CN110954690A

CN110954690A - ELISA antibody detection kit for detecting echinococcosis in sheep and application thereof

Info

Publication number: CN110954690A
Application number: CN201911388210.1A
Authority: CN
Inventors: 刘河冰; 温凯; 杨柳; 李蓉蓉; 马立才
Original assignee: Beijing Wdwk Biotechnology Co ltd
Current assignee: Beijing Mingrida Technology Development Co ltd
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2020-04-03
Anticipated expiration: 2039-12-30
Also published as: CN110954690B

Abstract

The invention discloses a sheep echinococcosis ELISA antibody detection kit, a preparation method and application thereof. In the detection kit, an enzyme label plate is pre-coated with echinococcus granulosus cocktail antigen; the echinococcus granulosus cocktail antigen is composed of echinococcus granulosus cocktail antigen consisting of EPC1 recombinant antigen, EgAgB1 recombinant antigen, EgAgB2 recombinant antigen and EgAgB4 recombinant antigen. The detection kit provided by the invention can be used for quickly detecting the hydatid antibody in the serum of the sheep, is simple to operate, short in time consumption, high in sensitivity and good in specificity, and is convenient for detecting a large number of samples at the same time. The kit for detecting the echinococcosis in sheep by using the ELISA antibody provided by the invention has important application value in the detection of the echinococcosis antibody level and the epidemiological investigation.

Description

ELISA antibody detection kit for detecting echinococcosis in sheep and application thereof

Technical Field

The invention belongs to the field of enzyme-linked immunosorbent assay, and relates to a sheep echinococcosis ELISA antibody detection kit, and a preparation method and application thereof.

Background

Echinococcosis is a zoonosis caused by the parasitism of echinococcus larvae in human bodies or animals, which is classified as a second class animal epidemic disease in China, and is classified as a B class animal disease in OIE. Echinococcosis can parasitize any organ in the host, press surrounding tissues to cause atrophy and dysfunction, and rupture of the sac can cause secondary infection or shock, even death. There are 5 kinds of echinococcus tapeworms which are confirmed at present, wherein cystic echinococcosis caused by the fine-grained echinococcus tapeworm is concentrated in the big province of livestock in northwest of China, and the infection of sheep, cattle and pigs is particularly serious, thus threatening public health safety and livestock production.

The current "gold standard" for diagnosing echinococcosis is a dissection method that sometimes fails to identify suspicious lesions or cysts. Relevant agricultural industry standards in China include indirect hemagglutination experiments, enzyme-linked immunosorbent assays and polymerase chain reactions. The indirect hemagglutination test is carried out by taking cells as a carrier to be specifically combined with antigen and antibody, and has high accuracy, less time consumption, easy influence by environment and poor clinical usability; the polymerase chain reaction has good specificity, sensitivity and repeatability, but has higher requirements on hardware conditions of laboratories, and is difficult to popularize in basic veterinary laboratories.

Enzyme-linked immunosorbent assay is one of the more common immunological methods for detecting echinococcosis in recent years. Has the advantages of rapidness, simplicity, convenience, low cost, capability of detecting a large number of samples and the like, and is widely applied to laboratory diagnosis of echinococcosis and population epidemiological investigation. Antigen B (Antigen B, AgB) is the main Antigen component of echinococcus granulosus cyst fluid, accounts for 90% of the crude Antigen, and is considered to be an Antigen with high sensitivity and specificity in immunodiagnostic tests. Wherein EgAgB1, EgAgB2 and EgAgB4 are main reaction subunits for serum detection. Echinococcus granulosus-metacercaria calcium binding protein 1 (EPC 1) has a strong diagnostic potential for cysticercosis. Therefore, the invention establishes the kit for detecting the echinococcosis ovis ELISA antibody, which is simple, convenient, rapid and specific in operation, by forming the echinococcosis granulosa cocktail antigen by using the EPC1 recombinant antigen, the EgAgB1 recombinant antigen, the EgAgB2 recombinant antigen and the EgAgB4 recombinant antigen.

Disclosure of Invention

In order to solve the technical problem, the invention provides an ELISA antibody detection kit for echinococcosis ovis, which comprises an enzyme label plate precoated with echinococcus granulosus cocktail antigen, a positive control solution, a negative control solution, an enzyme marker concentrated solution, an enzyme marker diluent, a sample diluent, a substrate A solution, a substrate B solution, a stop solution, a washing solution and a serum dilution plate; the echinococcus granulosus cocktail antigen is composed of EPC1 recombinant antigen, EgAgB1 recombinant antigen, EgAgB2 recombinant antigen and EgAgB4 recombinant antigen.

In the antibody detection kit, the elisa plate is made of a 96-hole solid-phase elisa plate NUNC-468667.

In the antibody detection kit, the concentration ratio of the EPC1 recombinant antigen, the EgAgB1 recombinant antigen, the EgAgB2 recombinant antigen and the EgAgB4 recombinant antigen expressed in the echinococcus granulosus cocktail antigen is 2:1:2: 1.

The invention also provides a preparation method of the sheep echinococcosis ELISA antibody detection kit, which comprises the following steps:

1) preparation of echinococcus granulosus cocktail antigen: by taking an echinococcus granulosus cDNA library as a template, specific primers are designed aiming at EPC1, EgAgB1, EgAgB2 and EgAgB4 gene sequences, target fragments are amplified through PCR and cloned to an expression vector pET28a, successfully constructed recombinant expression plasmids pET28a-EPC-1, pET28a-EgAgB1, pET28a-EgAgB2 and pET28a-EgAgB4 are transformed into escherichia coli BL21 (DE 3), IPTG induced expression is carried out, and EPC1 recombinant protein, EgAgB1 recombinant protein, EgAgB2 recombinant protein and EgAgB4 recombinant protein are obtained after high purification through affinity chromatography and molecular sieve chromatography.

2) Preparing an echinococcus granulosus cocktail antigen precoated enzyme label plate: diluting cyst fluid protein with carbonate buffer solution into antigen coating solution with concentration of 5 μ g/mL, coating for 16h at 2-8 deg.C and washing plate, wherein each well is 100 μ L; then adding 200 μ L of sealing liquid into each well, sealing at 37 deg.C and humidity of 30-40% for 2 hr, and drying at constant temperature of 37 deg.C and humidity of 30-40% for 2 hr. The final concentrations of EPC1 recombinant antigen, EgAgB1 recombinant antigen, EgAgB2 recombinant antigen and EgAgB4 recombinant antigen in the echinococcus granulosus cocktail antigen are 2.8mg/mL, 1.4mg/mL, 2.8mg/mL and 1.4mg/mL respectively;

3) preparation of positive control solution: the test was diluted 1:100 times with sheep combatting worm 270 day serum.

4) Preparation of negative control solution: the serum of healthy sheep is diluted 1:100 times.

5) Preparation of enzyme-labeled concentrate: and (3) diluting the HRP-Mouse Anti-goat IgG 1 marked by horseradish peroxidase by 30000 times.

6) Preparation of enzyme marker diluent: 0.01M PBST solution pH 7.4.

7) Preparation of sample diluent: 0.01M PBS solution, pH7.4.

8) Preparation of substrate A solution: contains urea peroxide 0.08%, PEG-2000 0.025%, disodium hydrogen phosphate dodecahydrate 3.58%, and citric acid monohydrate 0.96%, and has pH adjusted to 7.4.

9) Preparation of substrate B solution: contains 1.03% citric acid monohydrate, 0.04% TMB, 0.0008% sodium thiosulfate, 0.1% light stabilizer 292 and 3% DMF water solution, and the pH value is adjusted to 5.0.

10) Preparation of stop solution: it contains 0.1% 10% SDS, 5.56% sulfuric acid aqueous solution.

11) Preparation of a washing solution: 0.25M PBST solution pH 7.4.

Wherein, the primer used in the preparation of the EPC1 recombinant antigen in the step 1) is shown as a sequence 1-2 in a sequence table, and the EPC1 recombinant antigen nucleic acid sequence can be shown as a sequence 3 in the sequence table; the primer used in the preparation of the EgAgB1 recombinant antigen is shown as a sequence 4-5 in a sequence table, and the nucleic acid sequence of the EgAgB1 recombinant antigen can be shown as a sequence 6 in the sequence table; the primer used in the preparation of the EgAgB2 recombinant antigen is shown as a sequence 7-8 in a sequence table, and the nucleic acid sequence of the EgAgB2 recombinant antigen can be shown as a sequence 9 in the sequence table; the primer used in the preparation of the EgAgB4 recombinant antigen is shown as a sequence 10-11 in a sequence table, and the nucleic acid sequence of the EgAgB4 recombinant antigen can be shown as a sequence 12 in the sequence table.

The invention also provides application of the sheep echinococcosis ELISA antibody detection kit in echinococcosis detection.

The antibody detection kit adopts an indirect ELISA method, the echinococcosis specific antibody in a sample to be detected is combined with the antigen on the coating plate, an enzyme marker is added, the substrate is catalyzed for color development, the color development depth is in direct proportion to the antibody content in the sample, and the color development is deep, high in content, light in color development and low in content.

The kit for detecting the echinococcosis ovis ELISA antibody, which is established by using the echinococcus granulosus cocktail antigen, has the advantages of high sensitivity and specificity, simple and quick operation, convenience for simultaneously detecting a large number of samples and high practicability. Provides an important method in the aspects of antibody level detection and epidemiological investigation of the hydatid ovis.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 preparation of sheep echinococcosis ELISA antibody detection kit

1. Composition of sheep echinococcosis ELISA antibody detection kit

The kit for detecting the echinococcosis ovis ELISA antibody comprises a echinococcosis granulosa cocktail antigen pre-coated ELISA plate, a positive control solution, a negative control solution, an enzyme marker concentrated solution, an enzyme marker diluent, a sample diluent, a substrate A solution, a substrate B solution, a stop solution, a washing solution and a serum diluent plate.

2. Preparation of sheep echinococcosis ELISA antibody detection kit

1) Preparation of echinococcus granulosus cocktail antigen

A. Primer design

Primers were designed based on the EPC-1 (accession No. AF 481884), EgAgB1 (accession No. Z26336.1), EgAgB2 (accession No. JN 050887.1), EgAgB4 (accession No. AY 871031.1) sequences in GeneBank:

EPC-1-F： GGATCC GCCGTACTATGAGTCTTCA

EPC-1-R： AAGCTT TCTAGGCTTAATTCGCCGTC

EgAgB1-F： GGATCC CCTCGACGTCGAGGAGTGTG

EgAgB1-R： AAGCTT TCTGAGGTGGGACTTAAGTG

EgAgB2-F： GGATCC GCACACATGGGGCAAGTGGTA

EgAgB2-R： AAGCTT CATCTTTTTCTTCCACCAAA

EgAgB4-F： GGATCC AGATGCAAGTGCCTCATAATG

EgAgB4-R： AAGCTT CTTCTTCTTCCAGCAAATC

the underlined parts being introducedBamHI andHindIII enzyme cutting site.

Extraction of Echinococcus granulosus total RNA

Extraction was performed according to RNAiso Plus (Total RNA) extraction kit instructions, as follows:

① grinding and homogenizing the sample by placing 100mg of the metacercaria in a mortar, adding 1mL of RNAioso Plus solution, grinding thoroughly for 1min, transferring the homogenate to a centrifuge tube, standing at room temperature (20-25 deg.C) for 5min, centrifuging at 12000g at 4 deg.C for 5min, carefully pipetting the supernatant, transferring to a new centrifuge tube (without pipetting the pellet);

② Total RNA is extracted by adding 0.2mL chloroform to the homogenate, mixing until the solution is milky white, standing at room temperature for 5min, centrifuging at 12000g 4 deg.C for 15min, taking out the centrifuge tube from the centrifuge, separating the homogenate into three layers, i.e. colorless supernatant (containing RNA), middle white protein layer (mostly DNA) and colored lower organic phase, and transferring the supernatant to another new centrifuge tube (without sucking out the white middle layer);

③ cleaning RNA precipitate, adding 1mL isopropanol into supernatant, inverting centrifuge tube, mixing, standing at room temperature for 10min, 12000g, centrifuging at 4 deg.C for 10min to obtain RNA precipitate at the bottom of the tube, discarding the supernatant carefully, adding 1mL 75% ethanol, washing the tube wall slightly, inverting centrifuge tube slightly, centrifuging at 7500g 4 deg.C for 5min, discarding the supernatant carefully, and discarding the precipitate;

④ dissolving RNA by opening the cover of the centrifuge tube, drying the precipitate at room temperature for 5min, adding 50 μ L of RNase-free water to dissolve the precipitate;

the integrity of the total RNA extracted is identified by 1% agarose gel electrophoresis, and the purity is detected by a nucleic acid protein determinator. The total RNA concentration of each group of samples was diluted to 100 ng/. mu.L and stored at-70 ℃ for further use.

Obtaining cDNA by reverse transcription

Taking 0.3 mu g of total RNA of the metacercaria, and adding the mixture into the following reaction system: 5 μ L of 5 XM-MLV reaction buffer, 1 μ L of dNTP, 1 μ L of M-MLV reverse transcriptase, 0.5 μ L of RNase inhibitor, 1 μ L of oLigo (dT), and 25 μ L of RNAase-free water. Mixing and water bathing at 42 deg.C for 60 min.

Construction of expression vectors

① PCR amplification of EPC-1, EgAgB1, EgAgB2 and EgAgB4 antigen gene fragments₂O36.5. mu.L, 10 XPCR reaction wash 5. mu.L, dNTP 1. mu.L, Taq DNA polymerase 0.5. mu.L, upstream and downstream primers 2. mu.L each, and cDNA template 3. mu.L. Pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 45s, annealing at 53 ℃ for 45s, extension at 72 ℃ for 45s, and final extension at 72 ℃ for 10min after 30 cycles; PCR products were recovered from the gel.

② double enzyme digestion of target gene and plasmid DNA, target gene enzyme digestion reaction system, 10 mul target gene,BamHIthe enzyme is added in an amount of 2. mu.L,HindIIIenzyme 2. mu.L, 10 Xdouble digestion buffer 2. mu.L, ddH₂O4. mu.L. pET28a plasmid digestion reaction system: 10. mu.L of pET28a plasmid DNA (pET28a),BamHi, 2 mu L of enzyme is added,HindIII enzyme 2. mu.L, 10 Xdouble digestion buffer 2. mu.L, ddH₂O4. mu.L. Water bath at 37 deg.c for 120min, and recovering enzyme product.

③ the target gene fragment after double digestion is connected with the pET28a plasmid fragment, the connection reaction system comprises 4 mu L of the target gene fragment, 1.5 mu L of the pET28a plasmid fragment and T₄DNA ligase 1. mu.L, 10 Xligation reaction buffer 1. mu.L. Ligation was carried out overnight at 16 ℃.

④ transformation of DH5a competent cells ligation products were transformed by low temperature calcium chloride co-precipitationEcoliDH5a competent cells, single colonies were PCR identified and sequenced.

⑤ transformation of BL21 (DE 3) competent cells, which is to extract pET28a-EPC-1, pET28a-EgAgB1, pET28a-EgAgB2 and pET28a-EgAgB4 expression vectors from strains with correct sequencing, transform BL21 (DE 3) competent cells by chemical transformation, and take single colonies for PCR identification and conservation.

Recombinant protein induced expression and purification

Respectively carrying out amplification culture on 4 expression bacteria which are verified to be correctly transferred into plasmids pET28a-EPC-1, pET28a-EgAgB1, pET28a-EgAgB2 and pET28a-EgAgB4, inoculating 10mL of expression strain bacterial liquid into fresh LB (50 mu g/mL, Kana) culture liquid, and carrying out shaking culture on a shaker at 37 ℃ for 180r/min until the bacterial liquid OD (origin-to-destination) is reached₆₀₀When the concentration is 0.4-0.6, IPTG with the final concentration of 1mM is added, and the induction expression is carried out for 6h at 37 ℃. Collecting 1L of IPTG-induced bacterial liquid, centrifuging at 5000rpm and 4 ℃ for 20min, discarding the supernatant, suspending the precipitate with 40mL of PBS, centrifuging at 8000rpm and 4 ℃ for 30min, and sucking the supernatant.

Highly purified EPC-1, EgAgB1, EgAgB2, and EgAgB4 recombinant proteins:

highly purifying EPC-1, EgAgB1, EgAgB2 and EgAgB4 recombinant proteins by adopting affinity chromatography and molecular sieve chromatography, and specifically adopting the following method:

buffer solution: 50mM PBS buffer pH7.4 (19 mL 0.5M NaH)₂PO₄，81mL 0.5M Na₂HPO₄29.3g of NaCl dissolved in water to a volume of 1000 mL).

① affinity chromatography purification, loading nickel agarose gel column with 1.6 × 20cm size of column bed volume of 10mL, balancing 2-5 bed volumes with buffer solution at flow rate of 2mL/min, filtering 20mL Escherichia coli cell disruption solution (50 mM PBS, pH7.4, 0.5M NaCl) with 0.45 μ M filter membrane, loading at flow rate of 1mL/min, washing 2-5 bed volumes with buffer solution at flow rate of 2mL/min, performing stage elution with buffer solutions respectively containing 30, 80, 120, and 500 imidazole at flow rate of 2mL/min, collecting elution peaks at each stage, washing 5 bed volumes with pure water, washing 3 bed volumes with 20% ethanol at flow rate of 2mL/min, storing the column at 4-8 deg.C, detecting size and purity of target protein in imidazole with different concentrations by SDS-PAGE, and storing the eluate at-80 deg.C.

② molecular sieve purification, namely, pre-loading a Sephadex G-75 column by using an AKTA Purifier 100 system of GE Healthcare company, USA, connecting the Sephadex G-75 column with the AKTA system, wherein the flow rate is 1mL/min, balancing the Sephadex G-75 column by using 0.02mol/L phosphate buffer solution (pH 6.5) with 5-10 column volumes until the ultraviolet absorption curve is stable, carrying out protein loading by using 0.1mL loading ring after the ultraviolet absorption peak is zero, eluting by using 0.02mol/L phosphate buffer solution (pH 6.5), adjusting the flow rate to 0.2-0.5 mL/min, opening a collector to collect a tube (3 mL/tube) every 10min, carrying out SDS-PAGE verification to verify the size and purity, combining similar tubes, sequentially dialyzing and concentrating by using a 3KDa tube to obtain EPC-1 recombinant protein, EgB 1 recombinant protein, EgAgB2 recombinant protein and AggEgEgEgB 4 recombinant protein, and carrying out purification on the result by checking through PAGE and PAGE.

2) Preparation of echinococcus granulosus cocktail antigen pre-coated ELISA plate

Diluting the purified cocktail antigen with carbonate buffer solution (0.795 g sodium carbonate, 1.465g sodium bicarbonate dissolved in water, diluting to 500mL, adjusting pH to 9.6) to obtain antigen coating solution with concentration of 5 μ g/mL, transferring 100 μ L of antigen coating solution, injecting into each well of 96-well enzyme-labeled plate, coating at 2-8 deg.C for 16h, and washing the coating solution with 0.01M PBST solution. Accurately transferring 200 mu L of confining liquid (7 g of sucrose, 4.5g of casein, 30mL of calf serum, 500 mu L of Proclin 300 dissolved in 0.01MPBST solution, and constant volume to 1000 mL), respectively injecting into each hole of a 96-hole coated enzyme label plate, confining for 2h at 37 ℃ and humidity of 30-40%, and discarding the confining liquid. And (3) placing the coated plate without the confining liquid into a constant-temperature drying box, and drying at the constant temperature of 37 ℃ and the humidity of 30-40% for 2 h.

3) Preparation of Positive control solution

And (3) infecting sheep fasciola ova and 1000 ova per sheep for a test qualified by inspection, collecting blood for 270 days of attacking insects, separating serum, diluting the serum by 1:100 times, performing sterile filtration, adding Proclin 300 with the final concentration of 0.05%, and performing sterile subpackaging by 1 mL/tube.

4) Preparation of negative control solution

And (4) sampling blood from the vein of the qualified healthy sheep, separating serum, and diluting the serum by 1:100 times. After sterile filtration, Proclin 300 was added to a final concentration of 0.05% and aseptically dispensed at 1 mL/tube.

5) Preparation of enzyme-labeled concentrate

Horse radish peroxide labeled Mouse Anti-goat IgG-HRP 20. mu.L was added to the enzyme conjugate diluent to 6mL, filtered, and aseptically aliquoted at 0.12 mL/tube.

6) Preparation of enzyme-labeled diluent

Dissolving 0.45g of monopotassium phosphate, 3.125g of disodium hydrogen phosphate dodecahydrate, 0.65g of sodium chloride, 0.04g of potassium chloride, 30 mu L of tween-20 and 150 mu L of Proclin 300 in water, adjusting the pH value to 7.4, filtering, performing aseptic subpackaging, and performing aseptic subpackaging for 12 mL/bottle.

7) Preparation of sample dilutions

1.485g of potassium dihydrogen phosphate, 10.313g of disodium hydrogen phosphate dodecahydrate, 2.145g of sodium chloride, 0.132g of potassium chloride and 495 mu L of Proclin 300 are dissolved in water, the volume is up to 1650mL, the pH value is adjusted to 7.4, and the mixture is filtered, sterilized and packaged in 40 mL/bottle.

8) Preparation of substrate A solution

Dissolving 0.216g of carbamide peroxide, 0.8978 g of PEG-20000.0675 g of disodium hydrogen phosphate dodecahydrate, 9.666g of citric acid monohydrate and 2.592g of citric acid monohydrate in water, diluting to 270mL, adjusting the pH value to 7.4, filtering, and carrying out sterile subpackaging in 6 mL/bottle.

9) Preparation of substrate B solution

2.781g of citric acid monohydrate, 0.108g of TMB, 0.0226g of sodium thiosulfate, 0.27g of light stabilizer 292 and 8.1mL of sodium thiosulfate are dissolved in water, the volume is adjusted to 270mL, the pH value is adjusted to 5.0, and the mixture is filtered and sterilized and packaged in 6 mL/bottle.

10) Preparation of stop solution

Adding 250mL of purified water into a beaker, slowly adding 15.012mL of sulfuric acid while stirring, adding 0.27mL of 10% SDS, diluting to 270mL, filtering, and aseptically packaging in 6 mL/bottle.

11) Preparation of the washing solution

31.50g of monopotassium phosphate, 17.50g of disodium hydrogen phosphate dodecahydrate, 45.50g of sodium chloride, 2.80g of potassium chloride, 2.1mL of Tween-20 and 420 mu L of Proclin 300 are dissolved in water, the volume is determined to be 1400mL, the pH value is adjusted to 7.4, the solution is filtered, and sterile packaging is carried out in 30 mL/bottle.

12) Assembly

a) Pre-coating an enzyme label plate by using echinococcus granulosus cocktail antigen: 1 block (8 holes X12 strips)

b) Positive control solution: 1 tube (1 mL)

c) Negative control solution: 1 tube (1 mL)

d) Enzyme label concentrate: 1 tube (0.12 mL)

e) Enzyme label diluent: 1 bottle (12 mL)

f) Sample diluent: 1 bottle (40 mL)

g) Substrate A solution: 1 bottle (6 mL)

h) Substrate B solution: 1 bottle (6 mL)

i) Stopping liquid: 1 bottle (6 mL)

j) Washing liquid: 1 bottle (25X, 30 mL)

k) Serum dilution plate: 1 block

l) coverplate film: 1 sheet of paper

3. Performance verification of sheep echinococcosis ELISA antibody detection kit

1) Sensitivity: respectively using 3 batches of sheep echinococcosis ELISA antibody detection kits and indirect hemagglutination test to simultaneously detect 5 parts of sheep echinococcosis positive quality control substances and 15 parts of clinical serum samples which are detected to be positive, and comparing detection results.

Indirect hemagglutination assay detection method (IHA)

Diluting the serum to be detected: diluting the sample to be detected to seven titers of 1:4, 1:8, 1:16, 1:32, 1:64, 1:128 and 1:256 with 0.15mol/L PBS diluent (pH = 7.2), and adding the diluted sample to the well; the positive reference serum was diluted to seven titers of 1:4, 1:16, 1:64, 1:256, 1:1024, 1:4096 and 1:16384 and added to the control wells; diluting the negative reference serum and the serum to be detected, adding the diluted reference serum into a control hole, adding the diluted solution into the control hole through a diluted solution control hole, wherein the sample adding amount of each hole is 25 mu L;

adding a diagnostic solution: after shaking the antigen evenly, dripping 25 mu L of sensitized erythrocyte into each hole;

and (3) hemagglutination: oscillating the test microplate for 1-2min, taking down, covering the glass plate, and reacting at room temperature for 2-3 h;

the test is satisfied under the conditions: the diluent control does not agglutinate, the negative reference serum is not higher than 1:16, and the antibody titer of the positive reference serum is the specified value of the product (1: 1024-1: 4096);

and (3) judging standard: the 100% blood cells form a homogeneous membrane-like agglutination under the pore wall, with neat and compact edges; the "+++" 75% of the blood cells form membrane-like aggregates under the walls of the wells, but the non-aggregated blood cells are concentrated in the center of the bottom of the wells as a small dot; the ++ "50% of the blood cells form sparse agglutination at the lower part of the hole wall, and the non-agglutinated blood cells integrate a large round point at the center of the hole bottom; "+" 25% of the blood cells agglutinate at the bottom of the well, the non-agglutinated blood cells are concentrated into a large circular dot at the center of the bottom of the well; "-" all erythrocytes did not agglutinate, concentrated in the center of the bottom of the well as a maximum circle.

And (4) judging a result: using a V-shaped plate, taking "+ +" as a positive end point, and judging the sample to be detected to be positive when the antibody titer of the sample to be detected is equal to or higher than a positive specified value (1: 64); the antibody titer of the sample to be detected is lower than 1:64, namely, the third well (1: 64) is a plus or minus, and the sample is judged to be negative.

The detection results of the sheep echinococcosis ELISA antibody detection kit and the indirect hemagglutination test are shown in Table 1, and the positive results are consistent with the indirect hemagglutination test results and have 100% sensitivity.

TABLE 1 results of sensitivity test

2) Specificity: using 3 batches of the echinococcosis ovis ELISA antibody detection kit to detect 5 parts of the echinococcosis ovis negative quality control product, 1 part of brucella antibody positive sample, 1 part of peste des petits ruminants virus antibody positive sample, 1 part of mycoplasma ovipneumoniae antibody positive sample, 1 part of cercaria tenuis antibody positive sample, 1 part of cercaria cerebralis antibody positive sample and 15 parts of clinical serum samples which are detected to be negative. As shown in Table 2, the detection results of the samples are negative, the specificity is 100%, and the samples do not intersect with a Brucella antibody positive sample, a Peste des petits ruminants virus antibody positive sample, a Mycoplasma ovipneumoniae antibody positive sample, a Coccidiosis tenuis antibody positive sample and a Coccidiosis cerebralis antibody positive sample.

TABLE 2 results of specificity test

3) Repeatability: detecting 5 parts of a hydatid ovis positive quality control product, 5 parts of a hydatid ovis negative quality control product, 1 part of a brucella antibody positive sample, 1 part of a peste des petits ruminants virus antibody positive sample, 1 part of a mycoplasma ovipneumoniae antibody positive sample, 1 part of a cysticercosis tenuis antibody positive sample, 1 part of a cercaria cerebralis antibody positive sample and 15 parts of a clinical serum sample by using the same batch of echinococcosis ELISA antibody detection kit, comparing detection results, and calculating batch repeatability; and (3) detecting the samples by using the sheep echinococcosis ELISA antibody detection kit of 3 batches, comparing detection results, and calculating the batch repeatability. The repeated detection results of the sheep echinococcosis ELISA antibody detection kit are shown in tables 3 and 4, the intra-batch variation coefficients are less than 10%, and the kit has good repeatability.

TABLE 3 results of in-batch repeatability tests

TABLE 4 results of the batch to batch repeatability test

4) Stability: performing long-term stability test and accelerated stability test on each component of the sheep echinococcosis ELISA antibody detection kit and the finished product of the kit, wherein the long-term test condition is 2-8 ℃, the frequency is 0 month, 1 month, 2 months, 3 months, 6 months, 12 months, 15 months and 18 months, and the result shows that the OD of each component of the kit and the finished product is 18 months_450nmNo significant change in value was observed; the accelerated test conditions were 37 ℃ and the frequency was 0 day, 1 day, 2 days, 3 days, 6 days, 12 days, 15 days, and 18 days, and the results showed OD of each component and finished product of the kit at 18 days_450nmNo significant change in value was observed; by integrating long-term tests and accelerated tests, the storage life of the sheep echinococcosis ELISA antibody detection kit is set to be 2-8 ℃ for 15 months.

5) The coincidence rate is as follows: and (3) detecting 100 clinical serum samples by using the 3 batches of sheep echinococcosis ELISA antibody detection kits and the indirect hemagglutination test respectively, and comparing detection results. The coincidence rate verification results of the sheep echinococcosis ELISA antibody detection kit are shown in Table 5, and the coincidence rates of the detection results of the three batches of sheep echinococcosis ELISA antibody detection kits established in the research and the indirect hemagglutination test are both more than 95%.

TABLE 5 results of compliance rate verification

Example 2 detection of echinococcosis by ELISA antibody detection kit

1. Reagent preparation

The concentrated washing solution should be returned to room temperature, and the precipitate is dissolved by shaking, then diluted by 25 times with deionized water, and mixed well, and the diluted washing solution can be stored for 7 days at 4 ℃.

2. Sample pretreatment

Taking whole blood, centrifuging at 4000rpm for 10min after blood coagulation, and collecting supernatant. Serum can be naturally coagulated and separated out without hemolysis; diluting the serum sample to be detected in a serum dilution plate according to the volume of 1:99, and fully and uniformly mixing.

3. Detection of

1) Taking the echinococcus granulosus cocktail antigen to pre-coat the ELISA plate, and adding 100 mu L of diluted serum to be detected into the pre-coated ELISA plate. Setting 2 holes for negative control and 2 holes for positive control, adding 100 μ L of negative and positive control solution into reaction holes, gently shaking, covering with cover plate membrane, and incubating at 37 deg.C for 30 min.

2) Discarding the solution in the wells, adding 300 μ L of diluted washing solution into each well, standing for 3min, discarding the washing solution, washing for 3 times, and drying on absorbent paper.

3) Preparing an enzyme conjugate working solution: uniformly mixing the mixture according to the volume ratio of 1:99 (1 part of enzyme conjugate concentrated solution and 99 parts of enzyme conjugate diluted solution) for later use.

4) Add 100 μ L of the working solution of the enzyme conjugate into each well, cover the cover plate membrane, and react for 30min at 37 ℃ in the dark.

5) The solution in the wells was discarded and washed 3 times in the same manner as in step 2.

6) Mixing the substrate A solution and the substrate B solution according to the ratio of 1:1, adding into the well, covering with a cover plate membrane at 100 mu L/well, and reacting for 15min at 37 ℃ in a dark place.

7) Adding 50 mu L of stop solution into each well, and reading the OD value of each well at 450nm by using an enzyme-labeling instrument within 5 min.

4. Determination of results

1) Conditions for test establishment: average OD of negative control_450nmThe value is less than or equal to 0.20, and the positive control mean OD_450nmThe value is more than 1.0, and the test result is valid; otherwise, repeat testing should be performed.

2) The calculation method comprises the following steps:

3) and (3) judging the negative and positive: when the S/P is less than 0.35, the result is negative; when the S/P is more than or equal to 0.35, the sample is judged to be positive.

Sequence listing

<110> Beijing Weideweikang Biotech Ltd

<120> ELISA antibody detection kit for detecting sheep echinococcosis and application thereof

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213>EPC-1-F(Artificial Sequence)

<400>1

ggatccgccg tactatgagt cttca 25

<210>2

<211>26

<212>DNA

<213>EPC-1-R(Artificial Sequence)

<400>2

aagctttcta ggcttaattc gccgtc 26

<210>9

<211>192

<212>DNA

<213>EPC-1(Echinococcus granulosus)

<400>9

gccgtactat gagtcttcag aaaactgttg agaagctttt cgatgagttg gacaaggaca 60

agtcgggcaa gattagctgt gccgagctta aatccgcact acagtcgtgc tcagcagagc 120

ctctcgatga cgaccatgtg aaggctttct tagataagct cgactccaac aaggacggcg 180

aattaagcct ag 192

<210>3

<211>26

<212>DNA

<213>EgAgB1-F(Artificial Sequence)

<400>3

ggatcccctc gacgtcgagg agtgtg 26

<210>4

<211>26

<212>DNA

<213>EgAgB1-R(Artificial Sequence)

<400>4

aagctttctg aggtgggact taagtg 26

<210>10

<211>161

<212>DNA

<213>EgAgB1(Echinococcus granulosus)

<400>10

cctcgacgtc gaggagtgtg atgaaaatga ttggcgaacg gaagtacttc ttcgaacgtg 60

atccgttggg tcagaaagtg gttgacctct taaaggaact ggaagaagtg ttccagttgt 120

tgaggaagaa gctacgcacg gcacttaagt cccacctcag a 161

<210>5

<211>27

<212>DNA

<213>EgAgB2-F(Artificial Sequence)

<400>5

ggatccgcac acatggggca agtggta 27

<210>6

<211>26

<212>DNA

<213>EgAgB2-R(Artificial Sequence)

<400>6

aagcttcatc tttttcttcc accaaa 26

<210>11

<211>184

<212>DNA

<213>EgAgB2(Echinococcus granulosus)

<400>11

gcacacatgg ggcaagtggt aaaaaaaaga tggggtgaac ttcgagactt ctttagaaat 60

gatccactgg gtcaaagact tgtcgctctt ggcaatgacc taactgccat ttgccagaag 120

ctgcaattga agattcgtga ggtgctgaag aagtatgtta agaatttggt ggaagaaaaa 180

gatg 184

<210>7

<211>27

<212>DNA

<213>EgAgB4-F(Artificial Sequence)

<400>7

ggatccagat gcaagtgcct cataatg 27

<210>8

<211>25

<212>DNA

<213>EgAgB4-R(Artificial Sequence)

<400>8

aagcttcttc ttcttccagc aaatc 25

<210>12

<211>178

<212>DNA

<213>EgAgB4(Echinococcus granulosus)

<400>12

agatgcaagt gcctcataat gagaaaattg ggcgaaattc gggacttctt tagaagtgat 60

ccactgggtc aaaaacttgc tgctcttggc aggaacctga ctgccatctg ccagaagctg 120

caattgaagg ttcacgaagt gttgaagaaa tatgtcaagg atttgctgga agaagaag 178

Claims

1. The kit for detecting the sheep echinococcosis ELISA antibody comprises a fine-grained echinococcosis cocktail antigen pre-coated ELISA plate, a positive control solution, a negative control solution, an enzyme marker concentrated solution, an enzyme marker diluent, a sample diluent, a substrate A solution, a substrate B solution, a stop solution, a washing solution and a serum diluent plate; the echinococcus granulosus cocktail antigen is composed of EPC1 recombinant antigen, EgAgB1 recombinant antigen, EgAgB2 recombinant antigen and EgAgB4 recombinant antigen.

2. The kit for detecting the sheep echinococcosis ELISA antibody according to claim 1, wherein the ELISA plate is a 96-well solid-phase ELISA plate NUNC-468667.

3. The sheep echinococcosis ELISA antibody detection kit of claim 1, wherein the concentration ratio of the EPC1 recombinant antigen, the EgAgB1 recombinant antigen, the EgAgB2 recombinant antigen and the EgAgB4 recombinant antigen expressed in the echinococcus granulosus cocktail antigen is 2:1:2: 1.

4. The method for preparing the sheep echinococcosis ELISA antibody detection kit of claim 1, comprising the steps of:

1) preparation of echinococcus granulosus cocktail antigen: designing specific primers aiming at EPC1, EgAgB1, EgAgB2 and EgAgB4 gene sequences by taking a echinococcus granulosus cDNA library as a template, amplifying target fragments through PCR and cloning the target fragments to an expression vector pET28a, transforming successfully constructed recombinant expression plasmids pET28a-EPC-1, pET28a-EgAgB1, pET28a-EgAgB2 and pET28a-EgAgB4 into escherichia coli BL21 (DE 3), carrying out IPTG induced expression, and carrying out affinity chromatography and molecular sieve chromatography high purification to obtain EPC1 recombinant protein, EgAgB1 recombinant protein, EgAgB2 recombinant protein and EgAgB4 recombinant protein;

2) preparing an echinococcus granulosus cocktail antigen precoated enzyme label plate: diluting cocktail antigen with carbonate buffer solution to obtain antigen coating solution with concentration of 5 μ g/mL, coating at 2-8 deg.C for 16h in each well with 100 μ L, and washing plate; then adding 200 μ L of sealing liquid into each hole, sealing at 37 deg.C and humidity of 30-40% for 2 hr, and drying at constant temperature of 37 deg.C and humidity of 30-40% for 2 hr; the final concentrations of EPC1 recombinant antigen, EgAgB1 recombinant antigen, EgAgB2 recombinant antigen and EgAgB4 recombinant antigen in the echinococcus granulosus cocktail antigen are 2.8mg/mL, 1.4mg/mL, 2.8mg/mL and 1.4mg/mL respectively;

3) preparation of positive control solution: the test is carried out by diluting the blood serum of the sheep attacking insects for 270 days by 1:100 times;

4) preparation of negative control solution: diluting healthy sheep serum by 1:100 times;

5) preparation of enzyme-labeled concentrate: diluting the horse radish peroxide labeled Mouse Anti-goat IgG-HRP 1 by 30000 times;

6) preparation of enzyme marker diluent: 0.01M PBST solution pH7.4;

7) preparation of sample diluent: 0.01M PBS solution, pH7.4;

8) preparation of substrate A solution: adjusting pH to 7.4, wherein the solution contains 0.08% carbamide peroxide, 0.025% PEG-2000, 3.58% disodium hydrogen phosphate dodecahydrate and 0.96% citric acid monohydrate aqueous solution;

9) preparation of substrate B solution: contains 1.03% citric acid monohydrate, 0.04% TMB, 0.0008% sodium thiosulfate, 0.1% light stabilizer 292 and 3% DMF water solution, and the pH value is adjusted to 5.0;

10) preparation of stop solution: containing 0.1% 10% SDS, 5.56% aqueous sulfuric acid;

11) preparation of a washing solution: 0.25M PBST solution pH 7.4.

5. The primers used for preparing the EPC1 recombinant antigen of claim 4 are shown as the sequence 1-2 in the sequence table, and the EPC1 recombinant antigen nucleic acid sequence is shown as the sequence 3 in the sequence table; the primer used in the preparation of the EgAgB1 recombinant antigen is shown as a sequence 4-5 in a sequence table, and the nucleic acid sequence of the EgAgB1 recombinant antigen can be shown as a sequence 6 in the sequence table; the primer used in the preparation of the EgAgB2 recombinant antigen is shown as a sequence 7-8 in a sequence table, and the nucleic acid sequence of the EgAgB2 recombinant antigen can be shown as a sequence 9 in the sequence table; the primer used in the preparation of the EgAgB4 recombinant antigen is shown as a sequence 10-11 in a sequence table, and the nucleic acid sequence of the EgAgB4 recombinant antigen can be shown as a sequence 12 in the sequence table.

6. The use of the sheep echinococcosis ELISA antibody detection kit of claim 1 in echinococcosis detection.