CN109884323B - Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof - Google Patents
Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof Download PDFInfo
- Publication number
- CN109884323B CN109884323B CN201910070322.6A CN201910070322A CN109884323B CN 109884323 B CN109884323 B CN 109884323B CN 201910070322 A CN201910070322 A CN 201910070322A CN 109884323 B CN109884323 B CN 109884323B
- Authority
- CN
- China
- Prior art keywords
- precursor protein
- egg shell
- shell precursor
- paralichthys olivaceus
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit and detection method and application thereof. Preparing a paralichthys olivaceus egg shell precursor protein by a prokaryotic expression method, immunizing a mouse to develop a polyclonal antibody of the paralichthys olivaceus egg shell precursor protein, and labeling horseradish peroxidase on the purified antibody; filling 1 each of a pure product of the egg shell precursor protein of the paralichthys olivaceus, a polyclonal antibody of the egg shell precursor protein of the mouse anti-paralichthys olivaceus marked by horseradish peroxidase, a blank 96-hole enzyme-labeled plate, a coating solution, a cleaning solution, a sealing solution, a sample diluent, a developing solution and a stopping solution into a box body together to obtain the sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus. The kit can sensitively and accurately quantify the egg shell precursor protein in the blood plasma, the whole homogenate, the liver tissue and the hepatocyte culture solution of the paralichthys olivaceus, and the detection range is 1.95-250 ng/mL‑1And provides an important tool for screening and detecting the marine environmental estrogen and evaluating the ecological environmental risk.
Description
Technical Field
The invention belongs to the field of environmental detection, and particularly relates to a Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, and a preparation method and application thereof.
Background
After entering into the body as an exogenous compound, environmental estrogen has the functions of interfering the processes of synthesis, release, operation, metabolism, combination and the like of normal secretion substances in the body and activating or inhibiting the function of an endocrine system, thereby destroying the functions of maintaining the stability and regulation of the body. In recent years, environmental estrogen pollution poses a potential threat to ecological balance of the natural environment and human health, after environmental estrogen substances enter a human body, women mostly suffer from diseases such as hysteromyoma and ovarian cancer, and men mostly suffer from symptoms such as testicular cancer and reduction in the quantity and quality of sperms. Less than 1 ng/L of estradiol can cause male stingray trout to generate specific vitellogenin of female fish, while 4 ng/L of estradiol can cause sexual malformation of juvenile fish, and secondary sex characteristics of juvenile fish are changed. Estrogens in the marine environment can cause the reduction of fish population viability and fishery resources. The pollution of the marine environment estrogen is increasingly serious, wherein the concentration of common estrogens such as estradiol, bisphenol A and the like in coastal seawater in China reaches 45.7 ng/L, 3.99 ng/L and 3920 ng/L. Therefore, in order to solve the problem of the detection of the estrogen activity in the offshore sea area environment in China, a more sensitive, accurate and simple detection technology needs to be established urgently.
The egg shell precursor protein is an environmental estrogen biomarker newly discovered in recent years, is a female-specific protein, is not usually present in male fish and juvenile fish, but can be synthesized and secreted under the induction of environmental estrogen. The estrogen activity in the water environment can be evaluated by detecting the content of the egg shell precursor protein in the male fish or the juvenile fish. Compared with the vitellogenin which is a common environmental estrogen biomarker at present, the egg shell precursor protein can respond to environmental estrogen more sensitively and quickly. 1 ng/L E2Can remarkably up-regulate male ocean medaka (Oryzias javanicus) The expression level of the liver egg shell precursor protein gene is obviously higher than that of the vitellogenin. Therefore, the eggshell precursor protein is a more sensitive biomarker for environmental estrogen screening, however, no detection kit for the eggshell precursor protein is established at home and abroad at present, and the main reason is that the traditional separation and purification method is difficult to obtain the eggshell precursor protein from fish bodies, and a high-purity antigen cannot be provided for ELISA development, so that an ELISA method for accurately quantifying the eggshell precursor protein cannot be established up to now. Therefore, the invention adopts prokaryotic expression technology to prepare recombinant egg shell precursor protein and prepare high-sensitivity antibody, thereby establishing immunoassay technology of the egg shell precursor protein and preparing the kit capable of detecting the activity of the marine estrogen.
Paralichthys olivaceus (Paralichthys olivaceus)Paralichthys olivaceus) Belongs to the order Pleuroideae, Paralichthys, and is important in our countryThe required marine culture of economic fish. The paralichthys olivaceus usually moves only in offshore places, does not migrate for a long distance, can accurately reflect the pollution condition of the habitat, and is very suitable for being used as an indication fish species for marine pollutant monitoring. Mainly distributed in the yellow Bohai sea and the east sea in China, and along the bank water in Korea and Japan. Therefore, in order to realize the detection of the activity of environmental estrogen in offshore sea areas in China, the invention uses the egg shell precursor protein of the paralichthys olivaceus as a biomarker to detect the environmental estrogen.
Disclosure of Invention
The invention aims to provide a Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, and a detection method and application thereof, so as to meet the requirements of the prior art.
A sandwich ELISA kit for detecting egg shell precursor protein of paralichthys olivaceus comprises 1 blank 96-hole ELISA plate, coating liquid, sealing liquid, sample diluent, washing liquid, developing liquid and terminator,
the kit is characterized by also comprising 1 pure branch of the egg shell precursor protein of the paralichthys olivaceus, 1 branch of polyclonal antibody of the egg shell precursor protein of the mouse anti-paralichthys olivaceus and 1 branch of polyclonal antibody of the egg shell precursor protein of the mouse anti-paralichthys olivaceus marked by horseradish peroxidase.
In the sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus,
the pure product of the egg shell precursor protein of the paralichthys olivaceus is prepared by a prokaryotic expression technology;
the polyclonal antibody of the egg shell precursor protein of the paralichthys olivaceus is prepared by utilizing the pure product of the egg shell precursor protein of the paralichthys olivaceus obtained in the previous step;
the horseradish peroxidase-labeled polyclonal antibody of the mouse anti-paralichthys olivaceus egg shell precursor protein is prepared by using the mouse anti-paralichthys olivaceus egg shell precursor protein antibody obtained in the step. The method comprises the following specific steps:
the pure product of the egg shell precursor protein of the paralichthys olivaceus is prepared by the following method:
(1) by intramuscular injection 17βEstradiol induces the liver of the paralichthys olivaceus to largely transcribe Chg H mRNA, Trizol is used for extracting liver total RNA, cDNA is obtained through reverse transcription, and the reversed cDNA is used as a modelPCR amplification is carried out by using primers F: CACCCAAGTTTTCAAGTCTCAGCAGTC and R: CCGCTTACTGAGCAGGGTCAATGAAT, and a target fragment is recovered; connecting the target fragment with pClone007 vector by using T4 ligase, transforming the ligation product into DH5 alpha competent cells, sequencing, carrying out amplification culture on the correctly sequenced cells, extracting plasmids, carrying out PCR amplification by using the primers, cutting gel and recovering the target fragment;
(2) after the recovered target fragment is connected with a pDE1 expression vector, the connection product is transformed into an expression host bacterium BL21(DE 3); carrying out amplification culture on the correctly expressed host bacteria, namely adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1 mM, placing the mixture in a constant-temperature shaking table at 37 ℃ for shake culture for 10 hours, centrifuging the cultured bacterial solution at 5000 rpm for 20 min, collecting precipitates, treating the precipitates by a lysate, centrifuging again to collect inclusion bodies, adding 30 mL of a dissolving solution (100 mM Tris, 500 mM NaCl, 10 mM imidazole, 8M urea, pH8.0) into the inclusion bodies, and stirring at 4 ℃ overnight; and (3) centrifuging the dissolved inclusion body at 10000 rpm for 30min, collecting the supernatant, filtering the supernatant by a 0.45-micron filter membrane, and purifying by using nickel ion chelated magnetic beads to obtain the pure product of the egg shell precursor protein of the paralichthys olivaceus.
The polyclonal antibody of the mouse anti-paralichthys olivaceus egg shell precursor protein is prepared by the following method:
emulsifying 0.1mL of the pure product of the egg shell precursor Protein of the paralichthys olivaceus obtained in the above step and an equivalent volume of Freund complete adjuvant, injecting the emulsified pure product and the equivalent volume of Freund complete adjuvant into the abdominal cavity of a mouse, fully emulsifying the pure product of the egg shell precursor Protein of the paralichthys olivaceus with the same dose of Freund incomplete adjuvant after two weeks, performing boosting immunization on a Balb/c mouse, injecting the pure product of the egg shell precursor Protein of the paralichthys olivaceus into a tail vein after one week, performing boosting immunization, taking serum of the mouse after three days, purifying the serum by using a Protein G affinity chromatography column to obtain immunoglobulin IgG, dialyzing the purified immunoglobulin IgG by PBS buffer solution for 24 hours, and obtaining the polyclonal antibody of the egg shell precursor Protein of the paralichthys olivaceus.
The horse radish peroxidase labeled mouse anti-paralichthys olivaceus egg shell precursor protein polyclonal antibody is prepared by the following method:
adding 1 mg of horseradish peroxidase to 2 ml of freshly prepared 0.1M NaIO4The solution was stirred at room temperature in the dark for 20 min; putting the solution into a dialysis bag, and dialyzing with 1mM sodium acetate buffer solution with pH4.4 overnight; adding 0.5 ml of 0.16M ethylene glycol aqueous solution, and standing at room temperature for 30 min; adding 1 mg of the polyclonal antibody of the egg shell precursor protein of the paralichthys olivaceus obtained in the step (b), and dialyzing with 0.05M carbonate buffer solution with the pH value of 9.5 overnight to ensure that the polyclonal antibody of the egg shell precursor protein of the paralichthys olivaceus is fully combined with horseradish peroxidase; add 5mg/ml NaBH40.1ml of the solution is mixed evenly and put into a dialysis bag and dialyzed with PBS overnight at 4 ℃; centrifuging at 3000 r/min for 30min, and collecting supernatant as polyclonal antibody of horse radish peroxidase-labeled mouse anti-paralichthys olivaceus egg shell precursor protein.
And finally, putting 1 pure product of the egg shell precursor protein of the paralichthys olivaceus, 1 antibody of the egg shell precursor protein of the anti-paralichthys olivaceus, 1 polyclonal antibody of the egg shell precursor protein of the anti-paralichthys olivaceus marked by horseradish peroxidase, and 1 of coating solution, sealing solution, sample diluent, washing solution, developing solution and stopping solution into a box to obtain the sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus.
The sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus is applied to the detection of the estrogen pollution in the marine environment.
THE ADVANTAGES OF THE PRESENT INVENTION
In order to further improve the detection sensitivity and specificity to the activity of trace estrogen, the invention establishes a sandwich ELISA quantitative method by using stable egg shell precursor protein without degradation problem as an antigen and a polyclonal antibody thereof. And the prokaryotic expression technology is utilized to realize the mass preparation of the egg shell precursor protein, so that the high-sensitivity antibody is prepared, and the ELISA method for accurately measuring the egg shell precursor protein is established, so as to achieve the detection of the lower level of estrogen activity. Compared with indirect competitive ELISA, the sandwich ELISA has the advantages of short operation time, small workload, higher detection sensitivity and the like, is convenient to detect the egg shell precursor protein in the blood plasma, liver tissues and liver cell culture solution of the paralichthys olivaceus, has the detection range of 1.95-250 ng/mL, and provides an effective means for screening and detecting environmental estrogen and evaluating the risk of the ecological environment.
Drawings
FIG. 1 shows the result of detecting the expression vector of egg shell precursor protein of Paralichthys olivaceus prepared by the present invention.
FIG. 2 shows the result of detecting the pure egg shell precursor protein of Paralichthys olivaceus prepared by the present invention.
FIG. 3 shows the result of ELISA detection of the Paralichthys olivaceus egg shell precursor protein standard by the kit of the present invention.
The specific implementation mode is as follows:
a sandwich ELISA kit for detecting egg shell precursor protein of paralichthys olivaceus comprises 1 blank 96-hole ELISA plate, coating liquid, sealing liquid, sample diluent, washing liquid, developing liquid and terminator,
the antibody is characterized by also comprising 1 count of polyclonal antibody of the mouse anti-Paralichthys olivaceus egg shell precursor protein, 1 count of polyclonal antibody of the mouse anti-Paralichthys olivaceus egg shell precursor protein marked by horseradish peroxidase and 1 count of pure product of the Paralichthys olivaceus egg shell precursor protein.
The preparation of the sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus comprises the following steps:
(1) method for preparing pure paralichthys olivaceus egg shell precursor protein by using prokaryotic expression technology
Construction of prokaryotic expression vector of egg shell precursor protein
By intramuscular injection of E2Inducing the liver of Paralichthys olivaceus to largely transcribe Chg H mRNA, extracting total liver RNA with Trizol, and reverse transcribing to obtain cDNA according to the PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa). Designing upstream and downstream primers with different enzyme cutting sites by using Primer 5.0 to perform PCR amplification, wherein the sequence of the enzyme cutting Primer is as follows: the conditions for PCR amplification of F: CACCCAAGTTTTCAAGTCTCAGCAGTC and R: CCGCTTACTGAGCAGGGTCAATGAAT were: pre-denaturation at 98 deg.C for 1 min, denaturation at 95 deg.C for 20 s, annealing at 55 deg.C for 20 s, extension at 72 deg.C for 1 min and 30 s, and extension at 72 deg.C for 5 min after 30 cycles. The PCR product was recovered and purified by 1% agarose gel electrophoresis. After the purified target fragment was ligated with pClone007 vector using T4 ligase, the ligation product was transformed into DH5 α competent cells, and positive clones were selected for identification and sequencing validation. Carrying out amplification culture on the bacterial liquid with correct sequencing, and carrying out small-scale Plasmid extraction by using easy pure Plasmid MiniPrep Kit to extractThe plasmid of (2) is used as a template, the primers are used for PCR amplification, and the PCR amplification conditions are as follows: pre-denaturation at 98 ℃ for 3 min, denaturation at 98 ℃ for 20 s, annealing at 55 ℃ for 10 s, extension at 72 ℃ for 30 s, final cycle at 72 ℃ for 2 min for 25 cycles, and recovering and purifying the PCR product by 1% agarose gel electrophoresis. Connecting the purified target fragment with a pDE1 expression vector, transforming the connection product to DH5 alpha competent cells, selecting monoclonal positive bacteria for amplification culture and bacterial liquid PCR, transforming the constructed recombinant expression vector to escherichia coli expression host bacteria BL21(DE3), performing amplification culture on the correctly expressed host bacteria, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1 mM, and placing in a constant-temperature shaking table at 37 ℃ for shake culture for 10 hours to obtain the expression vector capable of expressing the egg shell precursor protein. FIG. 1 shows the detection result of the prepared expression vector of egg shell precursor protein of Paralichthys olivaceus.
② preparation of recombinant protein of egg shell precursor protein
Performing amplification culture by using the induced expression condition of the CHg H recombinant protein obtained in the step (1), subpackaging the induced expression escherichia coli into 50 mL centrifuge tubes, centrifuging for 20 min at room temperature and 5000 rpm in a high-speed centrifuge, and collecting thalli precipitates. Adding 25 mL of lysis solution (100 mM NaCl, 50mM Tris, pH8.0) into each tube to resuspend the thalli, adding PMSF, extracting protein by adopting an ultrasonic disruption method, wherein the ultrasonic power is 360W, each cycle of ultrasonic is 2 s, the interval is 3 s, and the total 360 cycles are performed, and the whole ultrasonic process is performed on ice. And after the ultrasonic treatment is finished, placing the suspension at 4 ℃ and centrifuging for 30min at the rotating speed of 12000 rpm, wherein the precipitate obtained by centrifuging is an inclusion body, and the inclusion body contains protein insoluble in a lysate. 25 mL of a washing solution containing 2% Triton X-100 (50 mM Tris, 100 mM NaCl, 0.5 mM EDTA, 2M urea) was added to the inclusion bodies, the inclusion bodies were uniformly sedimented by pipetting, and after standing on ice for 10min, the inclusion bodies were centrifuged at 10000 rpm at 4 ℃ for 20 min in a high-speed centrifuge, and the sediment was retained by discarding the supernatant. The washing was repeated once. Then washing was repeated 2 times with a wash solution containing no Triton X-100. To the washed inclusion bodies, 30 mL of a dissolving solution (100 mM Tris, 500 mM NaCl, 10 mM imidazole, 8M urea, pH =8.0) was added, the mixture was vortexed, and the mixture was stirred overnight on a magnetic stirrer, and the whole procedure was performed at 4 ℃. And (3) centrifuging the dissolved inclusion body in a high-speed centrifuge at 4 ℃ and 10000 rpm for 30min, collecting supernatant, and filtering the supernatant through a 0.45-micron filter membrane to prepare the egg shell precursor protein.
Purification of recombinant protein of egg shell precursor protein
And (4) purifying the recombinant protein of the Chgh of the paralichthys olivaceus in the total protein of the escherichia coli by using the supernatant containing the target protein obtained in the step (II) and nickel ion chelated magnetic beads. The tube containing 2 mL of the suspension of magnetic beads was placed on a magnetic separator for magnetic separation, the preservation solution was removed, and 5mL of Binding Buffer (20 mM Na) was added3PO4500 mM NaCl, 5-50 mM imidazole) into the centrifuge tube with the magnetic beads, blowing and beating the magnetic beads for a plurality of times by a pipette gun to resuspend the magnetic beads, carrying out magnetic separation, and removing the supernatant. And (3) fully mixing and suspending the pretreated magnetic beads and the crude protein sample, placing the mixture on a shaking table, rotationally mixing and incubating the mixture for 30min at room temperature, carrying out magnetic separation, and removing the solution for detection. 10mL of Washing Buffer (20 mM Na) was added3PO4500 mM NaCl and 50-100 mM imidazole) into a magnetic bead tube, blowing and uniformly mixing the mixture again, carrying out magnetic separation, collecting cleaning solution for detection, and repeating the steps for 1 time. Adding 10mL of Washing Buffer again, transferring the mixture to a new tube after resuspension, and adding 1-10 mL of Elution Buffer (20 mM Na)3PO4500 mM NaCl and 500 mM imidazole) are blown and beaten evenly, magnetic separation is carried out, and eluent is collected to obtain high-purity egg shell precursor protein recombinant protein. FIG. 2 shows the result of the detection of the pure egg shell precursor protein of Paralichthys olivaceus.
(2) Preparation of polyclonal antibody against egg shell precursor protein
Immunizing a mouse by using the pure product of the egg shell precursor Protein of the paralichthys olivaceus obtained in the step 1, emulsifying 0.1mL containing 70 mug of egg shell precursor Protein and an isovolumetric Freund's complete adjuvant, injecting the emulsified mixture into the abdominal cavity of the mouse, fully emulsifying the emulsified mixture by using the same dose of egg shell precursor Protein and Freund's incomplete adjuvant after two weeks, performing boosting immunization on a Balb/c mouse, injecting the egg shell precursor Protein into tail veins after one week for boosting immunization, killing the mouse after three days, taking serum of the mouse, and purifying the serum by using a Protein G affinity chromatography column from ascites supernatant to obtain immunoglobulin IgG. And dialyzing the purified antibody for 24 hours by using ultrapure water to obtain the paralichthys olivaceus egg shell precursor protein polyclonal antibody.
(3) Preparation of polyclonal antibody of horse radish peroxidase-labeled mouse anti-paralichthys olivaceus egg shell precursor protein
Adding 1 mg horseradish peroxidase into 2 ml newly-prepared 0.1M NaIO4 solution, and stirring at room temperature in the dark for 20 min; putting the solution into a dialysis bag, and dialyzing with 1mM sodium acetate buffer solution with pH4.4 overnight; adding 0.5 ml of 0.16M ethylene glycol aqueous solution, and standing at room temperature for 30 min; adding 3 mg of purified polyclonal antibody of egg shell precursor protein of Paralichthys olivaceus, placing into a dialysis bag, slowly stirring and dialyzing overnight with 0.05M buffer solution of carbonate with pH of 9.5 to combine the polyclonal antibody of egg shell precursor protein of mouse anti-Paralichthys olivaceus with horse radish peroxidase; adding newly prepared NaBH of 5mg/ml40.1ml of the solution is mixed evenly and put into a dialysis bag and dialyzed with PBS overnight at 4 ℃; centrifuging at 3000 r/min for 30min, and collecting supernatant as polyclonal antibody of horse radish peroxidase-labeled mouse anti-paralichthys olivaceus egg shell precursor protein.
And finally, putting 1 pure product of the egg shell precursor protein of the prepared paralichthys olivaceus, 1 polyclonal antibody against the egg shell precursor protein of the mouse paralichthys olivaceus, 1 polyclonal antibody against the egg shell precursor protein of the paralichthys olivaceus marked by horseradish peroxidase, a blank 96-hole enzyme label plate, coating liquid, sealing liquid, sample diluent, washing liquid, developing liquid and 1 piece of stopping liquid into a box body to form the kit.
The concrete composition is as follows:
1) 1 blank 96-hole enzyme label plate;
2) 1 pure product of the egg shell precursor protein of the paralichthys olivaceus, and diluting the pure product to the required concentration by using a sample diluent before use;
3) 1 count of polyclonal antibody of the mouse anti-paralichthys olivaceus egg shell precursor protein is diluted to 3 mu g/ml by using a coating solution before use;
4) 1 count of polyclonal antibody of egg shell precursor protein of paralichthys olivaceus marked by horseradish peroxidase is diluted by sample diluent according to the volume ratio of 1:4000 before use;
5) 1 each coating solution, washing solution, confining solution, sample diluent, developing solution and terminator, wherein the coating solution is 50mM carbonate buffer solution with pH of 9.6: 1.59g Na2CO3，2.93g NaHCO3Adding distilled water to 1000 ml; the washing solution was 150mM pH7.4 phosphate buffer containing 0.05% Tween-20: 8.0g NaCl, 0.2g KCl, 2.9g Na2HPO4·12H2O，0.2g KH2PO4, 0.5 ml Tween-20, adding distilled water to 1000 ml; the blocking solution was 2% BSA in ph7.4 phosphate buffer: 0.2g BSA was dissolved in 10ml pH7.4 phosphate buffer; the sample diluent was 150mM phosphate buffer containing 0.05% Tween-20, 1% BSA, pH 7.4: 0.1g BSA was dissolved in 10ml blocking solution; the color developing solution is TMB single-component color developing solution produced by Beijing Nuo Bo Laide science and technology Limited company; the stop solution is 2M H2SO4An aqueous solution.
The sandwich ELISA kit for detecting the egg shell precursor protein of the paralichthys olivaceus can be used for detecting endocrine disrupting chemicals. The application method comprises the following steps:
1) diluting a paralichthys olivaceus egg shell precursor protein polyclonal antibody in the kit to 5 mu g/ml by using a coating solution, adding 100 mu l/hole into a blank 96-hole enzyme label plate, coating overnight at 4 ℃, removing the solution in the hole, and washing the solution for 3 times;
2) adding a sealing solution into a 96-well enzyme label plate, incubating at room temperature for 1 hour at a concentration of 300 mu L/well, removing the solution in the well, and washing for 3 times;
3) diluting the pure egg shell precursor protein of the paralichthys olivaceus to 3.9, 7.8, 15.62, 31.25, 62.5, 125 and 250 ng/mL by using a sample diluent; adding each pure product and a sample to be detected in 100 mu L/hole into a 96-hole enzyme label plate, incubating for 1 hour at 37 ℃, removing solution in the hole, and washing for 5 times;
4) adding horseradish peroxidase-labeled paralichthys olivaceus egg shell precursor protein polyclonal antibody diluted by 1:4000 times of sample diluent into a 96-hole enzyme label plate, incubating at room temperature for 1 hour at 100 mu L/hole, discarding the solution in the hole, and washing for 5 times;
5) adding a developing solution into a 96-well enzyme label plate, and reacting at the room temperature and the dark place at 37 ℃ for 10min, wherein the developing solution is 100 mu L/well;
6) adding a stop solution after the yellow color is obvious, wherein the concentration of the stop solution is 50 mu L/hole;
7) measuring the light absorption value of each hole under the wavelength of 450 nm by using an enzyme-labeling instrument, wherein the measurement is carried out within 15 minutes after the stop solution is added;
8) and (3) calculating: and taking the logarithmic value of the concentration of the standard substance as an abscissa and the OD value as an ordinate to make a standard curve, calculating a linear regression equation of the standard curve by using the concentration of the standard substance and the OD value, substituting the OD value of the sample into the equation, calculating the concentration of the sample, and multiplying the concentration by a dilution factor to obtain the actual concentration of the egg shell precursor protein of the paralichthys olivaceus in the sample. The result of ELISA detection of the paralichthys olivaceus egg shell precursor protein standard by using the kit is shown in figure 3.
Sequence listing
<110> China oceanic university
<120> Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213> Paralichthys olivaceus (Paralichthys oliveus)
<400> 1
cacccaagtt ttcaagtctc agcagtc 27
<210> 2
<211> 26
<212> DNA
<213> Paralichthys olivaceus (Paralichthys oliveus)
<400> 2
ccgcttactg agcagggtca atgaat 26
Claims (3)
1. A sandwich ELISA kit for detecting egg shell precursor protein of Paralichthys olivaceus comprises 1 blank 96-hole ELISA plate, 1 coating solution, sealing solution, sample diluent, washing solution, developing solution and stop solution,
the kit is characterized by also comprising 1 pure product of the egg shell precursor protein of the paralichthys olivaceus, 1 polyclonal antibody of the egg shell precursor protein of the mouse anti-paralichthys olivaceus and 1 polyclonal antibody of the egg shell precursor protein of the mouse anti-paralichthys olivaceus marked by horseradish peroxidase;
the pure product of the egg shell precursor protein of the paralichthys olivaceus is prepared by the following method:
(1) by intramuscular injection 17βEstradiol induces the liver of the paralichthys olivaceus to largely transcribe Chg H mRNA, Trizol is used for extracting liver total RNA, cDNA is obtained through reverse transcription, the reversed cDNA is taken as a template, PCR amplification is carried out by using primers F: CACCCAAGTTTTCAAGTCTCAGCAGTC and R: CCGCTTACTGAGCAGGGTCAATGAAT, and a target fragment is recovered; connecting the target fragment with pClone007 vector by using T4 ligase, transforming the ligation product into DH5 alpha competent cells, sequencing, carrying out amplification culture on the correctly sequenced cells, extracting plasmids, carrying out PCR amplification by using the primers, cutting gel and recovering the target fragment;
(2) after the recovered target fragment is connected with a pDE1 expression vector, the connection product is transformed into an expression host bacterium BL21(DE 3); carrying out amplification culture on the correctly expressed host bacteria, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1 mM, placing the mixture in a constant-temperature shaking table at 37 ℃ for shake culture for 10 hours, centrifuging the cultured bacterial solution for 20 min at 5000 rpm, collecting precipitates, carrying out treatment on the precipitates, centrifuging again to collect inclusion bodies, and adding 30 mL of a dissolving solution into the inclusion bodies, wherein the dissolving solution is 100 mM Tris, 500 mM NaCl, 10 mM imidazole, 8M urea and the pH value is 8.0; stirring overnight at 4 ℃; centrifuging the dissolved inclusion body at 10000 rpm for 30min, collecting the supernatant, filtering the supernatant with a 0.45 mu m filter membrane, and purifying by using nickel ion chelated magnetic beads to obtain a pure product of the egg shell precursor protein of the paralichthys olivaceus;
the polyclonal antibody of the mouse anti-paralichthys olivaceus egg shell precursor protein is prepared by the following method:
emulsifying 0.1mL of a pure product of the egg shell precursor Protein of the paralichthys olivaceus, which is obtained by the above steps, and an isovolumetric Freund complete adjuvant, injecting the emulsified pure product into the abdominal cavity of a mouse, fully emulsifying the pure product of the egg shell precursor Protein of the paralichthys olivaceus and the Freund incomplete adjuvant with the same dosage after two weeks, performing boosting immunization on a Balb/c mouse, injecting the pure product of the egg shell precursor Protein of the paralichthys olivaceus into the tail vein after one week, performing boosting immunization, taking the serum of the mouse after three days, purifying the serum by using a Protein G affinity chromatography column to obtain immunoglobulin IgG, dialyzing the purified immunoglobulin IgG by a PBS buffer solution for 24 hours, and obtaining the polyclonal antibody of the anti-paralichthys olivaceus egg shell precursor Protein of the mouse;
the horse radish peroxidase labeled mouse anti-paralichthys olivaceus egg shell precursor protein polyclonal antibody is prepared by the following method:
adding 1 mg of horseradish peroxidase to 2 ml of freshly prepared 0.1M NaIO4Stirring the solution for 20 min in the dark; putting the solution into a dialysis bag, and dialyzing with 1mM sodium acetate buffer solution with pH4.4 overnight; adding 0.5 ml of 0.16M ethylene glycol aqueous solution, and standing at room temperature for 30 min; adding 1 mg of the paralichthys olivaceus egg shell precursor protein polyclonal antibody obtained in the above step, and dialyzing with 0.05M carbonate buffer solution with pH of 9.5 overnight to allow the mouse anti-paralichthys olivaceus egg shell precursor protein polyclonal antibody to be fully combined with horseradish peroxidase; add 5mg/ml NaBH40.1ml of the solution is mixed evenly and put into a dialysis bag to be dialyzed overnight by PBS at 4 ℃; centrifuging at 3000 r/min for 30min, and collecting supernatant as polyclonal antibody of horse radish peroxidase-labeled mouse anti-paralichthys olivaceus egg shell precursor protein.
2. The application of the Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit of claim 1 in the detection of estrogen pollution in marine environment.
3. The method for detecting endocrine disrupting chemicals by using the Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit of claim 1, which comprises the steps of:
1) diluting a paralichthys olivaceus egg shell precursor protein polyclonal antibody in the kit to 5 mu g/ml by using a coating solution, adding 100 mu L/hole into a blank 96-hole enzyme label plate, coating overnight at 4 ℃, discarding the solution in the hole, and washing for 3 times;
2) adding a sealing solution into a 96-well enzyme label plate, incubating at room temperature for 1 hour at a concentration of 300 mu L/well, removing the solution in the well, and washing for 3 times;
3) diluting the pure egg shell precursor protein of the paralichthys olivaceus to 3.9, 7.8, 15.62, 31.25, 62.5, 125 and 250 ng/mL by using a sample diluent as a standard substance; adding each pure product and a sample to be detected in 100 mu L/hole into a 96-hole enzyme label plate, incubating for 1 hour at 37 ℃, removing solution in the hole, and washing for 5 times;
4) adding horseradish peroxidase-labeled paralichthys olivaceus egg shell precursor protein polyclonal antibody diluted by 1:4000 times of sample diluent into a 96-hole enzyme label plate, incubating at room temperature for 1 hour at 100 mu L/hole, discarding the solution in the hole, and washing for 5 times;
5) adding a developing solution into a 96-well enzyme label plate, and reacting at the room temperature and the dark place at 37 ℃ for 10min, wherein the developing solution is 100 mu L/well;
6) adding a stop solution after the yellow color is obvious, wherein the concentration of the stop solution is 50 mu L/hole;
7) measuring the light absorption value of each hole under the wavelength of 450 nm by using an enzyme-labeling instrument, wherein the measurement is carried out within 15 minutes after the stop solution is added;
8) and (3) calculating: and taking the logarithmic value of the concentration of the standard substance as an abscissa and the OD value as an ordinate to make a standard curve, calculating a linear regression equation of the standard curve by using the concentration of the standard substance and the OD value, substituting the OD value of the sample into the equation, calculating the concentration of the sample, and multiplying the concentration by a dilution factor to obtain the actual concentration of the egg shell precursor protein of the paralichthys olivaceus in the sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910070322.6A CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910070322.6A CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109884323A CN109884323A (en) | 2019-06-14 |
| CN109884323B true CN109884323B (en) | 2021-08-20 |
Family
ID=66926865
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910070322.6A Expired - Fee Related CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109884323B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8395018B2 (en) * | 2010-03-24 | 2013-03-12 | City University Of Hong Kong | Transgenic fish and uses thereof |
-
2019
- 2019-01-25 CN CN201910070322.6A patent/CN109884323B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN109884323A (en) | 2019-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107266569B (en) | Preparation method of tussah silk fibroin monoclonal antibody | |
| CN102747042A (en) | Hybridoma cell line 10G4 and anti-alfatoxin total (B1, B2, G1 and G2) monoclonal antibody produced by the same | |
| CN105440132B (en) | The monoclonal antibody and its application of porcine epidemic diarrhea resisting viral N proteins | |
| CN109709339B (en) | Colloidal gold immunochromatographic test strip for detecting skeletal muscle troponin I of cattle or sheep and application thereof | |
| CN105541655B (en) | The general artificial semiantigen of Capsaicinoids, artificial complete antigen and its application | |
| CN109001450A (en) | A kind of kit and preparation method detecting chicken Mycoplasma synoviae antibody | |
| CN101362800A (en) | Test strip for rapid detection of brucella | |
| Mazalovska et al. | Detection of serum antibodies to hepatitis E virus based on HEV genotype 3 ORF2 capsid protein expressed in nicotiana benthamiana | |
| CN110954690A (en) | ELISA antibody detection kit for detecting echinococcosis in sheep and application thereof | |
| CN109884323B (en) | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof | |
| CN113325172A (en) | Novel coronavirus detection kit | |
| CN109884324B (en) | Immunofluorescence kit for detecting egg shell precursor protein of paralichthys olivaceus and application of immunofluorescence kit | |
| CN110726837A (en) | ELISA detection kit for fasciolopsis diagnosis and application thereof | |
| CN115028713A (en) | Antibody for resisting coronavirus N protein and application thereof | |
| CN103965348A (en) | Monopterus albus estrogen receptor alpha gene, encoding protein and enzyme-linked immunosorbent assay method | |
| CN112279901B (en) | Sea cucumber fucosan specific binding protein and preparation and application thereof | |
| CN111220809B (en) | Colloidal gold immunochromatography test strip for detecting chicken or duck skeletal muscle troponin I and preparation method and application thereof | |
| CN106198974A (en) | The ELISA detection kit of IHNV antibody in a kind of quick detection rainbow trout serum | |
| CN101497665B (en) | Human fiber plasminogen Kringle5 polyclonal antibody, and preparation and use thereof | |
| CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| CN106749668A (en) | Anti- IDO1 protein monoclonal antibodies and application thereof | |
| CN102532310B (en) | Monoclonal antibody against grass carp reovirus VP5 protein and application of monoclonal antibody | |
| CN113735968A (en) | Method for measuring titer of swine transmissible gastroenteritis virus N protein antibody | |
| US20070161048A1 (en) | Anti nc1 monoclonal antibody | |
| CN101907624A (en) | Immune affinity chromatographic column for rhodamine 6G and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210820 Termination date: 20220125 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |