CN103146715A

CN103146715A - Mycobacterium tuberculosis ESAT6 antigen protein serial recombinant expression method and application in tuberculosis detection thereof

Info

Publication number: CN103146715A
Application number: CN201310076675XA
Authority: CN
Inventors: 杨艳坤; 白仲虎; 刘晓磊; 李昕; 朱国珍; 林兴兵; 曹成; 付建军
Original assignee: ZHENZHOU BOSAI BIOTECH CO Ltd
Current assignee: ZHENZHOU BOSAI BIOTECH CO Ltd
Priority date: 2012-07-20
Filing date: 2013-03-11
Publication date: 2013-06-12

Abstract

The invention discloses mycobacterium tuberculosis ESAT6 serial recombinant fusion protein and application thereof. The invention provides a mycobacterium tuberculosis ESAT6 codon optimization method, a serial recombinant fusion method and a method for preparing the fusion protein, and also provides a method for manufacturing and applying the recombinant fusion protein in a whole-blood IFN-gamma tuberculosis diagnosis kit and a TCELL-SPOT tuberculosis infection diagnosis kit. The fusion protein has the advantages of high specificity, high sensitivity and the like, and the requirements of the tuberculosis (TB) infection clinical diagnosis are well met.

Description

A kind of mycobacterium tuberculosis ESAT-6 6 antigen protein series connection recombinant expression method and application in tuberculosis detects thereof

Technical field

The present invention relates to genetically engineered field and Medical Immunology field, quick, the early stage special detection method that relates to tuberculosis patient and mycobacterium tuberculosis infection person, be specifically related to 6 series connection recombination fusion protein and the application thereof of a kind of mycobacterium tuberculosis ESAT-6, particularly the special whole blood IFN-gamma Diagnosis of Tuberculosis test kit of a kind of tuberculosis antigen ESAT6 series connection recombination fusion protein and the making method and methods for using them of TCELL-SPOT tuberculosis infection diagnostic reagent kit.

Background technology

Tuberculosis be by Mycobacterium tuberculosis ( Mycobacterium tubercu1osis, the MTB) human diseases due to the infection, mainly by respiratory infectious, and the epidemic situation development is on the rise.Prevention lungy, early diagnosis and in time treat significant.MTB reference culture H37Rv is widely used in the relevant biological medicine research of TB, and the preparation of its specific antigens receives much concern.Tuberculosis specific antigen commonly used can prepare in a large number by gene engineering method at present, is the basis of Diagnosis of Tuberculosis.Obtain the tuberculosis specific antigen but focus mostly at present in the expression of independent a kind of antigen, the expression of antigen alone epi-position, the method that plurality of antigens is united expression, the recombinant expressed research of rare single antigen series connection, and how the tuberculosis specific antigens directly detects tuberculosis infection with serological method, and sensitivity is low, poor specificity.

Summary of the invention

In order to overcome above-mentioned the deficiencies in the prior art, the invention provides a kind of tuberculosis ESAT6 series connection recombination fusion protein of producing with gene engineering method as antigen, high specificity and be easy to purifying, whole blood IFN-gamma Diagnosis of Tuberculosis test kit and TCELL-SPOT tuberculosis infection diagnostic reagent kit have been prepared with it as specific antigen, for the detection of tuberculosis infection provides more special, sensitive, instrument accurately.

A kind of codon optimized gene order of mycobacterium tuberculosis ESAT-6 6 genes of encoding, its single copy core former times acid sequence is as shown in SEQ ID NO.1,2 copy nucleosides in series acid sequences are as shown in SEQ ID NO.2,3 copy nucleosides in series acid sequences are as shown in SEQ ID NO.3,4 copy nucleosides in series acid sequences are as shown in SEQ ID NO.4,5 copy nucleosides in series acid sequences are as shown in SEQ ID NO.5,6 copy nucleosides in series acid sequences are as shown in SEQ ID NO.6, and ESAT6 gene series connection number of times includes but not limited to 1-6 time.

Mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it is by above-mentioned codon optimized gene order coding, its single copy aminoacid sequence is as shown in SEQ ID NO.7,2 copy aminoacid sequences are as shown in SEQ ID NO.8,3 copy aminoacid sequences are as shown in SEQ ID NO.9,4 copy aminoacid sequences are as shown in SEQ ID NO.10,5 copy aminoacid sequences are as shown in SEQ ID NO.11,6 copy aminoacid sequences are as shown in SEQ ID NO.12, and 6 kDa early secretory antigenic target series connection number of times includes but not limited to 1-6 time.

The expression vector of mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it is that above-mentioned codon optimized gene order is inserted into respectively on plasmid pET-25b, obtain recombinant plasmid ESAT6c1-pET25b, ESAT6c2-pET25b, ESAT6c3-pET25b, ESAT6c4-pET25b, ESAT6c5-pET25b or ESAT6c6-pET25b, carrier includes but not limited to pET25b.

A kind of engineering strain of expressing mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it contains above-mentioned expression vector, its Host Strains be intestinal bacteria ( Escherichia coli).

A kind of chemoluminescence method test kit of the detecting tubercle bacillus infection in vitro of setting up based on described mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it utilizes above-mentioned mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, stimulate person under inspection's peripheral blood to discharge gamma-interferon, and measure the variation of gamma-interferon by chemiluminescent method, whether diagnosis infects mycobacterium tuberculosis.

A kind of TCELL-SPOT test kit of the detecting tubercle bacillus infection in vitro of setting up based on described mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it utilizes above-mentioned mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, stimulate person under inspection's periphery blood T lymphocyte, and spot formation what the method by ELISPOT measures, and whether diagnosis infects mycobacterium tuberculosis.

The application of described mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins in preparation monoclonal antibody, many anti-, detection kit and protein chip.

Description of drawings

The structure schematic diagram of Fig. 1 recombinant plasmid ESAT6c1-pET16b;

The structure schematic diagram of Fig. 2 recombinant plasmid ESAT6c2-pET16b;

The structure schematic diagram of Fig. 3 recombinant plasmid ESAT6c3-pET16b;

The structure schematic diagram of Fig. 4 recombinant plasmid ESAT6c4-pET16b;

The structure schematic diagram of Fig. 5 recombinant plasmid ESAT6c5-pET16b;

The structure schematic diagram of Fig. 6 recombinant plasmid ESAT6c6-pET16b;

Fig. 7 ESAT6c1 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure;

Swimming lane

2,3,4,5,6,7:ESAT6c1 purifying band; After swimming lane 8:ESAT6c1 purifying; Before swimming lane 9:ESAT6c1 purifying;

Fig. 8 ESAT6c2 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure; Before swimming lane 2:ESAT6c2 purifying; After swimming lane 3:ESAT6c2 purifying;

Swimming lane

4,5,6,7:ESAT6c1 purifying band;

Fig. 9 ESAT6c3 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure; Before swimming lane 2:ESAT6c3 purifying; After swimming lane 3:ESAT6c3 purifying;

Swimming lane

4,5,6,7:ESAT6c3 purifying band;

Figure 10 ESAT6c4 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure; Before swimming lane 2:ESAT6c4 purifying; After swimming lane 3:ESAT6c4 purifying;

Swimming lane

4,5,6,7:ESAT6c4 purifying band;

Figure 11 ESAT6c5 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure; Before swimming lane 2:ESAT6c5 purifying; After swimming lane 3:ESAT6c5 purifying;

Swimming lane

4,5,6,7:ESAT6c5 purifying band;

Figure 12 ESAT6c6 recombination fusion protein purifying figure, swimming lane 1:NEB albumen Marker in figure;

Swimming lane

2,3,4,5,6:ESAT6c6 purifying band; Before swimming lane 7:ESAT6c6 purifying; After swimming lane 8:ESAT6c6 purifying;

Figure 13 TCELL-SPOT detected result figure, in figure, a is tuberculosis infected students positive control hole; B is that tuberculosis infected students ESAT6c1 detects the hole; C is that tuberculosis infected students ESAT6c2 detects the hole; D is that tuberculosis infected students ESAT6c3 detects the hole; E is that tuberculosis infected students ESAT6c4 detects the hole; F is that tuberculosis infected students ESAT6c5 detects the hole; G is that tuberculosis infected students ESAT6c6 detects the hole; H is the tuberculosis infected students negative control hole.

Embodiment

Below by preferred embodiment, technique of the present invention being described in further detail, but protection scope of the present invention is not limited to this.

Embodiment

Below the present invention is further described.Following examples are used for explanation the present invention, but are not used for limiting protection scope of the present invention.

Embodiment 1The preparation of mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins

The nucleotide sequence of analysis of encoding tuberculosis specific antigens ESAT6, and combination E.coliCodon preference, the Nucleotide of ESAT6 is carried out the optimization of synonym, and adds at the two ends of its encoding sequence the restriction enzyme site that designs, thereby realize the tandem expression of sequence.

As follows through the nucleotide sequence of optimizing:

catatgggaattcccatggaggatccgatgacagagcagcagtggaatttcgcgggtatcgaggccgctgcaagcgcaatccagggtaatgtcacgtccattcattccctccttgacgaggggaagcagtccctgaccaagctcgcagcggcctggggcggtagcggttcggaggcgtaccagggtgtccagcaaaaatgggacgccacggctaccgagctgaacaacgcgttgcagaacctggcgcgtacgatcagcgaagccggtcaggcaatggcttcgaccgaaggcaacgtcactgggatgttcgcagcagatctggctaagcttcccgggtcgactcgagcggccgc

The sequence upstream adds NcoI and BamHI; Add HindIII, the restriction enzyme sites such as BglII and SalI in the sequence downstream.And entrust the precious biological mode of synthesizing by gene in Dalian to be connected into pMD-19T simple, called after ESAT6c1-19T simple above-mentioned sequence.

1. alkali method plasmid extraction in a small amount

A. will contain after the intestinal bacteria overnight incubation of ESAT6c1-19T simple centrifugal.Add 200 μ L Solution I (GTE:50 mmol/L glucose in bacterial precipitation; 25 mmol/L pH 8.0 TrisHCl; 10 mmol/L EDTA), abundant mixing is until thalline is fully resuspended.

B. add again 200 μ LSolutionII (1% SDS of new preparation to centrifuge tube; 0.2 mol/L NaOH), light and slow inversion immediately for several times, until the mixed solution clarification.

C. add 200 μ L SolutionIII (5mol/L potassium acetate 60mL; Glacial acetic acid 11.5mL; Water 28.5mL), light and slow inversion immediately has a large amount of white precipitates to occur for several times, places 5 min in ice-water bath.

D. centrifugal 5 min of 2,000 r/min, get supernatant, adds the abundant mixing of isopyknic chloroform/primary isoamyl alcohol.

E. centrifugal 10 min of 12,000 r/min, get supernatant, add 2 times of volume dehydrated alcohol precipitations.

F. centrifugal 10 min of 12,000 r/min, abandon supernatant, add 500 μ L 70% washing with alcohol precipitations.

G. centrifugal 5 min of 12,000 r/min, abandon supernatant, adds TE damping fluid or the sterilized water of 100 μ L pH8.0 after oven dry, is placed in-20 ℃ and saves backup.

2. enzyme is cut

To ESAT6c1-19T simple, obtain the ESAT6 goal gene with sticky end with BamH I and 37 ℃ of double digestions that spend the night of Hind III.It is as follows that enzyme is cut system:

BamH I 2ul

Hind III 2ul

Buffer 4ul

ESAT6-19T simple 20ul

Water 12ul

With Bgl II and 37 ℃ of double digestion ESAT6c1-19T simple that spend the night of HindIII, obtain the ESAT6c1-19T'simple fragment with same sticky end.It is as follows that enzyme is cut system:

BamH I 2ul

Hind III 2ul

Buffer 4ul

ESAT6-19T simple 20ul

Water 12ul

3. glue reclaims

A. enzyme is cut product and carry out agarose gel electrophoresis, excision contains the blob of viscose of purpose band under the ultraviolet condition, adds the Binding Buffer of 3 times after weighing, and 55 ℃ of water-baths are dissolved glue fully.

B. change DNA solution over to the DNA column, be nested into centrifugal 1 min of room temperature 10000 rpmin in the collection tube of 2 mL.

C. abandon waste liquid, wash post both sides post-drying with Wash Buffer.

D. DNA is combined with and is inserted in new aseptic centrifuge tube, add 50 μ L sterilized waters, room temperature is placed 1 min, greater than centrifugal 1 min of 13000 r/min.The glue that namely obtains goal gene reclaims product.

4. connect

Use the T4 ligase enzyme under 16 ℃ of conditions, connection is spent the night.Reaction system is as follows:

ESAT6c1-19T' simple 1.5ul

ESAT6 5.5ul

Buffer 1ul

T4 Ligase 1ul

5. E.coliThe preparation of competent cell

A. the bacillus coli DH 5 alpha list colony inoculation on the picking flat board in 3 mL LB liquid nutrient mediums, 37 ℃ of vibrations (approximately 150rpm) overnight incubation.

B. get this bacterial culture fluid that spends the night and be inoculated in the 100 fresh LB nutrient solutions of mL with the ratio of 1:100,37 ℃ of thermal agitations (approximately 150 rpm) are cultured to OD ₆₀₀=0.4-0.6(is 2.5 h approximately), stop cultivating in the placement ice bath.

C. the new bacterium liquid of cultivating in b is sub-packed in sterilized centrifuge tube 1mL/ pipe, 1,500 g, 4 ℃ of centrifugal 5 min, supernatant discarded (as far as possible eliminating supernatant).

D. add the solution A of precooling in 100 μ L ice at each centrifuge tube, the springing centrifuge tube suspends precipitation gently, forbids concuss.

E. 1,500 g, 4 ℃ of centrifugal 5 min, supernatant discarded (as far as possible eliminating supernatant).

F. add the solution B of precooling in 100 μ L ice at each centrifuge tube, the springing centrifuge tube suspends precipitation gently.

6. transform

B. add 5 μ L ligation reactions (volume ratio 2-5%) in every pipe competent cell, rotate gently and place 30 min after mixing in ice bath.

After c .42 ℃ thermal shock 60 sec, put rapidly 2 min on ice.

D. add the LB substratum of 900 μ L37 ℃ of pre-temperature in each centrifuge tube.

1 h is cultivated in e .37 ℃ of concussion (100 r/min).

F. get the 400 above-mentioned bacterium liquid of μ L, coat on the LB flat board that contains penbritin (Amp, 100 μ g/mL), be inverted overnight incubation for 37 ℃.

7. recombinant plasmid is identified

After dull and stereotyped single bacterium colony incubated overnight after picking is transformed, get 1ml and carry out DNA sequencing, sequencing result is consistent with desired result, and without suddenling change, encoder block is correctly without frameshit, called after ESAT6c2-19T simple.

Extract the correct recombinant plasmid of order-checking, with BamH I and Hind III double digestion, enzyme is cut rear electrophoresis and is detected the left and right for 710bp, with the ESAT6c2 in the same size.Bgl II and Hind III double digestion, take ESAT6c1-19T as reference, electrophoresis showed ESAT6c2-19T with fragment after Bgl II and Hind III double digestion greater than ESAT6c1-19T the fragment after with Bgl II and Hind III double digestion, consistent with expected results.

8. the structure of goal gene three times series connection recombinant plasmids

Reclaim the ESAT6c2 fragment that ESAT6c2-19T produces after with BamH I and Hind III double digestion, be connected with the ESAT6c1-19T with sticky end, carry out equally the enzyme evaluation of cutting and check order after conversion, identify the correct ESAT6c3-19T that is.

9. the structure of goal gene four times series connection recombinant plasmids

Reclaim the ESAT6c3-19T fragment that ESAT6c3-19T produces after with Bgl II and Hind III double digestion, be connected with the ESAT6c1 fragment, carry out equally the enzyme evaluation of cutting and check order after conversion, identify the correct ESAT6c4-19T that is.

10. the structure of goal gene five times series connection recombinant plasmids

Reclaim the ESAT6c4-19T fragment that ESAT6c4-19T produces after with Bgl II and Hind III double digestion, be connected with the ESAT6c4 fragment that produces after BamH I and Hind III double digestion, carry out equally the enzyme evaluation of cutting and check order after conversion, identify the correct ESAT6c5-19T that is.

11. the structure of six series connection recombinant plasmids of goal gene

Reclaim the ESAT6c5-19T fragment that ESAT6c5-19T produces after with Bgl II and Hind III double digestion, be connected with the ESAT6c5 fragment that produces after BamH I and Hind III double digestion, carry out equally the enzyme evaluation of cutting and check order after conversion, identify the correct ESAT6c6-19T that is.

12. the structure of recombinant expression plasmid

With Nco I and Sal I double digestion ESAT6c1-19T, ESAT6c2-19T, ESAT6c3-19T, ESAT6c4-19T, ESAT6c5-19T, ESAT6c6-19T and expression vector pET25b.Reclaim respectively ESAT6c1, ESAT6c2, ESAT6c3, ESAT6c4, ESAT6c5, ESAT6c6 purpose fragment and pET25b plasmid fragment.Transform intestinal bacteria Rosetta-gami (DE3) bacterial strain after connecting, be inverted incubated overnight for 37 ℃.Picking list bacterium colony is in ammonia benzyl and the two anti-LB substratum of Ka Na (ammonia benzyl final concentration 100ug/ml blocks that final concentration 50ug/ml), and 37 ℃ of concussion overnight incubation are extracted recombinant expression plasmid.

13. the evaluation of recombinant expression plasmid

Take extracted recombinant expression plasmid as template, be PCR with the sequencing primer of pET25b and identify; Doing simultaneously Nco I and Sal I double digestion identifies.With positive colony difference called after ESAT6c1-pET25b, ESAT6c2-pET25b, ESAT6c3-pET25b, ESAT6c4-pET25b, ESAT6c5-pET25b and the ESAT6c6-pET25b that identifies.

14. the abduction delivering of genetic engineering bacterium and evaluation

To contain ESAT6c1-pET25b, ESAT6c2-pET25b, ESAT6c3-pET25b, ESAT6c4-pET25b, 37 ℃ of concussion overnight incubation of the Rosetta-gami of ESAT6c5-pET25b and ESAT6c6-pET25b (DE3), by in 1% inoculum size switching and ammonia benzyl and the two anti-LB substratum of Ka Na, when the OD value is 0.6---0.8, add the IPTG abduction delivering again.

Get the thalline 1ml after abduction delivering, after adding in proportion Loading buffer and PBS after centrifugal, resuspended thalline boils 5---10min to boiling water, get 10ul after the centrifugal 5min of 12000rpm and carry out the SDS-PAGE electrophoresis, simultaneously with pET25b-Rosetta-gami (DE3) in contrast.12% separation gel, the 100V constant voltage, electrophoresis 2h, electrophoresis decolours clear to band after finishing.The bacterial strain difference called after ESAT6c1-pET25b-Rosetta-gami (DE3) that obvious expression band will be arranged according to electrophoresis result, ESAT6c2-pET25b-Rosetta-gami (DE3), ESAT6c3-pET25b-Rosetta-gami (DE3), ESAT6c4-pET25b-Rosetta-gami (DE3), ESAT6c5-pET25b-Rosetta-gami (DE3) and ESAT6c6-pET25b-Rosetta-gami (DE3).

15. the optimization of genetic engineering bacterium inductive condition

The IPTG that uses 0.2,0.4,0.6,0.6,0.8,1.0,1.2mM concentration induces, and at 2h, 4h, 6h, 8h, and take a sample respectively under the condition of spending the night and carry out the SDS-PAGE electrophoresis.To spend the night simultaneously and induce bacterium to carry out ultrasonication, and get respectively cleer and peaceful precipitation and carry out the SDS-PAGE electrophoresis.

Thereby determine IPTG concentration and induction time and be that supernatant is expressed or inclusion body.

16. the purifying of recombinant protein

Broken after inducing bacterium to collect, after the 0.22um membrane filtration, adopt AKTA plus protein purification system and HisTrap HP prepacked column affinity purification ESAT6c1, ESAT6c2, ESAT6c3, ESAT6c4, ESAT6c5 and the ESAT6c6 recombinant protein of GE company.The SDS-PAGE detected result shows that the purpose band is single, without assorted band.

Embodiment 2Bacillus tuberculosis typus humanus's detection kit (chemoluminescence method) based on mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins

[packing specifications]

9 person-portions/box (48T), 21 person-portions/box (96T)

[desired use]

This test kit adopts the content of T lymphocyte human interferon-gamma (Interferon-γ, IFN-γ) of secretion after the tubercle bacillus differential antigenic peptide stimulates in chemoluminescence double antibody sandwich method quantitative assay human blood sample.What mycobacterium tuberculosis infection mainly caused is cell-mediated immunne response.As the part of immunne response, the T lymphocyte is accepted the effector T cell that the tubercle bacillus differential antigenic peptide stimulates becomes activation, secrete cytokines IFN-γ.Can infer by the content that detects IFN-γ in sample the effector T cell that whether exists in body the tubercule bacillus reaction, thereby mycobacterium tuberculosis infection is carried out auxiliary diagnosis.

[inspection principle]

This test kit is the activated T lymphocytes that has tubercle bacillus differential in the person's blood sample that utilizes the mycobacterium tuberculosis infection, and secretion of gamma-IFN designs these T lymphocytes after being subject to the tubercle bacillus differential antigenic peptide and stimulating.

Add together Tissue Culture Plate to cultivate Fresh blood sample, tubercle bacillus differential antigenic peptide A/ tubercle bacillus differential antigenic peptide B or positive control reagent.When the effector T cell that exists in blood sample for tubercule bacillus, the tubercle bacillus differential antigenic peptide A that adds in nutrient solution and B will stimulate these effector T cell secretion of gamma-IFN.

To resist the IFN-gamma antibodies to be coated with micro reaction plate, make insolubilized antibody, add the nutrient solution supernatant, add simultaneously the anti-IFN-gamma antibodies of horseradish peroxidase-labeled.When containing IFN-γ in the nutrient solution supernatant, just be combined with coated anti-IFN-gamma antibodies, the anti-IFN-gamma antibodies of enzyme labelling and form mixture, add substrate solution and luminous, measure relative optical signal (RLU).By Data Management Analysis, can judge the content of IFN-γ in the nutrient solution supernatant, infer with this effector T cell that whether exists in body the tubercule bacillus reaction, thereby mycobacterium tuberculosis infection is carried out auxiliary diagnosis.

[chief component composition]

1. human interferon-gamma detection kit (chemoluminescence method)

	Form	48 person-portions	96 person-portions
				Standard substance	Human interferon-gamma content is 0 (A), 50 (B), 125 (C), 312.5 (D), 800 (E), 2000 (F) pg/ml, 6 bottles	(0.5 ± 0.1) ml/ bottle	(0.5 ± 0.1) ml/ bottle
Coated hole	Be coated with the polystyrene micropore of anti-human interferon-γ antibody	48 holes	96 holes
				30 times of enzyme concentrated solutions	The anti-human interferon-γ antibody of horseradish peroxidase-labeled, 1 pipe	(100±15)μl	(200±15)μl
30 times of washing lotions	The Tris damping fluid that contains Tween-20,1 bottle	(20.0±0.5)ml	(20.0±0.5)ml
				The enzyme diluent	The Tris damping fluid that contains BSA, 1 bottle	(3.0±0.5)ml	(6.0±0.5)ml
The sample diluent	The PBS damping fluid that contains Casein, 1 bottle	(5.0±0.5)ml	(10.0±0.5)ml
				Substrate A	Luminol solution, 1 bottle	(3.0±0.5)ml	(6.0±0.5)ml
Substrate B	Urea peroxide solution, 1 bottle	(3.0±0.5)ml	(6.0±0.5)ml

2. tubercule bacillus ESAT6 series connection restructuring fused antigen: 0.160 mg/ml, 10 ml/ prop up, and 5, amount to 1.6 mg/ and prop up, total amount 8 mg.

[sample requirement]

1. use asepsis injector to extract sample to be tested peripheric venous blood 2ml, add to contain the anticoagulant heparin heparin tube; Or use 5ml to contain the anticoagulant heparin vacuum test tube directly to gather sample to be tested peripheric venous blood 2ml.

2. can place after sample collection room temperature 2-3 hour, and be sure not to be placed in freezing or refrigerating chamber.

3. please don't use the nutrient solution supernatant of significant hemolysis, piarhemia, jaundice.

[preparation of reagent]

1. all reagent should be put in room temperature (18 ℃～25 ℃) balance at least 30 minutes before use.

2. preparation washing lotion with deionized water dilution (1:30), is mixed with the washing lotion working fluid with 30 times of washing lotions.

3. prepare the enzyme working fluid, with 30 times of enzyme concentrated solution centrifuging and taking supernatants, with enzyme diluted (1:30), be mixed with the enzyme working fluid.

4. every bottle of freeze-drying standard substance add 0.5 ml deionized water and redissolve.

5. before use, with ratio mixed substrates A and the substrate B of 1: 1.

[checked operation]

1. cell cultures: add stimulator in 3 hours after the heparin anti-coagulating sample collection, every increment is originally established negative control one hole; Positive control one hole (PHA-P HA), working concentration 160 μ g/ml, final concentration are 20 μ g/ml; Detect hole A(ESAT6 series connection restructuring fused antigen), working concentration 160 μ g/ml, final concentration are 20 μ g/ml.

In 24 porocyte culture plates, specifically add sample loading mode as follows, this step is aseptic technique:

Negative control hole: 300 μ l serum free mediums+100 μ l serum free mediums+400 μ l heparin anti-coagulating samples;

Positive control hole: 300 μ l serum free mediums+100 μ l PHA (160 μ g/ml)+400 μ l heparin anti-coagulating sample;

Detect hole A:300 μ l serum free medium+100 μ l ESAT6 series connection restructuring fused antigen (160 μ g/ml)+400 μ l heparin anti-coagulating samples;

After adding all samples, cover the plate lid, the abundant mixing of light shaking is put into 37 ° of C, 5% CO ₂Incubator was cultivated 18-24 hour.

2. collect the nutrient solution supernatant: 24 porocyte culture plates are taken out from incubator, draw culture in 1.5 ml centrifuge tubes, 3000r/min, centrifugal 5 minutes, separation and Culture liquid supernatant.

3. detect the nutrient solution supernatant:

⑴ take out human interferon-gamma detection kit (chemoluminescence method), is ready to quantity and the position of coated microwell plate, and the microwell plate of use is not airtight, puts in 2 ℃～8 ℃ refrigerators.

⑵ the every hole of standard substance adds 100 μ l; The every hole of sample aperture first adds sample diluent 80 μ l, and then adds 20 μ l nutrient solution supernatants (sample to be tested is done 5 times of dilutions), and mixing gently vibrates.Every Kong Zhongzai adds enzyme working fluid 50 μ l, and the capping Sptting plate was placed 37 ℃ of constant water bath box incubations 2 hours.

⑶ wash plate: Sptting plate is taken out, wash plate 5 times with the washing lotion working fluid that dilution is good, soaked 1 minute at every turn, for the last time plate is patted dry.

⑷ add substrate: the A, the B substrate mixed solution that add 100 μ l to prepare in every hole, vibrated 10 seconds.

⑸ detect: adding substrate to detect luminous value RLU with Chemiluminescence Apparatus in 10 minutes.

⑹ Data Management Analysis: luminous value RLU is carried out double-log or other method Treatment Analysis, preparation IFN-γ concentration-RLU typical curve, the content of IFN-γ in the conversion sample to be tested.

[assay judgement]

1. normal reference value:

Negative control hole: measured value＜50 pg/ml; Nutrient solution supernatant＜250 pg/ml; Heparin anti-coagulating sample＜500 pg/ml.

Positive control hole: measured value＞100 pg/ml; Nutrient solution supernatant＞500 pg/ml; Heparin anti-coagulating sample＞1000 pg/ml.

2. result judgement:

Detect under normal prerequisite in negative control hole, positive control hole, detect hole A institute this concentration of test sample 〉=2 times of negative control hole concentration, be judged to be positive findings.

3. if sample to be tested RLU value is higher than 2000 pg/ml standard substance RLU values, the suggestion sample detects after doing suitable dilution again, its concentration=measurement concentration * extension rate.

[explanation of assay]

1. under negative control hole, the normal prerequisite of positive control hole detection, the measurement result that detects the hole is only reliably;

2. as need, near the sample threshold value should carry out multiple hole application of sample, measures for the second time and confirms.

3. contain the effector T cell for tubercle bacillus differential in positive findings prompting test sample book.For the person under inspection of test positive, should judge in conjunction with clinical symptom and other index comprehensives.

4. do not contain the effector T cell for tubercle bacillus differential in negative findings prompting test sample book.Do not mean that for the negative sample of detected result and do not contain IFN-γ in sample.

5.RLU value can change along with the change of time, assay should be as the criterion with the concentration of the corresponding RLU value of these touchstone product institute inverse.

Embodiment 3Bacillus tuberculosis typus humanus TCELL-SPOT detection kit based on mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins

Experimental program:

Coated:

1. with 30 seconds at the bottom of the film of 35% moistening 96 pore membrane plates in ethanol 15ul/ hole;

2. wash plate 5 times, 1min/ time with the aseptic deionization of 200ul;

3. control slightly residual moisture in dry hole, every hole adds 100ul IFN-γ mono-clonal capture antibody (being 15ug/ml with the PBS dilution), 4 ℃ of refrigerator overnight;

4. discard coating buffer, PBS washes plate 2 times, 1min/ time, pats dry;

5. every hole adds 200ul to contain the PBS sealing of 2% casein and 1% trehalose, incubated at room 2 hours;

6. discard confining liquid, with the RPMI-1640 rinse once, stand-by.

Separate the counting lymphocyte:

1. collection of specimens: extract personnel to be tested's peripheral blood 4-5ml, add the anticoagulant blood-collecting pipe that contains heparin sodium, mixing for several times turns upside down; Room temperature was placed less than 6 hours, not freezing or refrigeration;

2. the 3ml anticoagulation cirumferential blood of getting mixing in the ratio of 1:1 slowly joins in the aseptic centrifuge tube of 3ml lymphocytes separating solution, forms sharp interface, the centrifugal 20min of 2500rpm under room temperature.As seen peripheral blood mononuclear cell (PBMC) is present in the cloud layer;

3. drawing lymphocyte cloud and mist layer with aseptic dropper or pipettor is equipped with in a small amount of 1640 centrifuge tube to aseptic;

4. add the RPMI-1640 of 37 ℃ of preheatings to 8ml, after blowing and beating mixing gently with dropper, in room temperature 2000rpm horizontal centrifugal 10min;

5. abandoning supernatant, add the RPMI-1640 of 37 ℃ of preheatings to 6ml, and resuspended sedimentation cell is in room temperature 1500rpm horizontal centrifugal 8min;

6. abandoning supernatant adds the serum free medium 0.25ml of 37 ℃ of preheatings, blows and beats gently the mixing cell with dropper;

7. get the 10ul cell suspension and add blood counting chamber, the microscopically counting is counted every ml suspension cell quantity.With the serum free medium diluting cells suspension of 37 ℃ of preheatings to 2.5*106/ml;

Immunodotting detects

1. add following reagent in above-mentioned 96 coated hole filter membrane plates: (1) 50ul serum free medium is to each negative control hole; (2) 50ul PHA-P HA is to each positive control hole; (3) 50ul mycobacterium tuberculosis recombinant fusion protein ESAT6/ESAT6 to each detect the hole;

2. every hole adds 100ul to contain the PBMC cell suspension of 2.5*106/ml;

3. 96 hole filter membrane plates are put into wetting 37 ℃, 5% CO2 incubator, fixed temperature and humidity was cultivated 18-20 hours;

4. 96 hole filter membrane plates are taken out, abandon culture supernatant, add 4 ℃ of 5min after 10min(-20 ℃ of 5min of frozen water lysing cell of 200ul precooling), wash plate 5 times with 1*PBST, 1min/ time, pat dry after washing for the last time plate;

5. add biotin labeled IFN-γ and detect antibody 100ul/ hole (the PBS dilution is 1ug/ml), hatched 1 hour for 37 ℃, knockout plate is washed plate 5 times with the PBST of 200ul, 1min/ time, pats dry after washing for the last time plate;

6. the streptavidin 100ul that adds alkali phosphatase enzyme mark is hatched 30min for 37 ℃, discards liquid, washes plate 5 times with the PBST of 200ul, 1min/ time, pats dry after washing for the last time plate;

7. every hole adds 100ul BCIP/NBT substrate solution, and room temperature lucifuge colour developing 7-15min grows to suitable size to spot;

8. occur the bluish voilet spot at the bottom of plate, with three termination reactions of distillation washing plate, plate is put into 37 ℃ of oven for drying;

9. use enzyme connection spot analysis instrument to carry out the painted spot of analysis of accounts, or use microscope or magnifying glass to count, each point represents the T lymphocyte of a secretion IFN-γ.

One, doing clinical sample with embodiment 2 experimental programs detects, adopt simultaneously approved listing and the clinical quality product preferably that generally believes at present: Beijing Wantai Biological Pharmacy Enterprise Co., Ltd.'s reagent, name is called: mycobacterium tuberculosis gamma-interferon detection kit (release in vitro euzymelinked immunosorbent assay (ELISA)) reagent (authentication code is: state's food medicine is supervised tool (standard) word 2012 No. 3400557) in contrast of be correlated with.Every kind of recombinant protein ESAT6c1, ESAT6c2, ESAT6c3, ESAT6c4, ESAT6c5 and ESAT6c6 respectively make 30 routine samples.

1. take ESAT6c1 as example, data such as table 1:

Figure 201310076675X100002DEST_PATH_IMAGE002

2. calculate yin and yang attribute coincidence rate and total coincidence rate (comparing with contrast agents) of test reagent, concrete grammar is as follows:

Positive coincidence rate=13/13 * 100%=100%;

Negative match-rate=15/17 * 100%=88.24%;

Total coincidence rate=(13+15)/(13+2+0+15) * 100%=93.33%;

3. result shows:

Detect as stimulus with ESAT6c1, the positive coincidence rate of result of determination is 84.61%%, and negative match-rate is 82.35%, and total coincidence rate is 83.33%, and coincidence rate is good;

Detect as stimulus with ESAT6c2, the positive coincidence rate of result of determination is 100%, and negative match-rate is 88.24%, and total coincidence rate is 93.33%, and coincidence rate is good;

Detect as stimulus with ESAT6c3, the positive coincidence rate of result of determination is 92.31%, and negative match-rate is 82.35%, and total coincidence rate is 86.67%, and coincidence rate is good;

Detect as stimulus with ESAT6c4, the positive coincidence rate of result of determination is 100%, and negative match-rate is 82.35%, and total coincidence rate is 90%, and coincidence rate is good;

Detect as stimulus with ESAT6c5, the positive coincidence rate of result of determination is 84.62%, and negative match-rate is 82.35%, and total coincidence rate is 83.33%, and coincidence rate is good;

Detect as stimulus with ESAT6c6, the positive coincidence rate of result of determination is 92.31%, and negative match-rate is 88.24%, and total coincidence rate is 90%, and coincidence rate is good.

Two, do clinical sample with embodiment 3 experimental programs and detect, the tuberculosis infection T cell detection kit (immune spot-ing) that adopts simultaneously Oxford Immunotec Ltd. is reagent (number of registration is No. the 3402556th, state's food medicine prison tool (advancing) word 2010) in contrast.Every kind of recombinant protein ESAT6c1, ESAT6c2, ESAT6c3, ESAT6c4, ESAT6c5 and ESAT6c6 respectively make 24 routine samples.

1. take ESAT6c2 as example, data such as table 3:

Figure 201310076675X100002DEST_PATH_IMAGE004

Positive coincidence rate=12/13 * 100%=92.31%;

Negative match-rate=11/11 * 100%=100%;

Total coincidence rate=(12+11)/(12+0+1+11) * 100%=95.83%;

3. result shows, detects as stimulus with ESAT6c1, and the positive coincidence rate of result of determination is 76.92%, and negative match-rate is 90.91%, and total coincidence rate is 83.33%, and coincidence rate is good;

Detect as stimulus with ESAT6c2, the positive coincidence rate of result of determination is 92.31%, and negative match-rate is 100%, and total coincidence rate is 95.83%, and coincidence rate is good;

Detect as stimulus with ESAT6c3, the positive coincidence rate of result of determination is 92.31%, and negative match-rate is 90.91%, and total coincidence rate is 91.67%, and coincidence rate is good;

Detect as stimulus with ESAT6c4, the positive coincidence rate of result of determination is 84.62%, and negative match-rate is 90.91%, and total coincidence rate is 87.50%, and coincidence rate is good;

Detect as stimulus with ESAT6c5, the positive coincidence rate of result of determination is; 92.31%, negative match-rate is 81.82%, and total coincidence rate is 87.50%, and coincidence rate is good;

Detect as stimulus with ESAT6c6, the positive coincidence rate of result of determination is 84.62%, and negative match-rate is 81.82%, and total coincidence rate is 83.33%, and coincidence rate is good.

Claims

1. codon optimized gene order of mycobacterium tuberculosis ESAT-6 6 genes of encoding, it is characterized in that: its single copy core former times acid sequence is as shown in SEQ ID NO.1,2 copy nucleosides in series acid sequences are as shown in SEQ ID NO.2,3 copy nucleosides in series acid sequences are as shown in SEQ ID NO.3,4 copy nucleosides in series acid sequences are as shown in SEQ ID NO.4,5 copy nucleosides in series acid sequences are as shown in SEQ ID NO.5,6 copy nucleosides in series acid sequences are as shown in SEQ ID NO.6, and ESAT6 gene series connection number of times includes but not limited to 1-6 time.

2. mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it is characterized in that: it is by codon optimized gene order coding claimed in claim 1, its single copy aminoacid sequence is as shown in SEQ ID NO.7,2 copy aminoacid sequences are as shown in SEQ ID NO.8,3 copy aminoacid sequences are as shown in SEQ ID NO.9,4 copy aminoacid sequences are as shown in SEQ ID NO.10,5 copy aminoacid sequences are as shown in SEQ ID NO.11,6 copy aminoacid sequences are as shown in SEQ ID NO.12, and 6 kDa early secretory antigenic target series connection number of times includes but not limited to 1-6 time.

3. the expression vector of mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it is characterized in that: it is that the described codon optimized gene order of claim 1 is inserted into respectively on plasmid pET-25b, obtain recombinant plasmid ESAT6c1-pET25b, ESAT6c2-pET25b, ESAT6c3-pET25b, ESAT6c4-pET25b, ESAT6c5-pET25b or ESAT6c6-pET25b, carrier includes but not limited to pET25b.

4. engineering strain of expressing mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins, it is characterized in that: it contains expression vector claimed in claim 3, its Host Strains be intestinal bacteria ( Escherichia coli).

5. the chemoluminescence method test kit of a detecting tubercle bacillus infection in vitro of setting up based on mycobacterium tuberculosis ESAT-6 claimed in claim 26 series connection recombination fusion proteins, it is characterized in that: utilize mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins claimed in claim 2, stimulate person under inspection's peripheral blood to discharge gamma-interferon, and measure the variation of gamma-interferon by chemiluminescent method, whether diagnosis infects mycobacterium tuberculosis.

6. the TCELL-SPOT test kit of a detecting tubercle bacillus infection in vitro of setting up based on mycobacterium tuberculosis ESAT-6 claimed in claim 26 series connection recombination fusion proteins, it is characterized in that: utilize mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins claimed in claim 2, stimulate person under inspection's periphery blood T lymphocyte, and spot formation what the method by ELISPOT measures, and whether diagnosis infects mycobacterium tuberculosis.

7. the application of described mycobacterium tuberculosis ESAT-6 6 series connection recombination fusion proteins in preparation monoclonal antibody, many anti-, detection kit and protein chip according to claim 2.