CN109943632A - Application and kit of the hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker - Google Patents

Abstract

The present invention relates to the microRNA markers of screening acute high altitude reaction susceptible person a kind of, application of the microRNA hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker can apply in the reagent or kit of preparation screening acute high altitude reaction susceptible person.A kind of kit detected by real time fluorescence quantifying PCR method to hsa-miR-1183 molecule in the blood plasma of subject person Plain is more provided, and predicts acute high altitude reaction onset risk by the height of its expression.The features such as microRNA has high specificity as molecular marker, and high sensitivity is non-invasive, convenience, is suitble to carry out the screening of extensive acute high altitude reaction susceptible person in Plain.

Description

Hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker application and Kit

Technical field

The invention belongs to molecular biotechnology and its application fields, and the present invention relates to hsa-miR-1183 as Acute Altitude Application and the kit for reacting susceptible person's molecular marker, pass through the acute height of Plain blood plasma hsa-miR-1183 expression screening Original reaction onset risk.For evaluation human body is to the neurological susceptibility of acute high altitude reaction, people is reduced because acute high altitude reaction is sent out Sick risk.

Background technique

Acute high altitude reaction (acute mountain sickness, AMS), be occur it is long-term with moving in low altitude area The people from Plain in area rapidly enters 1-3 days behind plateau in the case where not shaking down and generates, including headache, dizziness, fatigue, The a series of symptoms such as insomnia, mood uneasiness, flatulence, diarrhea and vomiting, wherein violent headache is the classical symptom of AMS. Height above sea level is higher than 500m on geography, topography relatively flat or has the wide area centainly to rise and fall to cry plateau, it medically will be extra large The place in 2500-3000m is lifted plateau.AMS disease incidence is higher, according to the difference of the rate of climb and specific height above sea level, morbidity Rate may be up to 50% to 85% (Bartsch P.and Swenson E.R., Clinical practice:Acute high- Altitude illnesses. " The New England Journal of Medicine ", 2013,368 (24), 2294- 302.).Its harmfulness is big, can not only seriously affect the work and life ability of Acute Exposed Altitude people from Plain, more seriously, if AMS is not controlled effectively and treats, it is likely that develops into the plateau brain edema (Boos with high lethality rate C.J.et al.,High Altitude and Acute Mountain Sickness and Changes in Circulating Endothelin-1,Interleukin-6,and Interleukin-17a.《High Altitude Medicine&Biology》,2016,17(1),25-31.)。

AMS has apparent genetic predisposition and private medical service, and the environmental factor and inherent cause of plateau hypobaric hypoxia are equal It can influence the generation of AMS.For many years, the genetic predisposition of AMS and private medical service are always what domestic and foreign scholars paid close attention to Hot spot is although it is proposed that use hypoxemia related gene EGLN1, HIF-1AN, NOS₃Etc. SNP sites to AMS Susceptible population Predicted, but at present apparently these markers accuracy and in terms of all it is not fully up to expectations (Luks A.M., Swenson E.R., Bartsch P., Acute high-altitude sickness. " European respiratory review:an official journal of the European Respiratory Society》,2017,26 (143)).And the high original area in China is vast (account for about national territorial area 1/5), and height above sea level is higher that (Qinghai-Tibet mean sea level exists 4000 meters or more).In recent years since, with flourishing for domestic and international highland tour's industry and plateau economic construction, more and more People from Plain enters plateau, and the high-incidence of AMS not only causes extremely serious influence to their life and work, but also also to height The more fragile health organ of original area causes heavy burden.So urgently search out Plain to the Gene susceptibility of AMS into The effective ways of row prediction.

MicroRNA is that one kind is widely present in eucaryote, and length is the non-coding RNA point of 18~24 nucleotide Son.MicroRNA inhibits the expression of target gene by post-transcriptional level, and it is living to participate in the life such as regulating cell differentiation, proliferation, apoptosis It is dynamic, it plays a significant role in a variety of physiology such as embryonic development, organism metabolism, disease development and pathologic process.In recent years, Researcher detects microRNA in a variety of body fluid such as blood, saliva, urine, proposes the concept of circulation microRNA.And And the height of the expression of microRNA and its genetic otherness are highly relevant.It is appreciated that in recent years, It is a large amount of that a series of diagnosis in advance of tumour, hypertension, stroke and diseases and morbidity are predicted studies have shown that recycling microRNA There are specificity and sensibility well.Furthermore the humoral specimens such as blood are easily obtained, clinical strong operability and traumatic small, And circulation microRNA stability is good, detection convenience, and therefore, circulation microRNA, which has, is used as the non-invasive biological marker of AMS The potential of object is suitable for AMS neurological susceptibility Mass screening (Toffolo K., Wang J.et al., Circulating microRNAs as biomarkers in traumatic brain injury.《Neuropharmacology》,2018.)。 And at present about the correlation between circulation microRNA and AMS neurological susceptibility, it is rarely reported.

Summary of the invention

In view of this, the purpose of the present invention is to provide that the present invention relates to hsa-miR-1183 is easy as acute high altitude reaction The application of sense person's molecular marker also provides a kind of agent box of screening acute high altitude reaction susceptible person examination, passes through Plain blood plasma Hsa-miR-1183 expression screening acute high altitude reaction onset risk.For evaluation human body is to acute high altitude reaction Neurological susceptibility reduces people because of acute high altitude reaction onset risk.

In order to achieve the above objectives, the invention provides the following technical scheme:

Application of the 1.hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker.

Further, the sequence of the hsa-miR-1183 is as shown in SEQ ID NO:1.

Further, the hsa-miR-1183 nucleic acid molecules are in the expression in target blood plasma compared with the expression in control blood plasma It is lowered.

Further, the application is preparing screening Acute Altitude as microRNA molecule marker for hsa-miR-1183 It reacts and is applied in the reagent or kit of susceptible person.

2. anxious as the screening of the application preparation of acute high altitude reaction susceptible person's molecular marker according to hsa-miR-1183 Property altitude sickness susceptible person's kit, the kit include can respectively with hsa-miR-1183 reverse transcription product specificity knot Merge the primer for carrying out PCR amplification.

Further, the primer includes forward primer and reverse primer, forward primer sequence as shown in SEQ ID No.15, Reverse primer sequences are as shown in SEQ ID No.16.

Further, the sequence of the hsa-miR-1183 is as shown in SEQ ID NO:1.

Further, the hsa-miR-1183 nucleic acid molecules are in the expression in target blood plasma compared with the expression in control blood plasma It is lowered.

Further, the kit further includes miRNA RT reaction system, and the miRNA RT reaction system presses every 10ul Meter, comprising: reverse transcriptase primer 1ul, 5x reverse transcription Buffer 2ul, RTase Mix 2ul, RNase-free H₂O3ul, remaining 2ul are test rna.

Further, reverse transcriptase primer sequence is as shown in SEQ ID No.8.

Further, the kit RT reaction temperature parameter: 42 DEG C of 60min, 70 DEG C of 10min.

Further, the kit further includes miRNA qPCR reaction system, and the miRNA qPCR reaction system is by every 20ul meter includes: SYBR Green Mix 10ul, miRNA Forward primer 0.8ul, miRNA Reverse Primer 0.8ul, ddH₂O 6.4ul, remaining is RT reaction product 2ul.

Further, the kit miRNA qPCR reaction condition is 95 DEG C of 10min of initial denaturation, is denaturalized 95 DEG C of 2s, is annealed 60 DEG C of 20s extend 70 DEG C of 10s.

The beneficial effects of the present invention are: the present invention is composed by the chip of Plain native Tibetan Plain plasma circulation microRNA Screening is distinguished AMS according to the international diagnostic criteria Lake Louise scoring diagnostic system of AMS and is good for after crowd enters plateau Kang Renqun, in conjunction with the AMS incidence after the exposure of its high altitude anoxia, discovery Plain plasma circulation hsa-miR-1183 is easy in AMS There is significant differences between sense person and Healthy People.Pass through SYBR (i.e. SYBR GREEN dyestuff, abridge SYBR) real-time fluorescence again The method of quantitative PCR (polymerase chain reaction) has detected each microRNA expression water of Plain plasma circulation of another independent crowd It is flat, fully confirm between Plain plasma circulation hsa-miR-1183 expression and the neurological susceptibility of AMS that there is correlations.This It is big to invent verified plasma specimen number of cases amount, it is highly reliable, it can sufficiently prove microRNA pointed by the present invention for AMS Prevention and treatment have reliable effect.The present invention by susceptible person's blood plasma of AMS unconventionality expression low-level it is obvious and more permanent Fixed miRNA is determined as Primary Study object, has found with the closely related miRNA of the susceptible person of AMS, miRNA pairs filtered out AMS has good screening efficiency, can Plain screening reach plateau after altitude sickness onset risk, instruct the prevention of AMS And treatment, mitigate the health and lives threat for reducing altitude sickness to people.It is microRNA as potential acute high altitude reaction The existing Laboratory evidence of diagnostic biomarkers has carried out new effective reliable supplement.

Detailed description of the invention

In order to keep the purpose of the present invention, technical scheme and beneficial effects clearer, the present invention provides following attached drawing and carries out Illustrate:

Fig. 1 is that hsa-miR-1183 expression compares in the blood plasma of AMS susceptible person and normal healthy controls；

Fig. 2 is the performance curve of AMS susceptible person's blood plasma hsa-miR-1183.

Fig. 3 is that hsa-miR-3654 expression compares in the blood plasma of AMS susceptible person and normal healthy controls；

Fig. 4 is the performance curve of AMS susceptible person's blood plasma hsa-miR-3654.

Fig. 5 is that hsa-miR-134-3p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；

Fig. 6 is the performance curve of AMS susceptible person's blood plasma hsa-miR-134-3p.

Fig. 7 is that hsa-miR-15b-5p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；

Fig. 8 is the performance curve of AMS susceptible person's blood plasma hsa-miR-15b-5p.

Fig. 9 is that hsa-miR-23b-5p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；

Figure 10 is the performance curve of AMS susceptible person's blood plasma hsa-miR-23b-5p.

Figure 11 is AMS susceptible person's blood plasma hsa-miR-1183, hsa-miR-15b-5p, hsa-miR-23b-5p tri- joints Performance curve.

Specific embodiment

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other Embodiment shall fall within the protection scope of the present invention.

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiment, is respectively provided with three repeated experiments, and data are the average value of three repeated experiments Or mean+SD.

It is compared and analyzed first by the blood plasma microRNA express spectra to 20 AMS patients and 15 normal healthy controls, Each microRNA expression of the blood plasma of 209 AMS patients and 203 normal healthy controls is compared afterwards, research is each The correlation of microRNA and AMS has searched out the sensitive susceptible biological heredity label of believable AMS.Step is using EDTA-Na It is separated under quasi- 2ml, 3000 × g, 25 degrees Celsius of peripheral blood for rapidly entering plateau crowd from Plain of anticoagulant tube acquisition above-noted persons It extracts and is saved backup at -80 DEG C of upper plasma after ten minutes, pass through microRNA chip of expression spectrum (miRCURYTM LNA Array (v.18.0)) microRNA expression in blood plasma is detected, it is logical according to the world AMS after crowd enters plateau With diagnostic criteria Lake Louise scoring diagnostic system distinguish AMS and healthy population (Maggiorini M.et al., Assessment of acute mountain sickness by different score protocols in the Swiss Alps.Aviat Space Environ Med, 1998,69 (12), 1186-92.), compare AMS and healthy population MicroRNA express spectra, screening AMS neurological susceptibility related a large amount of microRNA, discovery hsa-miR-1183, hsa-miR-3654, Hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p are expressed in AMS susceptible person and healthy population in the presence of aobvious Write difference.

Using qPCR technology to hsa-miR-1183, hsa-miR-3654, hsa-miR-134- in another independent crowd The expression of 3p, hsa-miR-15b-5p, hsa-miR-23b-5p in AMS susceptible person (209) and healthy control group (203) Distribution is detected.Blood plasma RNA extracts the blood plasma microRNA pillar using Kai Jie Technology Co., Ltd., Germany in whole process (miRNeasy Serum/Plasma Kit, article No.: 217184) extracting extraction agent box, then uses real-time fluorescence quantitative PCR (Bulge-Loop^TMMiRNA qRT-PCR Starter Kit, article No.: R10039.2) method carry out to each microRNA and Outer ginseng cel-miR-39 is expanded；The normalization of cel-miR-39 is expressed in each microRNA for calculating separately every sample As a result level is tested by SPSS 19.0, with P < 0.05 for significance test standard, find AMS susceptible person's group (209 Example) and healthy population (203) blood plasma hsa-miR-1183, hsa-miR-3654, hsa-miR-134-3p, hsa-miR- There is significant differences for the expression of 15b-5p, hsa-miR-23b-5p.

The technical problem to be solved by the present invention is to finding one or more of Plain blood plasma microRNA markers can sieve Select AMS susceptible person and Healthy People.By the content of the related microRNA marker in detection people Plain blood plasma, pass through expression Amount just distinguishes AMS susceptible person and Healthy People, and then screening enters the onset risk of AMS behind plateau, avoids the generation of disease And lead to more risk.

Technical proposal that the invention solves the above-mentioned problems is: detection Plain human plasma hsa-miR-1183, hsa-miR- 3654, the content of hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p one or more is easy to distinguish AMS Sense person and Healthy People.

The invention also includes, blood plasma microRNA (hsa-miR-1183, hsa-miR-3654, hsa-miR-134-3p, Hsa-miR-15b-5p, hsa-miR-23b-5p are one or more of) answering in the kit of preparation screening AMS onset risk With.

The expression of 1 plasma specimen microRNA of embodiment and the correlation research of AMS onset risk

One, material and sample, which are collected, describes

Before AMS patient of AMS susceptible person's plasma specimen in Acute Exposed Altitude crowd enters plateau, add up to 209.Just Before normal health crowd of the plasma specimen of ordinary person group in Acute Exposed Altitude crowd enters plateau, add up to 203.AMS's Diagnosis is confirmed by international diagnostic criteria-Lake Louise scoring.All groups do not take before taking blood to be appointed What preventive medicine.Each sample collects 2ml blood with EDTA-Na anticoagulant tube is total.Patient clinical case feature such as 1 institute of table Show.This research has passed through the audit approval of army medical university, ground force (Third Military Medical University) Medical Ethics Committee, all samples Acquisition obtains the informed consent of patient.

The clinical data of 1 plasma specimen of table

Two, sample treatment and RNA are extracted

After intravenous blood collection in 10min, after being centrifuged 10 minutes at 3000 × g, 25 DEG C, with no RNA enzyme and without thin The suction nozzle of bacterium takes upper plasma to save backup for -80 DEG C in no RNA enzyme and abacterial EP pipe.RNA in blood plasma passes through Germany Kai Jie Technology Co., Ltd. blood plasma microRNA pillar extraction agent box (miRNeasy Serum/Plasma Kit, article No.: 217184) operating procedure is extracted and is purified to specifications.

1. the concentration of blood plasma microRNA is lower, 25-40ng/ul or so；

2.A260/280 all in 1.4-1.6；

3.cDNA synthesis uses microRNA quantitative fluorescent PCR Reverse Transcriptase kit (Bulge-Loop^TM miRNA qRT- PCR Starter Kit, article No.: R10039.2): 10ul reverse transcription reaction system: RNA stoste 2ul, reverse transcriptase primer 1ul (5uM), 5x reverse transcription Buffer 2ul, RTase Mix 2ul, Nase-free H₂O 3ul；It is inverse Transcription primers information is as shown in table 2；

4.RT reaction temperature parameter: 42 DEG C of 60min, 70 DEG C of 10min.

2 reverse transcriptase primer information of table

miRNA	miRNA RT primer	SEQ ID
			hsa-miR-134-3p	5'---gtcgtatccagtgcgtgtcgtggagtcggcaattgcactggatacgacttggtga---3'	SEQ ID No.6
hsa-miR-15b-5p	5'---gtcgtatccagtgcgtgtcgtggagtcggcaattgcactggatacgactgtaaac---3'	SEQ ID No.7
			hsa-miR-1183	5'---gtcgtatccagtgcgtgtcgtggagtcggcaattgcactggatacgactgcccac---3'	SEQ ID No.8
hsa-miR-3654	5'---gtcgtatccagtgcgtgtcgtggagtcggcaattgcactggatacgacttcctca---3'	SEQ ID No.9
			hsa-miR-23b-5p	5'---gtcgtatccagtgcgtgtcgtggagtcggcaattgcactggatacgacaaatcag---3'	SEQ ID No.10

Three, real-time fluorescence quantitative PCR (SYBR dye method)

With the microRNA real-time fluorescence quantitative PCR kit of GuangZhou, China Rui Bo Biotechnology Co., Ltd (Bulge-Loop^TMMiRNA qRT-PCR Starter Kit, article No.: R10039.2) respectively to hsa-miR-1183, hsa- MiR-3654, hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p (target microRNA) and outer ginseng cel- MiR-39 is expanded；Ct value (cycle threshold) is respectively obtained, formula is passed through: expression quantity=2Ct (cel-miR- 39)-Ct (target microRNA), in the expression for the microRNA for calculating separately every sample, specific operation process is shown in it Kit specification.Each sample is tested in triplicate.hsa-miR-1183,hsa-miR-3654,hsa-miR-134-3p, Hsa-miR-15b-5p, hsa-miR-23b-5p essential information are as shown in table 1.

1. amplification reaction system: (20ul system): RT reaction product 2ul, SYBR Green Mix 10ul, miRNA Forward primer (5uM) 0.8ul, miRNA Reverse primer (5uM) 0.8ul, ddH2O 6.4ul；It is forward and reverse to draw Object information is as shown in table 3；

2. reaction condition: 95 DEG C of 10min of initial denaturation are denaturalized 95 DEG C of 2s, and anneal 60 DEG C of 20s, extend 70 DEG C of 10s；

3. the Realtime PCR amplification curve of miRNA to be detected and outer ginseng cel-miR-39 are in " S " type；

4.PCR product melting curve be it is unimodal, illustrate that the target gene specificity of amplification is good and result is reliable.

1 microRNA essential information of table

ID	Sequence	Accession number	SEQ ID
				hsa-miR-1183	cacuguaggugauggugagagugggca	MIMAT0005828	SEQ ID No.1
hsa-miR-3654	gacuggacaagcugaggaa	MIMAT0018074	SEQ ID No.2
				hsa-miR-134-3p	ccugugggccaccuagucaccaa	MIMAT0026481	SEQ ID No.3
hsa-miR-23b-5p	uggguuccuggcaugcugauuu	MIMAT0004587	SEQ ID No.4
				hsa-miR-15b-5p	uagcagcacaucaugguuuaca	MIMAT0000417	SEQ ID No.5

The forward and reverse primer information of 3 PCR of table

miRNA	It is forward and reverse	primer	SEQ ID
				hsa-miR-134-3p	Forward primer	5'---cctgtgggccacctagtc---3'	SEQ ID No.11
hsa-miR-134-3p	Reverse primer	5'---cagtgcgtgtcgtggagt---3'	SEQ ID No.12
				hsa-miR-15b-5p	Forward primer	5'---tagcagcacatcatggt---3'	SEQ ID No.13
hsa-miR-15b-5p	Reverse primer	5'---cagtgcgtgtcgtggagt---3'	SEQ ID No.14
				hsa-miR-1183	Forward primer	5'---cactgtaggtgatggtgagagt---3'	SEQ ID No.15
hsa-miR-1183	Reverse primer	5'---cagtgcgtgtcgtggagt---3'	SEQ ID No.16
				hsa-miR-3654	Forward primer	5'---gactggacaagctg---3'	SEQ ID No.17
hsa-miR-3654	Reverse primer	5'---cagtgcgtgtcgtggagt---3'	SEQ ID No.18
				hsa-miR-23b-5p	Forward primer	5'---tgggttcctggcatgct---3'	SEQ ID No.19
hsa-miR-23b-5p	Reverse primer	5'---cagtgcgtgtcgtggagt---3'	SEQ ID No.20

Four, statistical analysis technique

It is counted with statistics software SPSS 19.0.Test of normality uses Shapiro-Wilk method, and conspicuousness is poor It is different to examine (Mann-Whitney Test) with Mann-Whitney, performance curve (receiver operating Characteristic curve, abbreviation ROC curve) and line under area (area under the curve, AUC) for evaluating Each microRNA (hsa-miR-1183, hsa-miR-3654, hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR- Screening efficiency 23b-5p).Think there is statistical difference as P < 0.05.

Five, interpretation of result

1. Fig. 1 is that hsa-miR-1183 expression compares in the blood plasma of AMS susceptible person and normal healthy controls；As shown in Figure 1, Between AMS susceptible person and normal healthy controls, the expression quantity of blood plasma hsa-miR-1183 is compared, and P < 0.001 has extremely significant statistics poor It is different.Wherein AMS be AMS susceptible person, Healthy be normal healthy controls.As P < 0.05, that is, there is a significant statistical difference, P < 0.01, There is extremely significant statistical difference, P < 0.001 has extremely significant statistical difference.

2. the performance curve that Fig. 2 is AMS susceptible person's blood plasma hsa-miR-1183.As shown in Fig. 2, blood plasma hsa-miR- 1183 pairs of screening efficiency between AMS susceptible person and normal healthy controls is by ROC curve it is recognised that hsa-miR-1183 is easy to AMS Screening efficiency between sense person and normal healthy controls is that well, wherein AUC is 0.828 (95%CI, 0.788-0.863).In the figure Show ROC curve, the area under the curve (area under the curve, AUC), sensitivity of AMS susceptible person well (sensitivity), specific (specificity), wherein AUC reflects screening efficiency.It is generally acknowledged that the AUC of test is most Greatly, then its diagnostic value is better.Absolutely prove that hsa-miR-1183 is separately as the biological marker of screening AMS susceptible person in blood plasma Object has certain accuracy and feasibility.Table 4 be Healthy People and each microRNA of AMS susceptible person's blood plasma (hsa-miR-1183, Hsa-miR-3654, hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p) performance curve data.

4 performance curve data of table

3. Fig. 3 is that hsa-miR-3654 expression compares in the blood plasma of AMS susceptible person and normal healthy controls；As shown in figure 3, Between AMS susceptible person and normal healthy controls, the expression quantity of blood plasma hsa-miR-3654 is compared, and P < 0.001 has extremely significant statistics poor It is different.

4. Fig. 4 is the performance curve of AMS susceptible person's blood plasma hsa-miR-3654.As shown in figure 4, blood plasma hsa-miR- 3654 pairs of screening efficiency between AMS susceptible person and normal healthy controls is by ROC curve it is recognised that hsa-miR-3654 is easy to AMS Screening efficiency between sense person and normal healthy controls is that well, wherein AUC is 0.697 (95%CI, 0.650-0.741).

5. Fig. 5 is that hsa-miR-134-3p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；Such as Fig. 5 institute Show, between AMS susceptible person and normal healthy controls, the expression quantity of blood plasma hsa-miR-134-3p is compared, and P < 0.001 has extremely significant statistics Learn difference.

6. the performance curve that Fig. 6 is AMS susceptible person's blood plasma hsa-miR-134-3p.As shown in fig. 6, blood plasma hsa- MiR-134-3p is to the screening efficiency between AMS susceptible person and normal healthy controls by ROC curve it is recognised that hsa-miR-134-3p It is that well, wherein AUC is 0.745 (95%CI, 0.700-0.786) to the screening efficiency between AMS susceptible person and normal healthy controls.

7. Fig. 7 is that hsa-miR-15b-5p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；Such as Fig. 7 institute Show, between AMS susceptible person and normal healthy controls, the expression quantity of blood plasma hsa-miR-15b-5p is compared, and P < 0.001 has extremely significant statistics Learn difference.

8. the performance curve that Fig. 8 is AMS susceptible person's blood plasma hsa-miR-15b-5p.As shown in figure 8, blood plasma hsa- MiR-15b-5p is to the screening efficiency between AMS susceptible person and normal healthy controls by ROC curve it is recognised that hsa-miR-15b-5p It is that well, wherein AUC is 0.808 (95%CI, 0.766-0.845) to the screening efficiency between AMS susceptible person and normal healthy controls.

9. Fig. 9 is that hsa-miR-23b-5p expression compares in the blood plasma of AMS susceptible person and normal healthy controls；Such as Fig. 9 institute Show, between AMS susceptible person and normal healthy controls, the expression quantity of blood plasma hsa-miR-23b-5p is compared, and P < 0.001 has extremely significant statistics Learn difference.

10. the performance curve that Figure 10 is AMS susceptible person's blood plasma hsa-miR-23b-5p.As shown in Figure 10, blood plasma Hsa-miR-23b-5p is to the screening efficiency between AMS susceptible person and normal healthy controls by ROC curve it is recognised that hsa-miR- 23b-5p is that well, wherein AUC is 0.769 (95%CI, 0.725- to the screening efficiency between AMS susceptible person and normal healthy controls 0.808)。

Figure 11 is tri- microRNA joints of blood plasma hsa-miR-1183, hsa-miR-15b-5p and hsa-miR-23b-5p Performance curve.Three microRNA molecules be to the screening efficiency between AMS susceptible person and normal healthy controls individually it is preferable, AUC be respectively as follows: 0.828 (95%CI, 0.788-0.863), 0.808 (95%CI, 0.766-0.845), 0.769 (95%CI, 0.725-0.808).Combined by three microRNA of Figure 11 to the screening efficiency ROC curve between AMS susceptible person and normal healthy controls It is recognised that three blood plasma microRNA of conjunctive use to the screening efficiency between AMS susceptible person and normal healthy controls be preferably, it is excellent It is individually used in it, AUC is 0.872 (95%CI, 0.836-0.903).

Inventor is compared by the blood plasma microRNA express spectra to 20 AMS patients and 15 normal healthy controls first MicroRNA related to AMS neurological susceptibility is screened in analysis, further by a large amount of creative works to 209 AMS susceptible person's blood plasma Each microRNA expression quantity in the plasma specimen of sample and 203 normal populations is analyzed, and finds hsa-miR- in blood plasma 1183, hsa-miR-3654, hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p to AMS susceptible person and are good for There is good screening efficiency between health control, and simultaneous determination hsa-miR-1183, hsa-miR-15b-5p and hsa-miR-23b- The onset risk of the more accurate screening AMS of tri- microRNA of 5p.Inventor also did some microRNA and mountain sickness early period The research of first-degree, but show hsa-miR-1183, hsa-miR-3654, hsa-miR- without any experimental data 134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p are related to AMS neurological susceptibility.

Finally, it is stated that preferred embodiment above is only used to illustrate the technical scheme of the present invention and not to limit it, although logical It crosses above preferred embodiment the present invention is described in detail, however, those skilled in the art should understand that, can be Various changes are made to it in form and in details, without departing from claims of the present invention limited range.

Sequence table

<110>army medical university, ground force, the Chinese People's Liberation Army

<120>application and kit of the hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 1

cacuguaggu gauggugaga gugggca 27

<210> 2

<211> 19

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 2

gacuggacaa gcugaggaa 19

<210> 3

<211> 23

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ccugugggcc accuagucac caa 23

<210> 4

<211> 22

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 4

uggguuccug gcaugcugau uu 22

<210> 5

<211> 22

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 5

uagcagcaca ucaugguuua ca 22

<210> 6

<211> 55

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactt ggtga 55

<210> 7

<211> 55

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactg taaac 55

<210> 8

<211> 55

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactg cccac 55

<210> 9

<211> 55

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactt cctca 55

<210> 10

<211> 55

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgacaa atcag 55

<210> 11

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

cctgtgggcc acctagtc 18

<210> 12

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

cagtgcgtgt cgtggagt 18

<210> 13

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

tagcagcaca tcatggt 17

<210> 14

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

cagtgcgtgt cgtggagt 18

<210> 15

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

cactgtaggt gatggtgaga gt 22

<210> 16

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

cagtgcgtgt cgtggagt 18

<210> 17

<211> 14

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

gactggacaa gctg 14

<210> 18

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

cagtgcgtgt cgtggagt 18

<210> 19

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

tgggttcctg gcatgct 17

<210> 20

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

cagtgcgtgt cgtggagt 18

Claims (10)

1. Application of the 1.hsa-miR-1183 as acute high altitude reaction susceptible person's molecular marker.
2. 2. application according to claim 1, which is characterized in that the sequence of the hsa-miR-1183 such as SEQ ID NO:1 It is shown.
3. 3. application according to claim 1 or 2, which is characterized in that the hsa-miR-1183 nucleic acid molecules are in target blood plasma In expression with control blood plasma in expression compared with lowered.
4. 4. application according to claim 1, which is characterized in that the application is hsa-miR-1183 as microRNA points Sub- marker is applied in the reagent or kit of preparation screening acute high altitude reaction susceptible person.
5. 5. screening acute high altitude reaction susceptible person's kit of any one of -4 application preparations according to claim 1, feature It is, the kit includes that can specifically bind respectively with hsa-miR-1183 reverse transcription product and carry out PCR amplification Primer.
6. 6. kit according to claim 5, which is characterized in that the primer includes forward primer and reverse primer, just To primer sequence as shown in SEQ ID No.15, reverse primer sequences are as shown in SEQ ID No.16.
7. 7. kit according to claim 5, which is characterized in that the kit further includes miRNA RT reaction system, The miRNA RT reaction system is based on every 10ul, comprising: reverse transcriptase primer 1ul, 5x reverse transcription Buffer 2ul, RTase Mix 2ul, RNase-free H₂O 3ul, remaining 2ul are test rna.
8. 8. kit according to claim 7, which is characterized in that the kit RT reaction temperature parameter: 42 DEG C 60min, 70 DEG C of 10min.
9. 9. kit according to claim 5, which is characterized in that the kit further includes miRNA qPCR reactant System, the miRNA qPCR reaction system includes: SYBR Green Mix 10ul, miRNA Forward based on every 20ul Primer 0.8ul, miRNA Reverse primer 0.8ul, ddH₂O 6.4ul, remaining is RT reaction product 2ul.
10. 10. kit according to claim 9, which is characterized in that the kit miRNA qPCR reaction condition is pre- 95 DEG C of 10min are denaturalized, 95 DEG C of 2s are denaturalized, anneal 60 DEG C of 20s, extends 70 DEG C of 10s.