CN109913497A - CPQ gene stablizes the LM3 hepatoma cell strain and its construction method knocked out - Google Patents

Abstract

The present invention relates to biomedical and gene editing research fields, and in particular to a kind of construction method of the LM3 stable cell line of CPQ gene knockout.Using 9 the relevant technologies of CRISPR/Cas of improvement, constructs CPQ and stablize the LM3 cell strain knocked out.By the design of sgRNA, the processing of the synthesis and enzyme digestion of Insert Fragment, the recombinant plasmid knocked out for CPQ is constructed；It collects after packing slow virus containing virulent medium supernatant, will be added to after the supernatant liquid filtering in preparatory cultured LM3 cell and be incubated for；Puromycin (Puromycin) resistance screening and secondary culture finally are carried out to the LM3 cell after virus infection, the final positive LM3 of CPQ knockout that obtains stablizes hepatoma cell strain.The foundation of this cell strain is molecular mechanism of the research CPQ in tumor development and provides new experimental material to the regulation of tumor metabolic variation, meanwhile, reference is provided for the correlation modeling of liver cancer diseases.

Description

CPQ gene stablizes the LM3 hepatoma cell strain and its construction method knocked out

Technical field

The present invention relates to biomedical and gene editing research fields, in particular it relates to a kind of knockout CPQ base The LM3 stable cell line and its construction method of cause.

Background technique

Tumor susceptibility gene CPQ (PGCP) coding is a kind of highly important human plasma glutamate carboxypeptidase, simultaneously It is also exocrine protein important in blood plasma, it is the important of metallocarboxypeptidase M28 family that the theoretical value of molecular weight, which is 51.88kDa, One of member.Existing literature research and TCGA statistics of database analysis shows, CPQ albumen is in Several Kinds of Malignancy (including liver Cancer, oophoroma, breast cancer, lung cancer, thyroid tumors etc.) in copy number dramatically increase and show overexpression trend, and The normal tissue of people and expression quantity in patient cancer beside organism are relatively low.In clinic, the activity for adjusting CPQ, which may also become, to be controlled The important channel of cancer is treated, CPQ has typical clinical meaning to the prognosis and treatment of cancer.Meanwhile CPQ albumen has secretion Property, and the important metabolic enzyme of metabolism is participated in, find that CPQ expressing quantity significantly improves in sera of patients with malignant tumors, and It is nearly no detectable in normal human serum.Therefore, the CPQ in serum is expected to become a kind of new tumor markers, for swelling The auxiliary therapies such as the early diagnosis of tumor clinic, Index for diagnosis, therefore become the target of Tumor biomarkers research.In addition, different Normal metabolic alterations are the important features of malignant tumour, play very important work in the generation and development process of metastases With.About metabolic enzyme and associated metabolic reprogramming, the research report of effect and mechanism in metastases is less, research by The EMT tumour cell that CPQ is mediated reprograms the molecular mechanism of anti-apoptotic by glutamine metabolism, can provide for the diagnosis and treatment of tumour New intervention.

It is well known that liver cancer is the most high-incidence cancer that the death rate accounts for second place of the world.In China, the disease incidence of liver cancer and dead It dies that rate is very high, seriously endangers national health and quality of life.Therefore, to the research of onset of liver cancer mechanism, become swollen One of the hot spot of tumor biological study.CPQ endogenous high expression, copy number in liver cancer increase, have and promote hepatoma cell proliferation And the phenotype of transfer, but its mechanism of action is unclear.In addition, about metabolic enzyme and associated metabolic reprogramming in metastases In effect and mechanism research report it is seldom.It therefore, is to parse hepatoma Metastasis occurrence and development using final goal of the invention The molecular mechanism of middle CPQ regulation, lays the foundation for it in clinical Transformation Application.

The research about CPQ function is concentrated mainly at present, and in the basic research of tumor proliferation, migration etc., correlation is literary It offers and relatively lacks.There is tumour cell epidermal cell interstitial (Epithelial-to- for further investigated CPQ induction Mesenchymal Transition, EMT) mechanism and inquire into its biological function in tumor development, need Construct research model.CRISPR Cas9 gene editing technology and slow-virus transfection technology of the present invention by optimization, building The stabilization hepatoma cell strain that CPQ is knocked out out provides for pathogenic mechanism and its biological function of the subsequent discussion CPQ in liver cancer New research material.

Summary of the invention

The object of the present invention is to provide a kind of LM3 stable cell line and its construction method for knocking out CPQ gene, the cell strains It can be used as cell model, for studying the regulatory mechanism of occurrence and development of the CPQ to tumour (especially liver cancer) and rearranging to metabolism The influence of journey.

A kind of construction method of LM3 stable cell line knocking out CPQ gene provided by the invention, is with hepatoma cell strain LM3 has the slow virus for the sgRNA for knocking out CPQ by infecting, by puromycin (Puromycin) resistance as target cell The stabilization hepatoma cell strain for knocking out CPQ gene is obtained after screening, cell expansion culture.Due to using the CRISPR/ of optimization Cas9 technology has easy and efficient advantage when knocking out plasmid construction.

A kind of construction method of LM3 stable cell line knocking out CPQ gene provided by the invention, includes the following steps:

(1) building of CRISPR/Cas9 knockout carrier.The genome sequence of mankind CPQ gene and right is downloaded from NCBI Structure is analyzed, and transcription initiation region is found, for the region design knock out CPQ sgRNA sequence, the sgRNA sequence by The laboratory Zhang Feng Photographing On-line website http://crispr.mit.edu/ design, and to position of the sgRNA in genome and Efficiency of missing the target is weighted screening, optimum selecting.

For different knockout segment sites, a pair of sgRNA is designed at target segment both ends (respectively in upstream and downstream), two SgRNA is spaced in 250bp or so, the problem of to prevent genomic fragment from chromosomal variation being occurred after too long shearing.In order to Guarantee to knock out effect, knocks out the sgRNA that same gene needs while designing 2 couples or more.Then, sick slowly with Lentivirus V2 Poisonous carrier is skeleton, is inserted into segment using PCR amplification method acquisition, then, is inserted into using ESP3I digestion with restriction enzyme Segment and carrier, through T₄After DNA ligase connection, the recombination constructed simultaneous with two sgRNA of upstream and downstream for knocking out CPQ is struck Except plasmid.

Following example is that (each pair of all include upstream and downstream sequence to two designed at CPQ Second Exon couple sgRNA sequence Column), three bases in bracket are PAM structural domain (NGG):

First pair:

sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)

sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)

Second pair:

sgRNA3 GCACTTCTGGTTGATACTGT(TGG)

sgRNA4 TCCCAGTGGGGTATTCTCAC(TGG)

201bp segment at CPQ gene Second Exon can be knocked out using first couple of sgRNA；It can using second couple of sgRNA Knock out the 140bp segment at CPQ gene Second Exon.

In application sgRNA, need to go out Insert Fragment by PCR amplification sgRNA sequence design in PCR primer, it Building knocks out the recombinant plasmid of gene afterwards.Each Insert Fragment needs to design four PCR primers, obtains by PCR three times.Four In PCR primer, primer I and primer IV are respectively provided with a sgRNA, following example, and sgRNA mode is N₍₂₀₎.And Primer II and primer III are universal primer, constant for knocking out other gene time series synthesizing other Insert Fragments.

Amplimer sequence with sgRNA segment are as follows:

primer I 5′-CGTCTCGCACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAG-3′

primer IV 5′-CGTCTCCAAACANNNNNNNNNNNNNNNNNNNNCGGTGTTTCGTCCTTTCCAC-3′

Wherein, N represents sgRNA sequence.

Two other universal primer sequence are as follows:

primer II 5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTC-3′

primer III 5′-AGTCGGTGCTTTTTTGCCTATTTCCCATGATTCC-3′

With Lentivirus V₂Skeleton plasmid is template, the synthesis process of Insert Fragment:

First time PCR uses primer primer I and primer II, and acquisition PCR product is 115bp；

Second of PCR uses primer primer III and primer IV, obtains PCR product 293bp.

Finally, using the first time and second of PCR product mixed liquor for diluting 100 times as template, third time PCR uses primer Primer I and primer IV complete final PCR, obtain the segment of one section of 386bp, connect for subsequent plasmid.

The method and technology advantage of Insert Fragment achieved above is that this method very rapid and convenient is at low cost.What is obtained inserts Enter segment and is finally connected into carrier by Fig. 1 mode.

(2) after above-mentioned PCR product being removed primer and impurity using PCR product recovery purifying kit, electrophoresis detection its Quality.

(3) digestion is carried out to Lentiviral Lentvirus V2 using ESP3I enzyme, glue recycles linear carrier conduct Skeleton carrier.

(4) T is utilized₄The linear carrier that DNA ligase will recycle in the Insert Fragment obtained in step (1) and step (3) Lentvirus V2 knocks out the recombinant plasmid of CPQ in 25 DEG C of connection 2h, building.Negative control plasmids employment AAVS segment replaces two Item knocks out the guidance sgRNA that gene uses.

(5) by above-mentioned connection reaction solution in the ratio Transformed E .coli competent cell Stbl3 of 1:10, after plating trans Bacterium solution is in the LB solid culture ware of amicillin resistance, 37 DEG C of culture 16h；The single colonie that next day picking is relatively large in diameter is used After 1.5ml centrifuge tube shake culture 5h, bacterium solution PCR identification is carried out, positive bacteria is expanded with 15ml centrifuge tube and is cultivated, is collected by centrifugation Thallus, extracts recombinant plasmid, and digested plasmid carries out second and identifies.The plasmid positive to identification, using the detection of designed, designed Primer LV2-3 carries out generation sequencing, need to there is the sgRNA sequence of design in sequencing result.Sequencing primer LV2-3 sequence are as follows: 5′-CTCCTTTCAAGACCTAGCTAGC-3′。

(6) 24-48h before cell transfecting is inoculated with 1-10 × 10 in 100mm culture dish⁵A every milliliter of HEK293T cell, Reach 50-70% for transfecting to next day cell confluency degree.

(7) cell transfection assays.The method infected using packaging slow virus, the positive recombinant plasmid that step (5) are obtained (gross mass 4-8 μ g) is mixed according to the mass ratio of 10:1:9 with viral packaging plasmid pVSVG and PSPA × 2, is added to 500 μ l In the DMEM culture medium of Opti-MEM minimal medium or serum-free without double antibody, then press the ratio of 1:4 (plasmid quality: transfection reagent) Transfection reagent is added in example, mixes, is stored at room temperature 30min；Meanwhile HEK293T cell is removed into old culture medium, with 1 × PBS of 5ml Soft cleaning 1 time, adds DMEM culture medium 2-3ml without double antibody, serum-free, then by the incubation of above-mentioned transfection reagent and plasmid Liquid is added dropwise in HEK293T cell, is put into 37 DEG C of 5%CO₂Incubator in cultivate；Culture dish is taken out after 3-6h, is added 8-10ml is 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) containing volumetric concentration And 10% serum DMEM culture medium, be put into and continue to cultivate in incubator.

(8) 48-72h is cultivated, collects and contains virulent culture medium, culture medium is filtered using 0.45 μm of sterilised membrane filter, obtains Filtrate be virus liquid.The virus liquid uses after directly can using or be concentrated, and can also place -80 DEG C of long-term preservations.

(9) 24-48h before virus infection is tested, is inoculated with LM3 cell in 60mm culture dish, and inoculum concentration is 6-10 × 10⁵It is a Cells/ml, next day cell confluency degree about 50-70%.

(10) virus infection.LM3 Tissue Culture Dish is taken out, removes cell culture medium, being changed to 3ml containing volumetric concentration is The DMEM of 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum training Base is supported, the virus liquid obtained in step (8) is added in above-mentioned LM3 Tissue Culture Dish, every ware adds 4ml, and 6-10 μ l is added Polybrene (polybrene), in 37 DEG C, 5%CO₂Continue culture in incubator for 24 hours.

(11) next day takes out above-mentioned culture dish from incubator, removes and contains virulent culture medium, uses 10ml instead containing volume Concentration is 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum DMEM culture medium continues to cultivate.

(12) after cultivating 24-48h, visible cell growth is more intensive under the microscope.With 0.25% trypsase The ratio of the every 10cm culture dish of 1ml gets off LM3 cell dissociation, after centrifugation whole renewed vaccinations in new 100mm culture dish, Containing volumetric concentration in 10ml is 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) And 10% serum DMEM culture medium in add the puromycin (Puromycin) of final concentration of 2 μ g/ml and carry out positive cell Screening.The once identical DMEM culture medium containing isoconcentration Puromycin was replaced every three days.Four to five week of step sizing, Until the cell that cell covers with culture dish and falls off almost without death.

(13) screening of cell monoclonal.Cell suspension will be prepared after cell dissociation, with ladder in 96 porocyte culture plates It spends dilution method and gradient dilution step by step is carried out to LM3 cell suspending liquid in 1:1 ratio, continue to cultivate surrounding or so in the incubator, Picking cell monoclonal under microscope.

(14) identification of positive cell strain.24 orifice plates, 12 orifice plates, 6 orifice plates are successively transferred to after the monoclonal of acquisition is digested And successively expand culture in 100mm culture dish, the positive cell that part LM3 knocks out CPQ is taken out, 1) extraction genome is respectively adopted DNA and PCR identification, 2) generation sequencing identification and 3) Western Blot identify striking for CPQ gene in positive cell genome Except the reduction of effect and CPQ expressing quantity, it was demonstrated that the LM3 cell strain that CPQ is knocked out constructs successfully.Using this method, CPQ base Because knocking out efficiency up to 70% or more, and stability is good.

(15) compared with prior art, the present invention knocks out the building mode of plasmid by adjusting CRISPR, optimizes slow virus The condition of culture of rotaring redyeing system obtains the LM3 cell strain stablized and knock out CPQ.This method has transfection efficiency high, special and high The advantages of imitating stable knockout target gene.The present invention be study mechanism of action of the CPQ albumen in liver cancer genesis and development and its Modulate tumor metabolism reprogramming mechanism, provides new research model and experimental material.

Detailed description of the invention

Fig. 1: the recombinant plasmid ideograph for the guidance sgRNA that gene uses is knocked out containing two.

As shown in the figure, U6 is mankind U6 promoter sequence.The sequence of double-head arrow successively indicates: U6 promoter, sgRNAa, U6 Promoter, sgRNAb, sgRNAa and sgRNAb are two sgRNA sequences.Wherein sgRNAa represents primer I

N in 5 '-CGTCTCGCACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAG-3 '₍₂₀₎； SgRNAb represents primer IV

N in 5 '-CGTCTCCAAACANNNNNNNNNNNNNNNNNNNNCGGTGTTTCGTCCTTTCCAC-3 '₍₂₀₎。

Fig. 2: cell monoclonal of the LM3 cell strain of people CPQ gene in inverted microscope (40 times of amplifications) is knocked out.

Fig. 3: the PCR qualification figure of the LM3 stable cell line of people CPQ gene is knocked out.Due to detection primer design be located at strike Except will lead to PCR in lost part without amplified production, without PCR product if knocking out successfully.Figure be use two pairs of primers respectively with Genomic DNA is that template carries out PCR detection.The knockout that number KO1-1CE is sgRNA1 and sgRNA2 combines, number KO2-1CE It is combined for the knockout of sgRNA3 and sgRNA4.The knockout CPQ effect of primer pair 2F and 22R detection sgRNA1 and sgRNA2；Primer To the knockout CPQ effect of TestKOCPQ1F and TestKOCPQ1R detection sgRNA3 and sgRNA4.

Wherein, primer pair 2F and 22R sequence are as follows:

2F:5 '-ATCTTCGCATTTTTCGGTGGTG-3 '

22R:5 '-CTTCTGGAGGAGTCCCAATGC-3 '

Primer pair TestKOCPQ1F and TestKOCPQ1R sequence are as follows:

TestKOCPQ1F:5 '-ACAGATGACAGCTGAGAAGGC-3 '

TestKOCPQ1R:5 '-TGGCTTTTTCTAGGTTCTTGG-3 '

Fig. 4: the LM3 stable cell line generation sequencing analysis result of people CPQ gene is knocked out.A) LM3KO1-1 is that sequencing knocks out SgRNA1&2 knocks out 165bp segment；B) LM3KO2-1 is that sequencing knocks out sgRNA3&4, knocks out 106bp segment.

Fig. 5: the LM3 stable cell line Western Blot detection of people CPQ gene is knocked out.From left to right successively are as follows: swimming lane 1 For the LM3 cell strain of transfection control plasmid (the sgRNA sequence of people AAVS), swimming lane 2 is to stablize to knock out cell strain KO1-1CE, swimming Road 3 is to stablize to knock out cell strain KO2-1CE, and antibody is Rabbit Anti-CPQ Antibody (public purchased from ProteinTech Department).

Specific embodiment

Embodiment 1, the carrier that CPQ gene is knocked out using the CRISPR/Cas9 technology building of optimization

(1) mankind are downloaded for basic framework from NCBI with Lentivirus V2 carrier (Zhang Feng Lab, MIT) The genome sequence of CPQ gene simultaneously analyzes structure, finds transcription initiation region, and for the region, Photographing On-line is chosen A pair of of sgRNA, upstream and downstream sgRNA sequence difference are as follows:

sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)

sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)

Wherein, three bases in bracket are PAM structural domain (NGG)

Design four primer sequences are as follows:

KOCPQ primer I (underscore is sgRNA1 sequence)

5′-CGTCTCGCACCGCTTATCTTCGCATTTTTCGGGTTTTAGAGCTAGAAATAG-3′

KOCPQ primer II

5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTC-3′

It is 115bp that first time PCR, which obtains PCR product using primer primer I and primer II,

KOCPQ primer III

5′-AGTCGGTGCTTTTTTGCCTATTTCCCATGATTCC-3′

KOCPQ primer IV (reverse complemental that underscore is sgRNA2 sequence)

5′-CGTCTCCAAACAATGAGCGATTGGCACTTCTGCGGTGTTTCGTCCTTTCCAC-3′

It is 293bp that second of PCR, which obtains PCR product using primer primer III and primer IV,

For the first time and second of PCR amplification system used is 25 microlitres of reaction systems:

PCR reaction condition:

94℃,5min；(94℃,30s；71℃,30s；72 DEG C, 1min) × 2 (TouchDown PCR is by 71 DEG C to 63 DEG C 2 DEG C of every 2 cycle down), (94 DEG C, 30s；61℃,30s；72℃,1min)×25；72℃,10min；Hold 4℃.

Finally, using the first time and second of PCR mixed liquor for diluting 100 times as template, third time PCR uses primer Primer I and primer IV complete final amplification, and PCR uses 2 times of above-mentioned 25 microlitres of PCR reaction systems, obtain one section The Insert Fragment of 386bp is connected for subsequent plasmid.

It (2) will be upper using the TaKaRa MiniBEST DNA Fragment Purification Kit of precious biotech firm It states PCR product and removes recovery purifying after primer and impurity, its quality of electrophoresis detection.

(3) PCR product of recycling is subjected to ESP3I digestion, endonuclease reaction system is as follows:

30 μ l digestion systems add 3 μ g PCR products, 1 μ l 10U ESP3I, 3 10 × FastDigest of μ l respectively Buffer (Thermo company), remaining uses ddH₂O is supplied, and after mixing, is put into 37 DEG C of water-baths and is incubated for 20min.

(4) by digestion products in 1 × TAE Ago-Gel of 1.0% (g/ml) electrophoresis, and gel extraction purpose piece Section.Using precious biotech firm's plastic recovery kit TaKaRa MiniBEST Agarose Gel DNA E × traction Kit, Operation is implemented referring to product description, is dissolved in the sterile water of 30 μ l.The final insertion for obtaining the knockout CPQ that length is 386bp Segment.

(5) linear slow virus carrier Lentivirus V2 is obtained using ESP3I digestion.Using ESP3I restriction enzyme Digestion is carried out to skeleton plasmid Lentivirus V2, is incubated for 0.5h in 37 DEG C of water-baths；Then electric in 1% Ago-Gel Swimming, and gel extraction linear carrier.

(6) T is utilized₄DNA ligase will be after the digestion that obtained in lentivirus V2 linear carrier and above step (4) Insert Fragment, with 10 microlitres of systems in 25 DEG C of connection 2h.

(7) 42 DEG C of heat-shock transformed methods are used, above-mentioned connection reaction solution is converted into Stbl3 competent cell with 1:10 ratio Afterwards, in the LB solid culture plate overnight culture containing 100 μ g/ml Ampicillin, 37 DEG C are put into overnight after being coated with bacterium solution Cultivate 12-16h.

(8) single colonie that next day picking is relatively large in diameter carries out bacterium solution PCR identification with 1.5ml centrifuge tube shake culture 5h, Positive bacterium colony is expanded with 15ml centrifuge tube and is cultivated, thalline were collected by centrifugation extracts recombinant plasmid, is measured using NanoDrop1000 Plasmid concentration.

(9) the secondary identification recombinant plasmid of ESP3I enzyme cutting method is used.Electrophorogram finds the provable recombinant plasmid of Insert Fragment It constructs successfully.To the plasmid of the identification Insert Fragment positive, it is sequenced, is being sequenced using the detection primer LV2-3 of designed, designed As a result it needs to find two sgRNA sequences in.Primer LV2-3 sequence are as follows: 5 '-CTCCTTTCAAGACCTAGCTAGC-3 '.

(10) positive plasmid is obtained.

Embodiment 2, the foundation for knocking out CPQ stable cell line, specific implementation step are as follows:

(1) after recombinant plasmid being extracted and measuring plasmid concentration with NanoDrop1000, the integrality of electrophoresis detection plasmid.

(2) 24-48h before cell transfecting, inoculating cell density is 1-10 × 10 in 100mm culture dish⁵It is every milliliter a HEK293T cell reaches 50-70% for transfecting to next day cell confluency degree.

(3) cell transfection assays.Method using packaging slow virus for transfection, the positive restructuring that embodiment one is obtained Plasmid mixes (8 μ g of gross mass) according to the mass ratio of 10:1:9 with virus packaging plasmid pVSVG and PSPA × 2, is added to 500 32 μ l transfection reagents are added in μ l Opti-MEM minimal medium, then mixes, be stored at room temperature 30min；Meanwhile by HEK293T Cell removes the culture medium in cultivating system, is softly cleaned 1 time with 1 × PBS of 5ml；Add the DMEM of 2ml serum-free without double antibody Above-mentioned transfection reagent and the Incubating Solution of plasmid are added dropwise to the HEK293 cell being inoculated in 100mm culture dish by culture medium In, it is put into 37 DEG C of 5%CO₂Incubator in continue to cultivate；Culture dish is taken out after 3h, adding 8ml containing volumetric concentration is 1% dual anti- The DMEM culture medium of (penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum, puts Enter and continues to cultivate in incubator.

(4) it after cultivating 48h, collects and contains the virulent cell culture medium supernatant of above-mentioned band, use 0.45 μm of sterile filter Film filtering obtains virus liquid and infects for subsequent.

(5) before virus infection experiment for 24 hours, LM3 cell is inoculated in 60mm culture dish, inoculum concentration is 6-10 × 10⁵It is a every Milliliter LM3, next day cell confluency degree reach 50-70%.

(6) virus infection.LM3 Tissue Culture Dish is taken out, cell culture medium is removed, it is 1% pair that 3ml, which is added, containing volumetric concentration The DMEM culture medium of anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum, The virus liquid obtained in step (4) is added in above-mentioned LM3 Tissue Culture Dish, every ware adds 4ml, is added 6 microlitres Polybrene (polybrene), in 37 DEG C of 5%CO₂Continue culture in incubator for 24 hours.

(7) next day takes out above-mentioned culture dish from incubator, removes and contains virulent culture medium, and addition contains volumetric concentration For 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and the DMEM of 10% serum Fresh culture continues to cultivate 48h in cell incubator.

(8) after 48h, visible cell growth is more intensive under the microscope.With the 0.25% every 10cm of trypsase 1ml The ratio of culture dish gets off LM3 cell dissociation, and whole renewed vaccinations contain volume in 10ml in 100mm culture dish after centrifugation Concentration is 1% dual anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum The puromycin (Puromycin) that final concentration of 2 μ g/ml is added in DMEM culture medium carries out positive cell screening.Every three days Replace the DMEM fresh culture once containing 2 μ g/ml Puromycin.Step sizing five weeks, until cell covers with culture dish And until the cell to fall off almost without death.

(9) screening of cell monoclonal.Cell suspension will be prepared after cell dissociation, uses gradient in 96 porocyte culture plates Dilution method carries out gradient dilution step by step to LM3 cell suspending liquid in 1:1 ratio, cultivates surrounding in the incubator, chooses under microscope Take cell monoclonal.

(10) positive cell strain is identified.Will acquisition monoclonal digest after be successively transferred to 24 orifice plates, 12 orifice plates, 6 orifice plates and Successively expand culture in 100mm culture dish, take out the positive cell that part LM3 knocks out CPQ, 1) extraction genome is respectively adopted DNA and PCR identification, 2) generation sequencing identification and 3) Western Blot identify striking for CPQ gene in positive cell genome Except the reduction of effect and CPQ expressing quantity, it was demonstrated that the LM3 cell strain that CPQ is knocked out constructs successfully.

Wherein, Western Blot identity process are as follows: extract the total protein stablized and knock out cell strain after RIPA cracking, use BCA method carries out protein quantification, then carries out the expression quantity of Western Blot detection CPQ albumen (see Fig. 5).Concrete operation method It is as follows: the CPQ LM3 cell knocked out is passaged in 100mm culture dish, culture medium is sucked after it is covered with, addition 5ml pre-cooling 1 × PBS is cleaned 1 time, abandons supernatant, and the RIPA cell pyrolysis liquid (ThermoFisher) that 350 μ l pre-cooling is added arrives above-mentioned culture dish In, culture dish is placed in progress lytic cell 1h on ice, interval concussion mixes several times during cracking；Then using the thin of pre-cooling Born of the same parents' spatula quickly scrapes cell, and is transferred in 1.5ml centrifuge tube；12000rpm, 4 DEG C of centrifugation 15min, carefully draws supernatant Liquid is transferred in new 1.5ml centrifuge tube.Protein concentration (ThermoFisher) is measured using BCA method, operating method is with reference to production Product specification.20 μ g protein extracts are drawn, 4 × SDS PAGE Loading Buffer of final volume 1/3 are added, in 97 DEG C It is denaturalized 10min, carries out 10%SDS- polyacrylamide gel electrophoresis, constant voltage 80V；Then albumen electricity is gone into pvdf membrane, Constant current 250mA；After transferring film, the skimmed milk power that pvdf membrane mass volume ratio is 5% (is prepared into) closing with TBST solution Then 1h is washed film 3 times, each 10min with 1 × TBST solution, rabbit anti-CPQ antibody is added, is incubated overnight in 4 DEG C. Morning next day recycles primary antibody, and 1 × TBST is washed film 3 times, each 10min, adds two antiantibody of rabbit, is incubated at room temperature 1h, 1 × TBST Film 3 times are washed, each 10min.Imaging analysis is carried out after ECL chemical illuminating reagent is added.As shown in figure 5, the visible CPQ egg of control group White master tape, and knock out the CPQ group albumen and disappear in master tape position, show that the LM3 cell strain for knocking out CPQ constructs successfully.

(11) it after the LM3 stable cell line for the successful knockout CPQ for obtaining step (10) expands culture, is placed in liquid nitrogen Long-term preservation is spare.

The present invention is constructed CPQ and is struck by the CRISPR/Cas9 gene editing technology and slow-virus transfection technology of optimization The stabilization hepatoma cell strain removed, experiment flow of the invention are not only limited to LM3 cell strain, and it is thin to be applied equally to other liver cancer Born of the same parents' strain and other tumours (such as breast cancer) knock out the foundation of cell strain, and cancer cell condition of culture is carried out according to specific cell strain Corresponding adjustment.

Claims (3)

1. the construction method that a kind of CPQ gene stablizes the LM3 stable cell line knocked out, which is characterized in that with liver cancer LM3 cell work For target cell, CPQ albumen in cell is knocked out by slow-virus infection, comprising the following steps:

1) 24-48h before transfecting will be used for the HEK293T cell inoculation of slow virus packaging in 100mm Tissue Culture Dish；

It 2) is 1 × 10 in cell density⁵-10×10⁵In a every milliliter of HEK293T cell, with the mass ratio of 1:9:10, transfection Total amount is the plasmid of 4-8 μ g, respectively pVSVG:PSPA × 2: knocks out CPQ, wherein pVSVG and PSPA × 2 are two packaging matter Grain；Knockout CPQ plasmid is Lentivirus V₂The recombinant plasmid that the guidance sgRNA that gene uses is knocked out containing two of skeleton； Two knock out the guidance sgRNA that gene uses and are expressed as the sgRNAa of upstream region of gene and the sgRNAb of downstream of gene；

3) culture medium in HEK293T cell culture system is removed, without double antibody, serum-free DMEM culture medium 2-3ml is used instead and incubates Educate HEK293T and transfection procedure 2) the 4-8 μ g plasmid of description, after transfecting 3-6h, adding 8-10ml containing volumetric concentration is 1% pair The DMEM culture medium of anti-(penicillin and streptomysin reagent Penicillin-Streptomycin of commercialization) and 10% serum is mended Liquid；

4) after transfecting in 48-72h, the medium supernatant of HEK293T is collected, by the supernatant sterilised membrane filter in 0.45 μm of aperture Filtering, virus liquid needed for obtaining；

5) 24-48h inoculating cell density is 6-10 × 10 before infecting⁵A every milliliter of target cell LM3 in new culture dish, with Bowel frequency day, cell confluency degree reached 50-70%, took virus liquid described in 4ml step 4) and 6-10 μ l polybrene (polybrene), at the same be added to be changed to 3ml containing 1% dual anti-and 10% serum DMEM culture medium target cell LM3 culture In system；

6) after virus infection, LM3 cell culture medium is sucked in 18-24h, using 10ml instead containing volumetric concentration is 1% dual anti-(commodity The penicillin and streptomysin reagent Penicillin-Streptomycin of change) and the DMEM culture medium of 10% serum continue to cultivate；

7) continue after cultivating 24-48h, in the ratio of the every 100mm culture dish of 0.25% trypsase 1ml, LM3 cell is disappeared Change is got off, and whole renewed vaccinations contain 1% dual anti-and 10% serum DMEM in 10ml in new 100mm culture dish after centrifugation The puromycin (Puromycin) that final concentration of 2 μ g/ml is added in culture medium carries out the positive cell screening that LM3 knocks out CPQ.

2. construction method as described in claim 1, it is characterised in that: LM3 knocks out the identification of the positive cell strain of CPQ；

96 orifice plate puromycin medicine sieve separation LM3 cell monoclonals are successively transferred to 24 orifice plates, 12 after digesting the monoclonal of acquisition Successively expand culture in orifice plate, 6 orifice plates and 100mm culture dish, takes out the positive cell that part LM3 knocks out CPQ, be respectively adopted 1) Extract genomic DNA and PCR identification, 2) generation sequencing identification and 3) Western Blot, are identified in positive cell genome The knockout effect of CPQ gene and the reduction of CPQ expressing quantity, it was demonstrated that the LM3 cell strain that CPQ is knocked out constructs successfully.

3. the CPQ gene that construction method as described in claim 1 obtains stablizes the LM3 hepatoma cell strain knocked out.