium strain fermentating liquid, extracts the exocellular polysaccharide with moisture-keeping function, by purifying There is exocellular polysaccharide afterwards good moisture-keeping function or even moisture-keeping function to be better than glycerol；Also there is good antioxygen to be turned into simultaneously With the exocellular polysaccharide can be used as moisturizing active constituent and oxidation-resistant active ingredient is applied to skin-moisturizing, skin cream.

Preferably, the quality accounting of Yeast-like conidium exocellular polysaccharide is 0.5~2% in the skin-moisturizing, skin cream.

Preferably, the quality accounting of Yeast-like conidium exocellular polysaccharide is 1% in the skin-moisturizing, skin cream.

Preferably, the Yeast-like conidium bacterium is Tremella fuciformis Tyc63 and/or Tr01；It is highly preferred that institute Stating Yeast-like conidium bacterium is Tremella fuciformis Tyc63.

Preferably, the skin-moisturizing, skin cream contains the ingredient of following mass percent: oily phase 20~30%, and water 60~ 70%, glycerol 5~8%, Yeast-like conidium exocellular polysaccharide 0.5~2%, outstanding horse bp0.5~2%.

Preferably, oily phase 27%, water 65%, glycerol 6%, Yeast-like conidium exocellular polysaccharide 1%, outstanding horse bp1%.

Preferably, the oil is mutually olive emulsifying wax, Sweet Almond Oil, wheat-germ oil and fat soluble vitamin E according to matter Amount is than being that 10:7:7:3 is formed.

Preferably, the Yeast-like conidium fermentation liquid be Yeast-like conidium t bacteria remella fuciformis Tyc63 or Tr01 is in PDA culture medium, and 25 DEG C, 6 days fermentation liquids of 150r/min shaken cultivation.2 kinds of Yeast-like conidium t bacteria remella Fuciformis Tyc63 or Tr01 is under this fermentation condition, the content highest of exocellular polysaccharide, before fermentation in 6 days, with The extension of time, the content of exocellular polysaccharide is continuously increased in fermentation liquid, at fermentation the 6th day, extracellular fructose in fermentation liquid Content highest, when continuing fermentation, then the content of the exocellular polysaccharide in fermentation liquid declines instead.

Preferably, the Sevage method goes the detailed process of removing protein are as follows:

S1. the Thick many candies for weighing ethanol precipitation, add water sufficiently to dissolve, and supernatant is collected by centrifugation；

S2. the Sevage reagent of its volume 1/3 is added into supernatant, shakes 15min in mixing strongly on oscillator, it After be put into shaking table, revolving speed be adjusted to 250r/min concussion 15min, later in 4000r/min be centrifuged 15min, obtain water layer removal Intersection denatured protein；

S3. in triplicate, reagent layer intersection does not have white precipitate to step S2 after centrifugation.

Preferably, Thick many candies can heat abundant dissolution in step S1, and heating temperature is 60 DEG C；The revolving speed of the centrifugation is 8000r/min, centrifugation time 15min；Sevage reagent is made of by volume for 4:1 chloroform and n-butanol in step S2.

Preferably, polysaccharide TPF-1, TPF-2 and TPF-3 are contained in the Yeast-like conidium exocellular polysaccharide, wherein point of TPF-1 Son amount is 5189kDa, by fucose, xylose, mannose, glucuronic acid with molar ratio for 9.25:23.4:16.05:37.1 group At；The molecular weight of the TPF-2 be 171.6kDa, by fucose, xylose, mannose, glucuronic acid and galactolipin with mole Than being formed for 1.78:9.55:12.63:128.59:13.91；The molecular weight of TPF-3 is 661kDa, by rhamnose, xylose, sweet dew Sugar, glucuronic acid and galactolipin are that 3.8:30.78:52.78:12.73:14.6 is formed with molar ratio.

By the way that isolated exocellular polysaccharide is further separated and purified, find to be primarily present in extracellular fructose This 3 kinds of polysaccharide of TPF-1, TPF-2 and TPF-3, for this 3 kinds of polysaccharide without special odor, the moisture absorption easy to moisture absorption is soluble easily in water, has very Good moisture-keeping function.

Preferably, in the Yeast-like conidium exocellular polysaccharide polysaccharide TPF-1, TPF-2 and TPF-3 content ratio be 2.1~ 2.3:0.7~0.9:1.7~1.9.

It is highly preferred that the content ratio of polysaccharide TPF-1, TPF-2 and TPF-3 are 2.2 in the Yeast-like conidium exocellular polysaccharide: 0.8:1.8。

Compared with prior art, the invention has the following advantages:

The present invention is fermented, using Yeast-like conidium Tremella fuciformis Tyc63 or Tr01 as strain with it Fermentation liquid is raw material, therefrom separates, extracts the exocellular polysaccharide with moisture-keeping function, is had by exocellular polysaccharide after purification fine Moisture-keeping function in addition moisture-keeping function be better than glycerol；Also there is good antioxidation simultaneously, the exocellular polysaccharide can be used as Moisturizing active constituent and oxidation-resistant active ingredient are applied to prepare skin care item.

Not only there is good moisture-keeping function using the milky lotion that Yeast-like conidium exocellular polysaccharide is prepared as active constituent, simultaneously also Has the function of cellular damage caused by repairing UVB radiation.

Further, since the exocellular polysaccharide that Yeast-like conidium fermentation generates has moisturizing and antioxidation, in order to the greatest extent may be used Isolated effective exocellular polysaccharide more than energy, optimal conditions of fermentation and fermentation week of the inventor for two kinds of Yeast-like conidium strains Phase is probed into, it was found that the highest fermentation condition of exocellular polysaccharide content and fermentation period in fermentation liquid are conducive to later period benefit Moisturizer industrialized production is prepared with exocellular polysaccharide.

Detailed description of the invention

Fig. 1 is the rDNA ITS sequence amplification of 6 plants of Yeast-like conidiums in embodiment 1.

Fig. 2 is the sequence alignment result of 6 plants of Yeast-like conidiums in embodiment 1.

Fig. 3 is glucose standard curve in embodiment 2.

Fig. 4 is the Yield comparison result of 4 plants of Yeast-like conidium bacterium exopolysaccharides in embodiment 2.

Fig. 5 is the result that the extracellular polysaccharide of 2 plants of Yeast-like conidium strains and spore output change with number of days in embodiment 2.

Fig. 6 is ferrous sulfate standard curve in embodiment 3.

Fig. 7 is the anti-oxidant interpretation of result of Thick many candies in embodiment 3.

Fig. 8 is Thick many candies moisture absorption and moisturizing interpretation of result in embodiment 4.

Fig. 9 is not packaged 3 kinds of Moisturizer appearances in embodiment 5.

Figure 10 is 3 kinds of Moisturizer appearances after packing in embodiment 5.

Figure 11 is the HSF cell of normal condition growth in embodiment 6.

Figure 12 is 3 kinds of Moisturizers in embodiment 6 to the toxic effect of HSF

Figure 13 is that UVB induces the building of HSF Ageing Model in embodiment 6.

Figure 14 is protective effect of 3 kinds of Moisturizers to HSF in embodiment 6.

Figure 15 is the DEAE-Sepharose of Yeast-like conidium Tremella fuciformis Tyc63 polysaccharide in embodiment 7 Fast Flow ion-exchange chromatography.

Figure 16 is Yeast-like conidium Tremella fuciformis Tyc63 polysaccharide in embodiment 7 further through Sephadex The chromatography map of G-100 gel filtration.

Figure 17 is the appearance of TPF-1, TPF-2 and TPF-3.

Figure 18 is the ultraviolet scanning atlas of TPF-1, TPF-2 and TPF-3.

Figure 19 is the Sephadex G-100 Purity map of TPF-1, TPF-2 and TPF-3.

Figure 20 is the GC-MS chromatogram for mixing derivative monosaccharide A.

Figure 21 is the GC-MS chromatogram of TPF-1, TPF-2 and TPF-3.

Figure 22 is the GPC-RI-MALS map of TPF-1.

Figure 23 is the GPC-RI-MALS map of TPF-2.

Figure 24 is the GPC-RI-MALS map of TPF-3.

Figure 25 is the molecular configuration map of TPF-1.

Figure 26 is the molecular configuration map of TPF-2.

Figure 27 is the molecular configuration map of TPF-3.

Figure 28 is the IR spectrum scanning figure of TPF-1.

Figure 29 is the IR spectrum scanning figure of TPF-2.

Figure 30 is the IR spectrum scanning figure of TPF-3.

Figure 31 is the Congo Red test result of TPF-1, TPF-2 and TPF-3.

Specific embodiment

The present invention is made combined with specific embodiments below and further being elaborated, the embodiment is served only for explaining this Invention, is not intended to limit the scope of the present invention.Test method as used in the following examples is normal unless otherwise specified Rule method；Used material, reagent etc., unless otherwise specified, for the reagent and material commercially obtained.

1 Yeast-like conidium bacteria selection of embodiment

Optimal strain is screened from six plants of Yeast-like conidiums Tyc63, Y2, Y11, Tr01, Tr21, Tr9901.

One, the rejuvenation and culture of Yeast-like conidium

(1) bacterial strain being stored in -80 DEG C of refrigerators is inoculated in a manner of plate streaking or coating to the training of PDA solid respectively It supports and is activated on base, later the constant temperature incubation 2-3d in 25 DEG C of incubators；

(2) the good single colonie of form on culture medium is selected, in superclean bench, a ring is dipped with oese and is inoculated in In PDB culture medium, 150r/min, 25 DEG C of shaking flask culture 3d are produced to logarithmic growth phase.Taking-up is placed in standby in 4 DEG C of refrigerators later With.

Two, the Molecular Identification of Yeast-like conidium

1, PCR identifies the preparation of template DNA

(1) it take outs of the shaker the Yeast-like conidium liquid spawn for growing to logarithmic phase, under room temperature, is centrifuged in 8000r/min 15min discards supernatant, collects the thallus in liquid shaking bottle；

(2) it collects mycelia (100mg-200mg) to use in advance in Liquid nitrogen precooler centrifuge tube in 2mL, 500 μ LBuffer is added CPL and 10 μ L2- mercaptoethanols；

(3) centrifuge tube is heated into 15min in 65 DEG C of metal baths.(period mixes twice, and 5 μ L RNA enzyme are added)；

(4) 500 μ L PCI are added, rear concussion shakes up.In 12000r/min, it is centrifuged 5min；

(5) 300 μ L supernatants are carefully drawn to new 1.5mL centrifuge tube；

(6) uniform mixture is obtained after Buffer CXD of the 150 μ L containing 300 μ L dehydrated alcohols is added；

(7) whole samples are transferred to the adsorption column containing collecting pipe, 10000r/min is centrifuged 1min, discards collection liquid and receipts Collector；

(8) adsorption column is transferred in new collecting pipe, SPW wash Buffer of the 650 μ L containing dehydrated alcohol is added, 10000r/min is centrifuged 1min, discards collection liquid, adsorption column is put back in collecting pipe；

(9) repetitive operation 7；

(10) collection liquid is discarded, 12000r/min sky is centrifuged 2min；

(11) deionized water of 50 μ L65 DEG C preheating is added after drying up residual alcohol with air duct.After being placed at room temperature for 2min 12000r/min is centrifuged 2min；

(12) repetitive operation 10 obtains genomic DNA.

2, PCR primer sequence

PCR amplification, amplimer sequence are carried out using ITS universal primer ITS1 and ITS4 are as follows:

ITS1:TCCGTAGGTGAACCTGCGG

ITS4:TCCTCCGCTTATTGATATGC

The synthesis of Shanghai JaRa Guangzhou Branch, expanding fragment length 500bp.

3, PCR identification reaction system and response procedures

(1) PCR reaction system (100 μ L)

1 ITS sequence of table expands PCR system

Reagent	Volume (μ L)
		ddH2O	71.5
10xEx-Taq buffer	10
		dNTP	8
Upstream primer	2
		Downstream primer	2
Template DNA	6
		Ex-Taq enzyme	0.5

(2) PCR response procedures

94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30sec, 52 DEG C of annealing 30sec, 72 DEG C of extension 1min, 30 recycle, and 72 DEG C Extend 5min；

(3) detected through gel electrophoresis of PCR product

1% agarose electrophoresis, the observation of 150 V, 100mA, 20min electrophoresis；

(4) gel imaging system observes electrophoresis result；

(5) sequencing, sequence alignment: delivering the sequencing of Guangzhou Mei Jisheng work for target gene, and sequencing result is enterprising in NCBI Row BLAST is compared.

Three, qualification result

1,6 plants of Yeast-like conidium rDNA ITS sequence amplifications are as shown in Figure 1.Wherein M:DNA Maker3；Swimming lane 1: Tyc63 gene；Swimming lane 2:Y2 gene；Swimming lane 3:Y11 gene；Swimming lane 4:Tr01 gene；Swimming lane 5:Tr9901 gene；Swimming lane 6: Tr21 gene.

As can be known from Fig. 1,6 plants of Yeast-like conidium spores after the purification and rejuvenation, are mentioned with fungal gene group extracts kit DNA is taken, then uses ITS1 and ITS4 primer amplification ITS sequence, DNA fragmentation band is single, in 500bp or so.

2, shown in sequence alignment result part Fig. 2 of 6 plants of Yeast-like conidiums.Wherein A:Y2；B:Tyc63；C:Y11；D:Tr01；E: Tr21；F:Tr9901.

According to BLAST comparison result, this four plants of Tyc63, Tr01, Tr21, Tr9901 and Tremella are found Fuciformis similarity highest, reaches 99% or more, thus may determine that this four plants of Yeast-like conidium strains.

The determination of the higher Yeast-like conidium bacterial strain screening of the extracellular polysaccharide of embodiment 2 and fermentation period

One, the higher Yeast-like conidium bacterial strain screening of extracellular polysaccharide

1, the extracting and developing of Yeast-like conidium exocellular polysaccharide

Embodiment 1 has determined that this four plants of Tyc63, Tr01, Tr21, Tr9901 is Yeast-like conidium strain, therefore with this four plants The object of Yeast-like conidium strain is screened, and specific experiment flow is as follows:

Yeast-like conidium fermentation liquid → centrifugation → takes supernatant to be concentrated, and 3V dehydrated alcohol precipitating polysaccharide → precipitating → polysaccharide is added Crude product → distilled water heating for dissolving → centrifugation → supernatant → Sevage method removing protein → centrifuging and taking supernatant → 3V ethyl alcohol precipitating Polysaccharide → precipitating → freeze-drying → refined polysaccharide

Operating procedure:

(1) fresh Yeast-like conidium fermentation liquid is centrifuged 20min in 8000r/min room temperature, discards lower layer's spore, in collection Clear liquid；

(2) supernatant is concentrated into small size using Rotary Evaporators；

(3) dehydrated alcohol of 3V volume, overnight precipitation are added thereto；

(4) 8000r/min is centrifuged 10min at 4 DEG C, collects precipitating；

(5) precipitating is washed 2-3 times with dehydrated alcohol, is placed in freeze drier dry 36h, obtained product is as thick Polysaccharide；

(6) Thick many candies are sufficiently dissolved in 60 DEG C of hot baths, 8000r/min is centrifuged 10min, collects supernatant, will precipitate It redissolves, 8000r/min is centrifuged 10min, is repeated twice, obtains polysaccharide solution；

(7) according to polysaccharide solution: the ratio of sevage reagent (chloroform: n-butanol=4:1)=5:1, Yu Zhen after mixing It swings device and shakes 20min strongly, generate milky white precipitate, 4000r/min is centrifuged 15min, collects supernatant, so repeats at least three It is secondary, until apparent albumin layer does not occur；

(8) 3V dehydrated alcohol overnight precipitation is added in supernatant, is centrifuged 10min in 4 DEG C, 8000r/min, collects precipitating, Vacuum freeze drying obtains refined polysaccharide for 24 hours.

2, the assay of Yeast-like conidium exocellular polysaccharide

The drafting of glucose standard curve

(1) accurate to measure Standard glucose solution 1mL, 2mL, 4mL, 6mL, 10mL, it is respectively placed in 50mL volumetric flask, adds Water constant volume, shakes up；

(2) the accurate solution 1mL measured in above-mentioned each volumetric flask is separately added into 6% in clean 15mL centrifuge tube Phenol solution 1mL, 95% sulfuric acid solution 5mL are mixed；

(3) 40 DEG C of water-bath 30min, take out and are cooled to room temperature；

(4) spectrophotometric determination light absorption value OD₄₉₀；

(5) using concentration of glucose as abscissa, absorbance is ordinate, makes equation of linear regression, obtains regression equation For y=6.2986x+0.0649, r²=0.999 (outstanding person etc., 2012).

(6) sugared content in phend-sulphuric acid measurement sample

The polysaccharide solution that the exocellular polysaccharide of six plants of Yeast-like conidiums is prepared to debita spissitudo respectively, accurately draws polysaccharide solution 1.0mL adds 6% phenol solution 1.0mL mixing, concentrated sulfuric acid 5.0mL is mixed well, colour developing, in OD₄₉₀Its suction is surveyed at wavelength Shading value calculates exocellular polysaccharide yield according to the light absorption value of glucose standard curve and polysaccharide.

(7) polysaccharide yield calculation formula

Polysaccharide yield (%)=polyoses content × extension rate/sample dry weight × 100%

Two, the determination of fermentation period

The yield of spore and exocellular polysaccharide has a great impact when fermentation period is to Yeast-like conidium liquid fermentation, therefore need to look for To optimal fermentation period, the maximum output of polysaccharide is obtained with this, concrete operations are as follows:

In superclean bench, 1mL seed liquor is inoculated in 100mL PDA culture medium, 25 DEG C, 150r/min, oscillation is trained It supports, residual sugar content in continuous 10 days sampling and measuring Yeast-like conidium fermentation liquids, spore dry weight, exocellular polysaccharide changes of contents, every group sets It sets three in parallel, finds best fermentation period.

Three, result

1, the comparison result of four plants of Yeast-like conidium strain yield of extracellular polysaccharide is as shown in Figure 4.It can be seen that Tr01, The polysaccharide yield of two plants of Yeast-like conidiums of Tyc63 is apparently higher than Tr21 and Tr9901, therefore the determination in subsequent fermentation period is with Tr01 It is studied with two plants of Tyc63.

2, the determination of fermentation period: with the variation of fermentation number of days, the extracellular polysaccharide of two plants of Yeast-like conidium strains and spore The result of variations of yield is as shown in Figure 4.From fig. 4, it can be seen that polysaccharide yield gradually increases from daystart is cultivated, until Reach yield maximum at the 6th day, will appear the trend being gradually reduced later.And spore output steeply rose at 0-4 days, Reach within 4th day maximum, it is overall later downward trend occur, and finally tend towards stability.It is since we test main study subject Exocellular polysaccharide, accordingly, it is determined that the best fermentation period of Yeast-like conidium is 6 days, obtained polysaccharide yield highest.

Wherein Yeast-like conidium Tyc63 (Tremella fuciformis Tyc63), systematic name Tremella Fuciformis is preserved in Guangdong Province's Culture Collection, deposit number GDMCC on June 15th, 2018 NO.60388。

Tremella fuciformis Tyc63 bacterial strain is referred to as Tyc63 in subsequent embodiment.

The 5.8S rRNA sequence of the Tremella fuciformis Tyc63 is as shown in SEQ ID NO:1.

The antioxidant activity of 3 Yeast-like conidium exocellular polysaccharide of embodiment is analyzed

1, elimination effect of the Yeast-like conidium exocellular polysaccharide to hydroxyl radical free radical

H containing 8.8mmol/L in (Yan Jun etc., 2005) reaction system is measured referring to the experiment of face army et al.₂O₂1mL, 9mmol/L FeSO₄The polysaccharide solution 1mL of 1mL, 9mmol/L salicylic acid-ethyl alcohol 1mL, various concentration finally adds H₂O₂Starting is anti- It answers, 37 DEG C of reaction 0.5h measure the absorbance of each concentration using distilled water as reference at 510nm.In view of the suction of polysaccharide itself Light value is received, with 9mmol/L FeSO₄1 mL, 9mmol/L salicylic acid-ethyl alcohol 1mL, the polysaccharide solution 1mL and 1mL of various concentration steam Background absorption value of the distilled water as polysaccharide.

Clearance rate calculation formula are as follows:

In formula: A₀For the absorbance of blank control liquid；A_XFor the absorbance after polysaccharide solution is added；A_XOFor color developing agent is not added H₂O₂The absorbance of polysaccharide solution background.

As a result see the A figure in Fig. 7, Yeast-like conidium Thick many candies are to the elimination effect of hydroxyl radical free radical when concentration is 5mg/mL Reach maximum, clearance rate is up to 97%, wherein the IC50 value of two plants of Yeast-like conidiums of Tyc63, Tr01 be respectively as follows: 1.2mg/mL and 1.09mg/mL。

2, elimination effect of the Yeast-like conidium exocellular polysaccharide to ABTs free radical

(Wu Zhenya, 2015) is slightly adjusted referring to the experiment of Wu Zhenya et al., the accurate ABTs solution for configuring 7.0mmol/L And the persulfate aqueous solution of 2.45mmol/L, after taking mixed in equal amounts uniform, room temperature stands 12-16h under the conditions of being protected from light Obtain ABTs⁺Mother liquor.The ABTs that will be obtained⁺Mother liquor is diluted with level-one water, makes its absorbance 0.7 ± 0.023 at 734nm, And 30min is balanced at 30 DEG C, ABTs can be obtained⁺Working solution.2.0mL sample to be tested and 2.0mLABTs are taken respectively⁺Working solution It is added in test tube, after mixing, avoid light place 20min, measures light absorption value under 734nm at room temperature.With deionized water Instead of sample to be tested and ABTs⁺As control after working solution mixing.Setting three parallel, averages.

Sample to be tested is calculated according to the following formula to the elimination effect of ABTs free radical:

In formula: A_SampleIt is the light absorption value after polysaccharide solution and working solution hybrid reaction；A_BlankFor the suction for being not added with polysaccharide solution Light value.

As a result see the B figure in Fig. 7, exocellular polysaccharide is respectively in the range of measured, to the Scavenging activity of ABTs free radical With being positively correlated property of concentration.The clearance rate of Tyc63, Tr01 Thick many candies in higher concentrations 5mg/mL when, clearance rate has reached 90%, IC50 value=2.13mg/mL of Tyc63, IC50 value=1.12mg/mL of Tr01 is calculated.The result shows that Yeast-like conidium is extracellular Thick many candies have the significant ability for removing ABTs free radical, and especially under conditions of high concentration, performance is more protruded.

3, Yeast-like conidium exocellular polysaccharide measures iron ion reducing power

It is modified slightly with reference to the experiment of Zheng Fei et al. (Zheng Fei etc., 2017):

(1) make standard curve: respectively draw 0.5mL concentration be 0.025,0.1,0.15,0.2,0.4,0.5,0.8, 1.0、1.5mmol/L FeSO₄Solution and 0.5mL0.01mol/L TPTZ solution, 5.0mL0.3mol/L Acetic acid-sodium acetate buffer Liquid (pH=3.6) mixing, measures light absorption value, if 3 repetitions, average at 593nm.

With FeSO in reaction system₄The concentration of solution is ordinate, light absorption value is that abscissa makees standard curve, calculates and returns Equation is y=0.5492x-0.003, r²=0.9999, standard curve is as shown in Figure 6.

(2) sample F RAP is measured: light absorption value A of the measurement FRAP working solution at 593nm_{Before reaction}；0.6mL supernatant is added Into 4.5mL FRAP working solution, light absorption value A is measured at 593nm after reacting 8min_{After reaction}；By A_{After reaction}-A_{Before reaction}Difference marking The corresponding FeSO of sample is obtained on directrix curve₄Concentration is defined as FRAP value.With the reaction of deionized water substitution supernatant same volume Mixed liquor is control, if 3 repetitions, average.

In an acidic solution, Fe³⁺-TPTZ(Fe³⁺Three azine of pyridine) it can be restored by the antioxidant in sample, OD₅₉₃There is maximum light absorption at place, and absorbance is directly proportional to the power of sample antioxidant activity.Using iron reduction/anti-oxidant energy Power (FRAP) analytic approach assessment Yeast-like conidium polysaccharide total antioxidant activity result is shown in that the C in Fig. 7 schemes.

By C figure as can be seen that Tyc63, Tr01 Thick many candies referring to VC from the point of view of, all with certain reduced iron ion energy, But it is all more much lower than control group VC.

4, elimination effect of the Yeast-like conidium exocellular polysaccharide to DPPH free radical

With reference to Meng Fanlei et al. experiment be modified slightly (Meng Fanlei etc., 2010) take the polysaccharide sample solution of various concentration with DPPH- ethanol solution is uniformly mixed, after standing 30min, in OD₅₁₇Place's measurement absorbance A i.Removing of the polysaccharide to DPPH free radical Rate may be expressed as:

In formula: A_iAbsorbance after being reacted for DPPH with various concentration polysaccharide solution liquid；A_jFor blank (sample 0.5mL+ 2.5mL95% ethyl alcohol) absorbance；Ac is the absorbance of DPPH solution (2.5mL DPPH+0.5mL dehydrated alcohol)；Setting three Group is parallel, takes its average value.

Each sample scavenging ability of DPPH free radical is using the experimental concentration of sample as abscissa, with corresponding hydroxyl radical free radical Clearance rate is ordinate, finds out equation of linear regression, is found out according to regression equation dense when hydroxyl radical free radical clearance rate is 50% Degree is half clearance rate concentration IC₅₀.And half clearance rate concentration IC₅₀It is smaller, indicate that its Scavenging activity is stronger, i.e. IC₅₀Size and removing Capacity of water is negatively correlated.

As a result see the D figure in Fig. 7, Tyc63, Tr01 Thick many candies are to the elimination effect of DPPH free radical, compared to reference substance VC wants much lower, and wherein Tr01 Thick many candies are to DPPH free radical almost without elimination effect, and Tyc63 Thick many candies reach in concentration When 1mg/mL, elimination effect is most strong, reaches 48%, and later with the increase of concentration, clearance rate declines instead.

The hygroscopicity and moisture retention of 4 exocellular polysaccharide of embodiment

1, the sucting wet experiment of exocellular polysaccharide

It will be by being saturated (NH₄)₂SO₄Aqueous solution is as the drier of relative humidity 81% and by being saturated K₂SO₃Aqueous solution conduct The drier of relative humidity 43% is placed in 20 DEG C of isoperibols, is accurately weighed dry 2 parts of sample to be tested of 1.0g, is respectively placed in Diameter is to be placed in two driers in the crystallising dish of 3cm, and every 12h measures each sample mass, and 48h is arrived in test always.Control group Glycerol is selected, by the of poor quality of placement front and back sample, finds out hydroscopicity with following formula:

Hydroscopicity (%)=100 (m_n-m₀)/m₀

Wherein, m₀Quality before being placed for sample, m_nQuality after being placed for sample.

2, the moisturizing experiment of exocellular polysaccharide

Each polysaccharide sample and reference substance are configured to 5% solution, are placed individually into above-mentioned two drier, every 12h weighs each sample mass, places the of poor quality of front and back sample by continuing, finds out moisturizing rate by following formula:

Moisturizing rate (%)=100m_a/m_b

Wherein, m_bContain water quality, m for sample_aContain water quality for sample after placement.

Test results are shown in figure 8, wherein A: sample hydroscopicity under 83% environment；B: sample moisture absorption under 44% environment Rate；C: sample moisturizing rate D under 83% environment: sample moisturizing rate under 44% environment.It can be seen from the figure that in relative humidity 83%, in the environment of 44%, in the 48h of test, the moisturizing rate of polysaccharide sample and glycerol is being gradually reduced, although polysaccharide sample Relative to glycerol, the decline of moisturizing rate is very fast, but in 48h, still there is 10%, 42% moisture retention.

The exploitation of 5 exocellular polysaccharide Moisturizer of embodiment

With the preparation method of embodiment 2, the exocellular polysaccharide of preparation is moisturizing active constituent, prepares Moisturizer.Preparation Product have 3 kinds, be respectively moisturizing toner, skin-moisturizing, skin cream and moisturizing face cream.

1, the formula of moisturizing toner, skin-moisturizing, skin cream and moisturizing face cream is respectively as shown in table 2 to table 4.

2 exocellular polysaccharide toner formula of table

3 exocellular polysaccharide moisturizing lotion formula of table

4 exocellular polysaccharide moisturizing face cream formula of table

Wherein, moisturizing toner is configured according to the formula in table 2, is paid attention to being sufficiently stirred in operation, be made Each material dissolution is uniform in formula, dispenses up to exocellular polysaccharide toner.

Skin-moisturizing, skin lotion is configured according to the formula in table 3:

(1) first by oily phase heating water bath to 80 DEG C, stirring melts material completely, for use；

(2) equally by heated aqueous to 80 DEG C it is stand-by, and oil is mutually poured into water phase while hot, keeps stirring and emulsus occur, directly 40 DEG C are dropped to temperature；

(3) adding ingredient is added in the sample of stirring and emulsifying several times, will often plus be once stirred evenly sufficiently Emulsification, until adding；It is cooled to room temperature to temperature, stands, bottle to obtain the final product.

Moisturizing face cream is configured according to table 4, and the same moisturizing lotion of concrete operation step is cooled to room temperature to temperature, It stands, bottles to obtain the final product.

The appearance of the moisturizing toner, skin-moisturizing, skin cream and the moisturizing face cream that prepare according to the method described above is as shown in Figure 9.Its In, A is moisturizing；B is moisturizing toner；C is moisturizing face cream.Moisturizing toner appearance is in yellowish, clarification as can be seen from Figure 9 It is transparent, slightly sticky sense；Skin-moisturizing, skin cream is creamy white, and exquisite in texture has mobility；Moisturizing face cream is creamy white, and quality is slightly It is thick and heavy, it is moist.

The finished appearance of preparation is as shown in Figure 10.

2, the physicochemical property detection of moisturizing toner, skin-moisturizing, skin cream and moisturizing face cream

Heat-resisting, cold-resistant, centrifugal stability is carried out to sample according to QB/T2286-1997 and QB/T2660-2004 standard to try It tests.

(1) heat resistant test: sample is placed in (40 ± 1) DEG C insulating box and keeps for 24 hours, restoring to room temperature, observes lotion Sample is whether there is or not obvious Traits change compared with before test, and whether there is or not water-oil separating phenomenons for milky lotion.

(2) low temperature resistant test: Essence, lotion sample are placed in (5 ± 1) DEG C refrigerator and keep for 24 hours, restoring to room temperature Afterwards, whether there is or not obvious Traits changes compared with before test for observation；Milky lotion sample is placed in -20 DEG C of refrigerators and keeps for 24 hours, restoring extremely After room temperature, whether there is or not water-oil separating phenomenons for observation.

(3) centrifugal stability is tested: milky lotion sample being packed into centrifuge tube, is put into 40 DEG C of electro-heating standing-temperature cultivator It is interior, it is moved into centrifuge after keeping 1h, adjusts revolving speed to 2000r/min, be centrifugated 30min, taking out observation, whether there is or not layerings Phenomenon.

After testing, observing, it is found that three kinds of skin care item after above-mentioned processing, do not occur the phenomenon that water-oil separating, It can be seen that three kinds of skin care item samples all have good heat-resisting, cold tolerance, milky lotion and moisturizing face cream centrifugal test do not go out Now it is layered.

The influence of 6 moisturizing toner of embodiment, skin-moisturizing, skin cream and moisturizing face cream to proliferation of human dermal fibroblasts

1, mtt assay surveys the cytotoxicity of moisturizing toner, skin-moisturizing, skin cream and moisturizing face cream

Test cell: HSF cell (human skin fibroblasts)

Cell culture: experiment cell is in logarithmic growth phase 3-8 for cell.Culture medium is that DMEM culture medium (contains 10% fetal calf serum, 100U/mL Benzylpenicillin sodium salt, 100mg/mL streptomycin sulphate), it is incubated at 37 DEG C, in 5%CO2 incubator.Tool Body experiment flow is as follows:

(1) cell recovery: being resuspended cell with 4mL complete medium, be subsequently placed in culture dish and cultivate, and condition of culture is temperature 37 DEG C, 5%CO2,95% air are spent, guarantees enough humidity.

(2) replace cell culture fluid: cell passage after second day, it is necessary to carry out replacement cell culture fluid, then every It carries out within 1-2 days changing liquid.

(3) cell passes on: the pancreatin that 2mL contains 0.25%EDTA is added, HSF cell is digested, digestion time 1- 2min.It when being rounded completely to it, but not completely disengaging wall also, is rapidly added in complete medium and pancreatin, is blown and beaten with suction nozzle thin Cell suspending liquid is drawn in 10mL centrifuge tube by born of the same parents, and 1000r/min is centrifuged 5min, collects cell.Continue addition 4mL to train completely It supports base and blows and beats residual cell, be drawn in new culture dish, continue to cultivate.

(4) bed board: taking the fibroblast of passage exponential phase of growth, carry out skill number with cell counter, with complete culture Keynote ganglion cell's density is 50000/mL, is inoculated on 96 orifice plates, every 100 μ L of hole, outer perimeter holes add PBS buffer solution to close, every hole 100 μ L are added.

(5) be loaded: after culture for 24 hours, drawing old culture solution, addition with complete medium prepares contain each concentration polysaccharide and The culture solution of skin care item, every 100 μ L of hole, every group 6 parallel, and culture is for 24 hours.

(6) MTT experiment tests HSF cell survival rate: after sample-adding effect for 24 hours, discarding culture solution, 90 μ L are added and cultivate completely The 10 μ L of MTT solution of base and 5mg/mL, is placed in CO2 incubator and cultivates 4h；Culture solution is discarded later, and 100 μ L DMSO are added, 10min is shaken, absorbance is measured at OD570.

Cell used in experiment is HSF (human skin fibroblasts), in 37 DEG C, 5%CO₂Normal condition under life Long status is as shown in figure 11.HSF cell volume is larger, and cell outline is unclear, shows elongated, fibrous structure.

MTT (tetramethyl azo azoles salt) method is a kind of sensitive, quick and convenient and fast living biological cell counting method, principle are as follows: Mitochondrial dehydrogenase in living cells MTT is restored to be formed formazan (bluish violet) amount it is directly proportional to viable count.Therefore, pass through Measure OD₅₇₀Under absorbance can reflect the quantity of living cells indirectly.

Using the moisturizing toner of various concentration, skin-moisturizing, skin cream and moisturizing face cream to HSF cytosis for 24 hours after, mtt assay Measure OD₅₇₀, the survival rate of cell is calculated, the result is shown in Figure 12, wherein A figure is Thick many candies to HSF toxic effect；B figure is that moisturizing is refreshing Skin water is to HSF toxic effect；C figure is that skin-moisturizing, skin cream is moisturizing face cream to HSF toxic effect (* table to HSF toxic effect D figure The bright P of significant difference compared with the control group < 0.05；* shows the extremely significant P < 0.01 of difference compared with the control group).

(1) toxic effect of the crude extracellular polysaccharide to HSF cell

The experimental results showed that crude extracellular polysaccharide (0.01mg/mL-0.5mg/mL) in the concentration range of test, thin to HSF The toxicity of born of the same parents is extremely low (A figure), and under low consistency conditions (0.01-0.02mg/mL), difference occurs in the proliferative capacity of HSF cell Degree is higher than control group, shows that it has facilitation to the growth of HSF cell.When Thick many candies concentration gradually rises, HSF is thin The relative survival rate of born of the same parents is declined slightly, but difference is not significant (P > 0.05) compared with the control group, therefore can be proved extracellular thick more Sugar is extremely low to the toxicity of HSF cell.

(2) toxic effect of moisturizing toner, skin-moisturizing, skin cream and moisturizing face cream to HSF cell

The experimental results showed that add the moisturizing skin toner Aquaponic HSF cell of basic, normal, high mass concentration, proliferative capacity with Control group, which is compared, does not occur significant change (P > 0.05).

Using basic, normal, high mass concentration skin-moisturizing, skin cream culture HSF cell when, low (0.01-0.05mg/mL), in Under (0.1-0.5mg/mL) dosage, have significant facilitation (P < 0.05) to the proliferation of HSF cell, 0.01,0.02, 0.1,0.2, under 0.3mg/mL concentration, effect is extremely significant (P < 0.01).At high dose (1-2mg/mL), to HSF cell It acts on unobvious (P > 0.05), without apparent promotion, inhibiting effect.

Using basic, normal, high mass concentration moisturizing face cream culture HSF cell when, when its concentration is in 0.1,0.2mg/mL, There is significant facilitation (P < 0.05) to HSF cell, concentration is that facilitation effect is extremely significant (P < 0.01) in 0.05mg/mL. Under high dose, to the inhibiting effect of HSF cell compared with the control group without significant difference.

According to the criterion of European Union's laboratory cosmetics toxicity, IC₅₀When >=1.5mg/mL, show that cosmetics toxicity is minimum Or nothing, IC₅₀When < 1.5mg/mL >=0.5mg/mL, show that cosmetics toxicity is medium, IC₅₀When < 0.5mg/mL, show cosmetics Toxicity is stronger.Moisturizing toner, skin-moisturizing, skin cream, moisturizing face cream in this experiment, in addition high dose (1-2mg/mL) Under culture, the relative survival rate of HSF cell is above 80%, therefore can prove three kinds of skin care item no cytotoxicities or toxicity pole It is small.

2, moisturizing toner, skin-moisturizing, skin cream and the moisturizing face cream protective effect to the HSF cell of UVB induction respectively

(1) UVB causes the building of HSF cell ageing model

1. the recovery of HSF cell, passage, the same abovementioned steps of bed board (1) (2) (3) and (4)；

2. UVB inducing cell aging: after culture for 24 hours, discarding script culture solution, the PBS of 100 μ L, blank group is added in every hole It is wrapped with masking foil, model group carries out UVB irradiation, and the distance between UVB radiation source and cell are 5cm, uses ultraviolet radioactive Meter measurement intensity is 330 μ W/cm2, and choosing irradiation time is 1min, 2min, 3min, 4min；

3. after the completion of irradiation, deducting PBS solution, complete medium is added, continues to be incubated for 2h, 10 μ L are added in every group of every hole 100 μ L DMSO are added after MTT, 4h dissolves crystallization in concussion 10min on 37 DEG C of shaking tables, finally, using microplate reader in OD570 Place checks the activity of cell.

HSF cell is induced using UVB, experimental result is as shown in figure 13: compared with blank control group, irradiation 1min, 2min, 3min, 4min have extremely significant inhibiting effect (P < 0.05) to HSF cell, and cell survival rate is successively are as follows: 78%, 76.8%, 76.1%, 75.9%.With the increase of irradiation time, UVB is stronger to the inhibitory effect of cell, therefore shows UVB causes HSF (human skin fibroblasts) damage model to construct successfully.

(2) protective effect of 3 kinds of skin care item to the UVB HSF cell induced is tested

The treatment process of experimental group is same as above, the difference is that, in 2. step, after culture for 24 hours, shone carrying out UVB irradiation Before penetrating, it is separately added into certain density moisturizing toner, skin-moisturizing, skin cream or moisturizing face cream, after being added for 24 hours, absorbs culture medium, It is cleaned 2 times with PBS liquid, and spreads a thin layer PBS liquid, irradiated according still further to UVB irradiation is carried out in 2. step, 2 parallel UVB fluorescent tubes are UVB light source is 330 μ W/cm with ultraviolet radioactive meter measurement intensity apart from cell 5cm², irradiation time 120s, UVB irradiate agent Amount is 40mJ/cm².After irradiation, the culture medium sopped up originally is rejoined in each hole, continues to cultivate；Then according to upper State the activity of method detection cell.

Each processing group details are shown in Table 5, and the skin care item in table 5 refer to moisturizing toner, skin-moisturizing, skin cream or moisturizing One of face cream.

Table 5 tests 3 kinds of skin care item to the grouping situation of the UVB HSF impact cell induced

Experimental result is as shown in figure 14: UVB model group is compared with blank control group (not illumination is not added with skin care item), phase (P < 0.01) is significantly reduced to survival rate, shows model success.

Each experimental group of crude extracellular polysaccharide is added to compared with UVB model group, dosage is in 0.01,0.02mg/mL, phase To survival rate and UVB control group significant difference (P < 0.05), this shows that under low dosage, crude extracellular polysaccharide has one to HSF cell Fixed protective effect.

Each experimental group of exocellular polysaccharide toner is added to compared with UVB model group, dosage is in 0.1,0.2,0.3mg/mL When, relative survival rate is significantly higher than UVB model group.It is added to each experimental group of exocellular polysaccharide milky lotion, dosage is in 0.05mg/ It is significantly higher than UVB model group when mL, later with the raising of concentration, relative survival rate is declined slightly, but is still higher than UVB model Group.Each experimental group of exocellular polysaccharide moisturizing face cream is added, relative survival rate is above UVB model group, and in this dosage range Interior, with the increase of concentration, raising trend is presented in relative survival rate, and wherein the relative survival rate of 0.5mg/mL group is significantly higher than UVB model group (P < 0.05).

The relative survival rate and blank control group difference of sample controls group (being added to three kinds of skin care item without polysaccharide) are aobvious It writes, with UVB model group without significant difference, this is the result shows that protect HSF cell from the substance of UVB damaging action from born of the same parents Exo polysaccharides, rather than the other compositions in skin care item.

The physicochemical property and structural analysis of 7 Yeast-like conidium exocellular polysaccharide of embodiment

The exocellular polysaccharide separated after being fermented using Tyc63 tests its pear flower property and structural analysis as research object.

One, Yeast-like conidium exocellular polysaccharide isolates and purifies research

Yeast-like conidium exocellular polysaccharide isolates and purifies process: according to exocellular polysaccharide → agar of the process preparation in embodiment 2 Sugared gel chromatography → eluent → dialysis → reduced pressure → 3V ethyl alcohol precipitating polysaccharide → precipitating → gel chromatography → elution The extracellular refined polysaccharide of Yeast-like conidium of liquid → reduced pressure → 3V ethyl alcohol precipitating polysaccharide → vacuum freeze drying → uniform.

1, the specific steps of Sevage method removing protein:

(1) Thick many candies for weighing certain mass are stirred evenly with deionized water dissolving, are placed in 60 DEG C of water-baths sufficiently Then dissolution is centrifuged 15min in 8000r/min room temperature, collect supernatant；

(2) the Sevage reagent (chloroform: n-butanol=4:1) of its volume 1/3 is added into Thick many candies solution in oscillator Upper strong mixing concussion 15min, is put into shaking table later, and revolving speed is adjusted to 250r/min concussion 15min, later in 4000r/min It is centrifuged 15min, water layer is obtained and removes intersection denatured protein.Repeatedly (at least three times), reagent layer is handed over after centrifugation There is no white precipitate to occur illustrating that protein removes completely substantially at boundary.

2, DEAE-Sepharose Fast Flow exchanges column chromatography

The filling of gel chromatography column:

(1) selection and processing of gel: pass through Suction filtration device for gel DEAE-Sepharose Fast with deionized water Alcohol Protection liquid in Flow is rinsed well, is added a small amount of deionized waters, ultrasonic degassing 30min, spare；

(2) filling of chromatographic column: the glass chromatography column of selection (2.5 × 30cm), the DEAE-Sepharose being swollen Chromatographic column is added in Fast Flow gel, and after allowing gel natural subsidence 12h, isogel all to settle, Primary plateaus weighing apparatus elution is added 24h。

Sample isolates and purifies:

(1) exocellular polysaccharide is configured to the solution of 10mg/mL, after the micro-pore-film filtration with 0.45 μ L, from chromatographic column top It is adherent to be slowly added to, it is careful not to destroy filler interface, primary sample-adding amount is 5mL；

(2) after being loaded, de-, distribution collection is first washed with deionized water, collects within every ten minutes a pipe, every pipe collects 10mL, stream Fast 1mL/min；

(3) phend-sulphuric acid measures each pipe polyoses content, with the absorbance at microplate reader detection OD490, is eluted to always There is no color reaction appearance；The NaCl progress gradient elution for using 0.1,0.3,0.5mol/L instead later, continues fraction collection, with same Quadrat method identifies polyoses content, and merges same composition, is concentrated.It is abscissa with collecting pipe number number, light absorption value A is ordinate, Draw DEAE-Sepharose Fast Flow gel exchange column elution curve.

(4) flowing water is dialysed

Bag filter: being cut into the segment of 20cm or so by bag filter pretreatment, level-one water is added, be boiled by fire 30min, later It is thoroughly cleaned, can be used with level-one water again.

Dialysing, early period is primary every 1h replacement deionized water, and the later period is primary every 6h replacement deionized water.It is taken out after 72h, It is placed in pre-freeze 30min in -80 DEG C of refrigerators, the dry 36h in freeze drier, wait be further purified.

(5) cleaning and storage of ion-exchanger: medium is taken out from pillar, with the NaCl solution of 2mol/L and The mixed liquor of the NaOH of 0.1mol/L is cleaned, and five column volumes are eluted, and is used deionized water instead later and is eluted ten column volumes. It crosses long-time when not used, need to be filtered, kept dry is in 4 DEG C of environment.

As a result: by DEAE-Sepharose Fast Flow exchange column chromatography initial gross separation after, through deionized water, After 0.1mol/L, 0.3mol/L and 0.5mol/L NaCl gradient elution, available 4 fractions, respectively TPF-1, TPF-2, TPF-3 and TPF-4, elution curve are as shown in figure 15.Wherein 0-23 pipe is the TPF-1 that deionized water affords；24-44 pipe is The TPF-2 that 0.1mol/L NaCl is afforded；45-67 pipe is the TPF-3 that 0.3mol/L NaCl is afforded；68-83 pipe is The TPF-4 that 0.5mol/L NaCl is afforded.

Peak area of each component in figure is bigger, and content is more, and the content that deionization washes polysaccharide TPF-1 is most, TPF-4 Content it is minimum and collect time-consuming, it is contemplated that the feasibility of subsequent experimental, therefore do not collect.Therefore collection TPF-1, TPF-2, The eluent of this three parts of TPF-3 carries out sephadex chromatography after concentrate drying.Polysaccharide TPF-1, TPF- as can be known from Fig. 15 The content ratio of 2 and TPF-3 be 2.1~2.2:0.7~0.9:1.7~1.9, by quantitative determination, determine the content ratio of three For 2.2:0.8:1.8.

3, Sephadex G-100 sephadex chromatography column chromatography

Polysaccharide component realizes initial gross separation in DEAE-Sepharose Fast Flow gel exchange column, but due to it There may be differences for the distribution of molecular weight and structure, it is therefore desirable to carry out grinding for further fine structure with dextran chromatography column Study carefully.

The filling of gel chromatography column:

(1) selection and processing of gel: by gel Sephadex G-100 water floatation, remove in glucan not at Grain, broken monomer.Then, 30 times of volume mass ratio (mL/g) deionized waters are added in selected particle, immersion makes for 24 hours It is sufficiently swollen；

(2) filling of chromatographic column: the glass chromatography column of selection (1.6 × 30cm), wet method dress post, then use deionized water balance It is spare for 24 hours；

(3) learn from else's experience the isolated various polysaccharide solution 2.0mL of DEAE-Sepharose Fast Flow gel exchange column, It after 0.45 micrometer Millipore membrane filtration, is added in pillar, is careful not to destroy filler interface, primary sample-adding amount is 5mL；

(4) after being loaded, de-, distribution collection is washed with deionized water, collects within every ten minutes a pipe, every pipe collects 10mL, flow velocity 1mL/min；

(5) phend-sulphuric acid measures each pipe polyoses content, with the absorbance at microplate reader detection OD490, is eluted to always There is no color reaction appearance.Sephadex G-100 sephadex column elution curve is drawn, is abscissa, extinction with pipe number number Value A makees ordinate.

The cleaning and storage of gel:

Five column volumes are eluted with the NaOH solution of 1mol/L, use soaking and washing after should taking out medium after repeatedly.It crosses For a long time when not used, it need to be soaked in 20% ethanol solution, be saved in 4 DEG C of environment.

As a result: after purification through Sephadex G-100 Gel-filtration, being eluted through deionized water, it is bent to obtain elution Line is shown in Figure 16.As can be seen that a single elution can be obtained in three kinds of refined polysaccharides TPF-1, TPF-2, TPF-3 after purification Peak, this shows that TPF-1, TPF-2, TPF-3 are uniform polysaccharide in molecular weight distribution.Corresponding eluent is collected, after concentration Freeze-drying obtains the extracellular refined polysaccharide of Yeast-like conidium, but amount is less, therefore follow-up test is to grind with TPF-1, TPF-2, TPF-3 Study carefully object progress.

The outside drawing of 3 kinds of single polysaccharides TPF-1, TPF-2, TPF-3 that the above process obtains are as shown in figure 17.Wherein, TPF-1 is White Flocculus, and TPF-2, TPF-3 are loose white mesh.Three kinds of polysaccharide are easy to moisture absorption without special odor The moisture absorption, soluble easily in water, insoluble in organic solvents such as methanol, ethyl alcohol, acetone and n-butanols, high concentration solution is in thick.

Two, the Purity of the polysaccharide obtained by above process separation, after purification

1, gel permeation chromatography

It takes each polysaccharide sample eluting peak a little respectively, is concentrated into 2-3mg/mL, carry out Sephadex G-100 gel again Filtration chromatography.The same aforementioned process of operating condition.

2, ultraviolet spectral analysis

The polysaccharide sample after isolating and purifying for accurately weighing constant weight amount, is made into 1.5mg/mL's with deionized water respectively Solution in wavelength is to be scanned within the scope of 250-800nm with ultraviolet specrophotometer.

As a result: 1, respectively by the aqueous solution of TPF-1, TPF-2, TPF-3, detected respectively under ultraviolet specrophotometer its 220, the 260, absorbance under 280nm wavelength illustrates to be free of protein and nucleic acid in sample as a result as Figure 18 show no absorption peak Substance.

2, Sephadex G100 gel filtration will be carried out again after above-mentioned gained polysaccharide TPF-1, TPF-2, TPF-3 concentration As a result as shown in figure 19 there is obvious main peak and single right through polyoses content in phend-sulphuric acid measurement collection liquid in chromatography Claim, it can be said that polysaccharide obtained by bright purifying is one-component.

Three, the monosaccharide composition analysis of Yeast-like conidium exocellular polysaccharide

1, the hydrolysis of polysaccharide

TPF-1, TPF-2, TPF-3 polysaccharide 15mg are weighed respectively, 2mol/L trifluoroacetic acid 2mL is added, and are hydrolyzed in 100 DEG C 8h, take out it is cooling after, be concentrated to dryness, obtain monosaccharide be placed in it is spare in drier.

2, the preparation of sample to be tested

Water intaking solution, it is dry after polysaccharide 5mg, be added hydroxylamine hydrochloride 10mg, pyridine 0.5mL is placed in 90 DEG C of baking ovens 30min, taking-up let cool to room temperature, aceticanhydride 0.5mL are added, 30min is placed in 90 DEG C of baking ovens, and dry, use is decompressed to after taking-up Chloroform 1mL dissolution, it is spare.

3, the preparation of monosaccharide reference substance derivative

Precision weighs reference substance rhamnose, arabinose, xylose, mannose, galactolipin, fucose, and glucuronic acid is each 5mg is separately added into 10mg hydroxylamine hydrochloride, handles according to method under " (2) " item, is dissolved with 5mL chloroform, spare.It takes and has made respectively Each 1.0mL of the monosaccharide derivatives got ready, to get standard monosaccharide derivatives mixed liquor after mixing.

4, chromatography column condition

By, using GC-MS analysis measurement, specific testing conditions are as shown in the table after the derivative saccharogenesis nitrile acetonyl ester of each monosaccharide.

5, standard curve making

Accurate measurement standard monosaccharide derivatives mixed liquor 1.5,1.8,2.0,4.0,8.0mL is set respectively in 10mL measuring bottle, is used Chloroform is diluted to scale, shakes up to get serial monosaccharide reference substance solution.Accurate respectively to draw 1 μ L, injection gas chromatograph is surveyed It is fixed, each concentration replication 3 times.Measurement result with the concentration (mg/mL) of each component be abscissa, using peak area as ordinate Mapping.

6 GPC-RI-MALS testing conditions of table

As a result: the method that this experiment utilizes derivatization combination GC-MS forms the monosaccharide of TPF-1, TPF-2, TPF-3 Analysis concrete outcome is carried out as shown in Figure 20,21, wherein Figure 20 is the GC-MS chromatogram for mixing derivative monosaccharide A, and 1 is sandlwood Sugar；2 be arabinose；3 be fucose；4 be xylose；5 be mannose；6 be glucuronic acid；7 be galactolipin；Figure 21 is extracellular The GC-MS chromatogram of polysaccharide TPF-1, TPF-2, TPF-3；B figure is TPF-1 chromatogram, and 1 is fucose；2 be xylose；3 be sweet dew Sugar；4 be glucuronic acid；C figure is TPF-2 chromatogram, and 1 is rhamnose；2 be arabinose；3 be mannose；4 be grape alditol Acid；5 be galactolipin；D is TPF-3 chromatogram, and 1 is rhamnose；2 be arabinose；3 be mannose；4 be glucuronic acid；5 are Galactolipin.

According to calculated by peak area, it is known that the composition ratio of its monosaccharide: TPF-1 is mainly by fucose, xylose, mannose, Portugal Grape uronic acid composition, the molar ratios of several monosaccharide are 9.25:23.4:16.05:37.1, and wherein glucuronic acid proportion is most Greatly, xylose takes second place, and is free of rhamnose and arabinose, and monosaccharide ratio is relatively easy.

TPF-2 is mainly made of fucose, xylose, mannose, glucuronic acid and galactolipin, and proportion is 1.78:9.55:12.63:128.59:13.91。

TPF-3 is mainly made of rhamnose, xylose, mannose, glucuronic acid and galactolipin, and respective proportion is 3.8:30.78:52.78:12.73:14.6, compared with TPF-1, monosaccharide contained in TPF-2, TPF-3 is relative complex.

Table 7TPF-1, TPF-2, TPF-3 monosaccharide composition

In the contents of monosaccharides of TPF-1 and TPF-2, ratio shared by glucuronic acid is maximum.Wherein, glucuronic acid content The antioxidant activity of height and polysaccharide is positively correlated, and mannose proportion is maximum in TPF-3, remaining monosaccharide residue proportion It is not much different, thus the main chain of deducibility TPF-1, TPF-2 may be the acid heteroglycan using glucuronic acid as main chain, simultaneously Containing multiple branches, and the main chain of TPF-3 may be the acid heteroglycan that mannose is main chain.

Four, the molecular weight analysis of TPF-1, TPF-2, TPF-3

TPF-1, TPF-2, TPF-3 are measured using GPC-RI-MALS (gel chromatography-shows difference-multi-angle laser light scattering) Weight average molecular weight, number-average molecular weight and molal weight dispersion degree it is as shown in table 8 below, GPC-RI-MALS map is respectively Shown in Figure 22,23 and 24.

The molecular weight of table 8 TPF-1, TPF-2, TPF-3

The weight average molecular weight of TPF-1, TPF-2, TPF-3 are respectively 5189kDa, 171.6kDa, 661kDa.Wherein, it utilizes The TPF-1 component that ultrapure water is eluted out has maximum molecular weight, and TPF-3 takes second place, and the molecular weight of TPF-2 is minimum, this time real It tests result to also indicate that, using the NaCl solution of various concentration, micromolecular polysaccharide can be eluted.And according to Mw/Mn's Ratio can be seen that being unevenly distributed for TPF-2, and the distribution of TPF-3 is more uniform.Utilize GPC-RI-MALS (gel color Compose-show difference-multi-angle laser light scattering) system can directly determine the radius of turn of polysaccharide, wherein TPF-1 and TPF-3 Shown in radius of turn table 8 as above.Since the molecular weight of TPF-2 is too small, fail to detect its radius of turn.

Configuration of the polysaccharide in different solvents is analyzed according to Conformation Plot, as shown in Figure 25,26 and 27 (point Not Wei TPF-1, TPF-2 and TPF-3 molecular configuration map): with log (Molar Mass) for abscissa, with log It (R.M.S.Radius) is ordinate, slope can reflect high molecular molecular configuration.According to this 3 width map analysis it is found that TPF-1, TPF-2, TPF-3 are with tight structure containing branched polymer.

Five, infrared spectroscopy (FTIR) analysis of TPF-1, TPF-2 and TPF-3

1mg polysaccharide sample mixing 100mg KBr is weighed, is ground to powdered, then tabletting analysis in the agate mortar.It surveys Measure infrared range of spectrum 4000cm^-1-400cm^-1.Measure result such as table 9 and Figure 28,29 and 30 (respectively TPF-1, TPF-2 and The IR spectrum scanning figure of TPF-3) shown in.

The results of FT-IR of table 9 TPF-1, TPF-2, TPF-3 are analyzed

The 3370.13cm in the infrared spectroscopy of sample TPF-1, TPF-2^-1、3369.84cm^-1There is a width Qiang Feng, is O-H The absorption peak of stretching vibration shows that there are intermolecular and intramolecular hydrogen bonds；2931.29cm^-1、2929.80cm^-1It is the flexible vibration of C-H Dynamic absorption peak；1646.62cm^-1、1645.70cm^-1It is the absorption peak of O-H bending vibration；1424.91cm^-1、1415.62cm^-1 It is the absorption peak of C-H bending vibration.1200cm^-1-900cm^-1Region has several strong and wide peak, is C-O stretching vibration Absorption peak；This several groups of peaks can tentatively judge that the sample is polysaccharide compound.

TPF-1, TPF-2 sample are in 1100cm^-1-1010cm^-1In region, only there are 2 peaks, can prove to should be furans Glucosides；934.66cm^-1、932.86cm^-1It is the characteristic absorption peak of carbohydrate molecule vibration, is ɑ-type absorption peak of saccharide ring； 765.05cm^-1、762.99cm^-1It is saccharide ring extensional motion ɑ-type absorption peak, illustrates that sample is ɑ-type polysaccharide.

The 3396.00cm in the infrared spectroscopy of sample TPF-3^-1There is a width Qiang Feng, be the absorption peak of O-H stretching vibration, Show that there are intermolecular and intramolecular hydrogen bonds；2931.70cm^-1It is the absorption peak of C-H stretching vibration；1612.49cm^-1It is O-H curved The absorption peak of Qu Zhendong；1418.35cm^-1It is the absorption peak of C-H bending vibration.1200cm^-1-900cm^-1Region has several Strong and wide peak is the absorption peak of C-O stretching vibration；This several groups of peaks can tentatively judge that the sample is polysaccharide compound； 1100cm^-1-1010cm^-1Only there are 2 peaks in region, should be furanoside；895.13cm^-1It is the feature suction of carbohydrate molecule vibration Peak is received, is β-type absorption peak of saccharide ring；768.43cm^-1It is saccharide ring extensional motion β-type absorption peak, illustrates that sample is β-type polysaccharide.

Six, Congo Red test

6 parts of polysaccharide sample, every part of 3mg or so are accurately weighed, 2.0mL deionized water, 80 μm of ol/L is added thereto respectively Congo red reagent 2.0mL, mix well.Then it is appropriate that 1.0mol/L NaOH is added, distinguishes the NaOH concentration in mixed liquor It for 0.0,0.1,0.2,0.3,0.4 and 0.5mol/L, mixes well and stands 5min, UV-vis spectroscopy is used in deionized water zeroing Photometer is scanned sample in 400-800nm, measures the maximum absorption wavelength of mixed liquor under different NaOH concentrations.Blank pair According to sample is not added, add equal amount deionized water, Congo red and NaOH solution, ibid method measures the maximum of different NaOH solutions and inhales Receive wavelength.

Pass through comparison sample liquid and blank maximum absorption wavelength situation of change.Under normal circumstances, with NaOH concentration from as low as Height, if institute's sample possesses triple helix structure, the maximum absorption wavelength of sample liquid will appear as first increasing reduces situation afterwards, if Sample does not have triple helix structure, essentially identical with blank variation tendency.

Test result is as shown in figure 31.As seen from the figure, TPF-1, TPF-3 and the Congo red maximum absorption wave for forming complex compound Long that red shift occurs compared with Congo red, when NaOH concentration is from 0.0mol/L to 0.1mol/L, UV absorption shifts to long wave, this table Bright sample can have well-regulated three helical conformation with Congo red formation complex compound；When NaOH concentration continues to increase, absorption maximum Wavelength is begun to decline, and shows that the helical structure in polysaccharide is destroyed, and becomes random ball of string mode.And TPF-2 maximum is inhaled The variation tendency for receiving wavelength is similar with blank control group, it can thus be assumed that the two cannot react to form complex compound, i.e. TPF-2 In three helical conformations may be not present.

Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than protects to the present invention The limitation of shield range can also be made on the basis of above description and thinking for those of ordinary skill in the art Other various forms of variations or variation, there is no necessity and possibility to exhaust all the enbodiments.It is all of the invention Made any modifications, equivalent replacements, and improvements etc., should be included in the protection of the claims in the present invention within spirit and principle Within the scope of.

Sequence table

<110>Agricultural University Of South China

<120>a kind of skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide

<150> 2018112446100

<151> 2018-10-24

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 502

<212> DNA/RNA

<213>Yeast-like conidium Tyc63 (Tremella fuciformis Tyc63)

<400> 1

aacaaggttt ccgtaggtga acctgcggaa ggatcattag agatgccgaa aggcttatcc 60

aaacacctgt gcacatcgga ccgcgccccc gggccgggcc gctttcacac aaacgcatgt 120

cacgaacgta atgcatcata acatgaaaca actttcaaca acggatctct tggctctcgc 180

atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca 240

tcgaatcttt gaacgcacct tgcgcctttt ggtattccga aaggcatgcc tgtttgagtg 300

tcatgtagac tcaacccccc gggtttctga cccggcggtg ttggatttgg gccctgcctc 360

ccccggctgg ccttaaatgc gttagtggtt tcacgcagac gtcgtaagtt acgcgtcgac 420

tgtgggccgc tcacaacccc ccctactttt gcactctgac ctcaaatcag gtagggctac 480

ccgctgaact taagcatatc aa 502

Claims (10)

1. a kind of skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide, which is characterized in that include the silver prepared by following methods Ear bud spore exocellular polysaccharide: taking the supernatant of Yeast-like conidium fermentation liquid, and the dehydrated alcohol precipitating of 3 times of volumes is added；It then will precipitating It takes supernatant to remove removing protein with Sevage method after being dissolved in water, is centrifuged to obtain supernatant, add the ethyl alcohol precipitating of 3 times of volumes, sink Form sediment it is freeze-dried after can be prepared by Yeast-like conidium exocellular polysaccharide.

2. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 1, which is characterized in that the moisturizing profit The quality accounting of Yeast-like conidium exocellular polysaccharide is 0.5%~2% in skin cream；Preferably, Yeast-like conidium in the skin-moisturizing, skin cream The quality accounting of exocellular polysaccharide is 1%.

3. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 1, which is characterized in that the tremella bud Spore bacterium is Tremella fuciformis Tyc63 and/or Tr01.

4. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 2, which is characterized in that the moisturizing profit Skin cream contains the ingredient of following mass percent: oily phase 20~30%, water 60~70%, glycerol 5~8%, Yeast-like conidium is extracellular Polysaccharide 0.5~2%, outstanding horse bp0.5~1.5%.

5. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 3, which is characterized in that the moisturizing profit Skin cream contains the ingredient of following mass percent: oily phase 27%, water 65%, glycerol 6%, Yeast-like conidium exocellular polysaccharide 1%, outstanding horse Bp1%.

6. the skin-moisturizing, skin cream according to claim 4 or 5 containing Yeast-like conidium exocellular polysaccharide, which is characterized in that described Oily mutually be olive emulsifying wax, Sweet Almond Oil, wheat-germ oil and fat soluble vitamin E according to mass ratio is that 10:7:7:3 is formed.

7. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 1, which is characterized in that the Sevage Method goes the detailed process of removing protein are as follows:

S1. the Thick many candies for weighing ethanol precipitation, add water sufficiently to dissolve, and supernatant is collected by centrifugation；

S2. the Sevage reagent of its volume 1/3 is added into supernatant, in 15min, Zhi Houfang are shaken in mixing strongly on oscillator Enter in shaking table, revolving speed is adjusted to 250r/min concussion 15min, is centrifuged 15min in 4000r/min later, obtains water layer removal and has a common boundary Locate denatured protein；

S3. in triplicate, reagent layer intersection does not have white precipitate to step S2 after centrifugation.

8. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 7, which is characterized in that thick in step S1 Polysaccharide can heat abundant dissolution, and heating temperature is 60 DEG C；The revolving speed of the centrifugation is 8000r/min, centrifugation time 15min； Sevage reagent is made of by volume for 4:1 chloroform and n-butanol in step S2.

9. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 1, which is characterized in that the tremella bud Contain polysaccharide TPF-1, TPF-2 and TPF-3 in spore exocellular polysaccharide, wherein the molecular weight of TPF-1 is 5189kDa, by fucose, wood Sugar, mannose, glucuronic acid are that 9.25:23.4:16.05:37.1 is formed with molar ratio；The molecular weight of the TPF-2 is 171.6kDa with molar ratio is 1.78:9.55:12.63 by fucose, xylose, mannose, glucuronic acid and galactolipin: 128.59:13.91 composition；The molecular weight of TPF-3 is 661kDa, by rhamnose, xylose, mannose, glucuronic acid and gala Sugar is that 3.8:30.78:52.78:12.73:14.6 is formed with molar ratio.

10. the skin-moisturizing, skin cream containing Yeast-like conidium exocellular polysaccharide according to claim 2, which is characterized in that the tremella The content ratio of polysaccharide TPF-1, TPF-2 and TPF-3 are 2.1~2.2:0.7~0.9:1.7~1.9 in gemma exocellular polysaccharide.