CN109884323A - Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection method and application - Google Patents
Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection method and application Download PDFInfo
- Publication number
- CN109884323A CN109884323A CN201910070322.6A CN201910070322A CN109884323A CN 109884323 A CN109884323 A CN 109884323A CN 201910070322 A CN201910070322 A CN 201910070322A CN 109884323 A CN109884323 A CN 109884323A
- Authority
- CN
- China
- Prior art keywords
- estradiol
- choriogenin
- bastard halibut
- bastard
- halibut
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection method and application.Bastard halibut estradiol choriogenin is prepared by the method for prokaryotic expression, mouse is immunized and develops Bastard halibut estradiol choriogenin polyclonal antibody, and will be on the antibody of horseradish peroxidase-labeled to purifying；By Bastard halibut estradiol choriogenin sterling, the anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse, the anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse of horseradish peroxidase-labeled, 96 hole elisa Plates of blank and coating buffer, cleaning solution, confining liquid, sample diluting liquid, developing solution, the terminate liquid each 1 common sandwich ELISA lcits for being packed into box body, obtaining detecting Bastard halibut estradiol choriogenin.Kit of the invention can estradiol choriogenin in sensitive, accurate quantitative analysis Bastard halibut blood plasma, whole homogenate, liver organization and hepatocyte cultures liquid, detection range is 1.95~250 ng/mL‑1, important tool is provided for screening, detection and the Ecological Environment Risk evaluation of marine environment estrogen.
Description
Technical field
The invention belongs to environmental testings, and in particular to a kind of Bastard halibut estradiol choriogenin sandwich ELISA lcits
And the preparation method and application thereof.
Background technique
After environmental estrogens enter body as a kind of exogenous compounds, the conjunction with normal secretions substance in interfering bodies
At, release, operating, metabolism, in conjunction with etc. processes, activate or inhibit endocrine system function, thus destroy its maintain stable machine
Property and regulating and controlling effect.In recent years, in environment estrogen pollution the ecological balance of natural environment and the health of the mankind are constituted it is latent
Threat, after environmental estrogens substance enters human body, women often has the diseases such as fibroid, oophoroma, and male often has
The symptoms such as carcinoma of testis, the quantity of sperm and quality decline.Male ray trout can be caused to generate raun lower than the female alkynol of 1 ng/L special
Some vitellogenins, and the female alkynol of 4 ng/L can lead to the sex deviation of juvenile fish, secondary sex characters changes.Marine environment
Estrogen can lead to fish population viability and fishery resources decline.The pollution of marine environment estrogen is got worse, wherein China
The concentration of the common estrogen such as estradiol, female alkynol, bisphenol-A reaches 45.7 ng/L, 3.99 ng/L, 3920 in coastal seawater
ng/L.Therefore, it is the detection for solving China coastal seas marine environment estrogenic activity, needs to establish sensitiveer, accurate, easy inspection
Survey technology.
Estradiol choriogenin is a kind of environmental estrogens biomarker newfound in recent years, is a kind of female specificity
Albumen usually in milter and juvenile fish body and is not present, but before capable of synthesizing under the induction of environmental estrogens and secrete chorion
Body protein.It is living that the estrogen in water body environment can be evaluated by detection milter or the intracorporal estradiol choriogenin content of juvenile fish
Property.Compared with currently used environmental estrogens biomarker vitellogenin, estradiol choriogenin can be more sensitive quick
Ground responds environmental estrogens.1 ng/L E2Can significantly raise male ocean blueness Medaka (Oryzias javanicus)
Liver estradiol choriogenin gene expression dose, and its relative expression quantity will be apparently higher than the gene expression water of vitellogenin
It is flat.Therefore, estradiol choriogenin is the more sensitive biomarker of environmental estrogens screening, however at present both at home and abroad not
The detection kit of estradiol choriogenin is established, main reason is that traditional isolation and purification method is difficult to obtain chorion from fish body
Precursor protein can not provide the antigen of high-purity for the exploitation of ELISA, cause still establish accurate quantitative analysis chorion precursor so far
The ELISA method of albumen.Therefore, the present invention uses prokaryotic expression technology preparation and reorganization estradiol choriogenin, and preparation is highly sensitive
Antibody, to establish the immunoassay technology of estradiol choriogenin, preparation is able to detect the kit of ocean estrogenic activity.
Bastard halibut (Paralichthys olivaceus) belonging to Pleuronectiformes, Bothidae, lefteye flounder subfamily, Paralichthys are China
Important sea-farming economic fish.Bastard halibut usually only in coastal waters activity, not will do it long range migration, can accurately reflect
The pollution situation of habitat is highly suitable as the instruction fingerling of marine pollutant monitoring.Be distributed mainly on China the yellow Bohai Sea,
The East Sea and Korea, the Japanese stretch of coastal water.It therefore, is the detection for realizing China coastal seas marine environment estrogenic activity, the present invention
Environmental estrogens are detected as biomarker using the estradiol choriogenin of Bastard halibut.
Summary of the invention
The purpose of the present invention is to provide a kind of Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection methods
With application, to meet the above-mentioned requirements of the prior art.
A kind of detection Bastard halibut estradiol choriogenin sandwich ELISA lcits, including 1 piece of 96 hole elisa Plates of blank, coating
Liquid, confining liquid, sample diluting liquid, cleaning solution, developing solution, terminator,
Characterized by further comprising Bastard halibut estradiol choriogenin sterlings 1, the anti-Bastard halibut estradiol choriogenin Anti-TNF-α of mouse
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse 1 of body 1, horseradish peroxidase-labeled.
In the sandwich ELISA lcits of above-mentioned detection Bastard halibut estradiol choriogenin,
The Bastard halibut estradiol choriogenin sterling is prepared using prokaryotic expression technology；
The Bastard halibut estradiol choriogenin polyclonal antibody is the Bastard halibut estradiol choriogenin obtained using abovementioned steps
Sterling preparation；
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of the mouse of the horseradish peroxidase-labeled is to utilize abovementioned steps
The anti-Bastard halibut estradiol choriogenin Antibody preparation of obtained mouse.It is specific as follows:
The Bastard halibut estradiol choriogenin sterling is to prepare using the following method:
(1) pass through intramuscular injection 17βEstradiol induction Bastard halibut liver largely transcribes Chg H mRNA, extracts liver with Trizol
Dirty total serum IgE obtains cDNA through reverse transcription, using the cDNA after inverting as template, utilizes primers F:
CACCCAAGTTTTCAAGTCTCAGCAGTC, R:CCGCTTACTGAGCAGGGTCAATGAAT carry out PCR amplification, recycle purpose
Segment；After being connect target fragment with pClone007 carrier with T4 ligase, connection product is converted to DH5 α competent cell
In, and be sequenced, sequencing is correctly expanded culture, plasmid is extracted, PCR amplification is carried out with above-mentioned primer, glue is cut and returns
Receive target fragment；
(2) after connecting the target fragment of recycling with pDE1 expression vector, connection product is converted to expressive host bacterium BL21
(DE3)；And the host strain correctly expressed is expanded and is cultivated, that is, the IPTG of final concentration of 0.1 mM is added, is placed in 37 DEG C of constant temperature and shakes
Shake culture 10 hours in bed, cultured 5000 rpm of bacterium solution is centrifuged 20 min, collects precipitating, after lysate is handled,
Inclusion body is collected by centrifugation again, 30 mL lysates (100 mM Tris, 500 mM NaCl, 10 mM miaows are added into inclusion body
Azoles, 8 M urea, pH8.0), 4 DEG C are stirred overnight；Dissolved 10000 rpm of inclusion body is centrifuged 30 min, collects supernatant simultaneously
0.45 μm of filter membrane is crossed, magnetic beads for purifying is chelated using nickel ion, is i.e. acquisition Bastard halibut estradiol choriogenin sterling.
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of the mouse is to prepare using the following method:
The Bastard halibut estradiol choriogenin sterling and isometric not formula that the 0.1 mL above-mentioned steps for containing 70 μ g are obtained are complete
Mouse peritoneal is injected into after adjuvant emulsion, it is incomplete with same dose of Bastard halibut estradiol choriogenin sterling and Freund after two weeks
Booster immunization is carried out to Balb/c mouse after adjuvant is fully emulsified, after a week tail vein injection Bastard halibut estradiol choriogenin sterling
Booster immunization is carried out, the serum of mouse is taken after three days, purifies adaptive immune ball from serum using Protein G affinity column
Protein I gG, for the Immunoglobulin IgG of purifying through PBS buffer solution 24 h of dialysis, i.e. acquisition Bastard halibut estradiol choriogenin is polyclonal
Antibody.
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of the horseradish peroxidase-labeled mouse is using the following method
Preparation:
1 mg horseradish peroxidase is added to the 0.1 M NaIO that 2 ml newly match4Solution is protected from light 20 min of stirring at room temperature；
Solution is fitted into bag filter, with the sodium-acetate buffer dialysed overnight of 1mM pH4.4；0.16 M glycol water is added
0.5 ml is placed at room temperature for 30 min；The Bastard halibut estradiol choriogenin polyclonal antibody that 1 mg above-mentioned steps obtain is added, then
With 0.05 M pH9.5 carbonate buffer solution dialysed overnight, make Bastard halibut estradiol choriogenin polyclonal antibody and horseradish peroxidating
Object enzyme sufficiently combines；The NaBH of 5mg/ml is added4Solution 0.1ml is mixed, loading bag filter, with PBS dialysed overnight at 4 DEG C；
3000 r/min are centrifuged 30min, and collecting supernatant is that the anti-Bastard halibut estradiol choriogenin of horseradish peroxidase-labeled mouse is more
Clonal antibody.
Finally, obtained Bastard halibut estradiol choriogenin sterling 1, the obtained anti-Bastard halibut estradiol choriogenin of mouse are resisted
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of body 1, the mouse for obtaining horseradish peroxidase-labeled 1 and coating buffer,
Confining liquid, sample diluting liquid, cleaning solution, developing solution, terminate liquid each 1 is put into box, obtains detection Bastard halibut chorion precursor egg
White sandwich ELISA lcits.
Above-mentioned detection Bastard halibut estradiol choriogenin sandwich ELISA lcits are in marine environment estrogen pollution detection
Using.
Advantages of the present invention
The present invention is the detection sensitivity and specificity further increased to minor levels estrogenic activity, with it is a kind of it is stable not
It is antigen and its polyclonal antibody there are the estradiol choriogenin of degradation problem, establishes sandwich ELISA quantitative approach.And
A large amount of preparations of estradiol choriogenin are realized using prokaryotic expression technology, so that preparing highly sensitive antibody establishes correct amount ovum
The ELISA method of shell precursor protein, it is living to reach the lower level estrogen of detection.Sandwich ELISA and indirect competitive ELISA
Short compared to the operating time, the advantages that workload is small, and detection sensitivity is higher, facilitates detection Bastard halibut blood plasma, liver organization
With the estradiol choriogenin in hepatocyte cultures liquid, it is the sieve of environmental estrogens that detection range, which is 1.95~250 ng/mL,
Choosing, detection and Ecological Environment Risk evaluation provide effective means.
Detailed description of the invention
Fig. 1 is the testing result to Bastard halibut estradiol choriogenin expression vector prepared by the present invention.
Fig. 2 is the testing result to Bastard halibut estradiol choriogenin sterling prepared by the present invention.
Fig. 3 is the ELISA testing result of kit of the invention to Bastard halibut estradiol choriogenin standard items.
Specific embodiment:
A kind of sandwich ELISA lcits for examining Bastard halibut estradiol choriogenin, including 1 piece of 96 hole elisa Plates of blank, coating buffer, envelope
Liquid, sample diluting liquid, cleaning solution, developing solution, terminator are closed,
Characterized by further comprising the anti-Bastard halibut estradiol choriogenin polyclonal antibodies of mouse 1, horseradish peroxidase-labeled
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse 1, Bastard halibut estradiol choriogenin sterling 1.
Preparation detection Bastard halibut estradiol choriogenin sandwich ELISA lcits the following steps are included:
(1) Bastard halibut estradiol choriogenin sterling is prepared using prokaryotic expression technology
1. the building of estradiol choriogenin prokaryotic expression carrier
Pass through intramuscular injection E2Induction Bastard halibut liver largely transcribes Chg H mRNA, extracts liver total RNA with Trizol, according to
II 1st Strand cDNA Synthesis Kit(TaKaRa company of PrimeScriptTM) illustrate that reverse transcription obtains cDNA.
The upstream and downstream primer that different restriction enzyme sites are had using the design of Primer 5.0, carries out PCR amplification, digestion primer sequence are as follows: F:
CACCCAAGTTTTCAAGTCTCAGCAGTC, R:CCGCTTACTGAGCAGGGTCAATGAAT carry out PCR amplification condition are as follows:
98 DEG C of initial denaturation 1 min, 95 DEG C of denaturation 20 s, 55 DEG C of annealing 20 s, 72 DEG C of 1 min of extension, 30 s, 72 DEG C after 30 circulations
Continue to extend 5 min.PCR product is recycled through 1% agarose gel electrophoresis, is purified.With T4 ligase by the target fragment of purifying with
PClone007 carrier connection after, connection product is converted into DH5 α competent cell, select positive colony carry out identification and
Sequence verification.Correct bacterium solution will be sequenced to expand culture, carried out with EasyPure Plasmid MiniPrep Kit small
Amount extracting plasmid carries out PCR amplification, PCR amplification condition are as follows: 98 DEG C of initial denaturations 3 using the plasmid of extraction as template with above-mentioned primer
Min, 98 DEG C of 20 s of denaturation, 55 DEG C of 10 s of annealing, 72 DEG C of 30 s of extension, 72 DEG C recycle 2 min eventually, totally 25 circulations, by PCR
Product is through 1% agarose gel electrophoresis recovery purifying.After the target fragment of purifying is connect with pDE1 expression vector, connection is produced
Object convert to DH5 α competent cell and select monoclonal positive bacteria expand culture with bacterium solution PCR, then will have been built up
Recombinant expression carrier convert to Bacillus coli expression host strain BL21 (DE3), and by the host strain correctly expressed expand cultivate,
The IPTG of final concentration of 0.1 mM is added, is placed in 37 DEG C of constant-temperature tables shake culture 10 hours, that is, obtains before can expressing chorion
The expression vector of body protein.Fig. 1 is the testing result to prepared Bastard halibut estradiol choriogenin expression vector.
2. the preparation of estradiol choriogenin recombinant protein
The inducing expression condition of the CHg H recombinant protein obtained using step (1) expands culture, the expression large intestine bar that will have been induced
Bacterium dispenses to 50 mL centrifuge tubes, and 5000 rpm of room temperature is centrifuged 20 min in supercentrifuge, collects bacterial sediment.In every pipe
25 mL lysates (100 mM NaCl, 50 mM Tris, PH 8.0) is added, thallus is resuspended, and PMSF is added, it is broken using ultrasound
Broken method extracts albumen, and ultrasonic power is 360 W, and each cyclic program of ultrasound is 2 s of ultrasound, and 3 s of interval, totally 360 are followed
Ring, entire ultrasonic procedure carry out on ice.After ultrasound, suspension is placed in 4 DEG C with 12000 rpm revolving speeds centrifugation 30
Min, being centrifuged obtained precipitating is inclusion body, and the albumen insoluble in lysate is contained in the inside.25 mL are added into inclusion body
The cleaning solution (50 mM Tris, 100 mM NaCl, 0.5 mM EDTA, 2 M urea) of the X-100 containing 2%Triton, piping and druming are equal
Even inclusion body precipitating, stands after 10 min that 4 DEG C of 10000 rpm is centrifuged 20 min in supercentrifuge on ice, abandons supernatant and protects
Stay precipitating.Repeated washing is primary.Then it is washed repeatedly 2 times with the cleaning solution without Triton X-100 again.To the packet after washing
Contain in body and 30 mL lysates (100 mM Tris, 500 mM NaCl, 10 mM imidazoles, 8 M urea, PH=8.0) is added, blows
It beats uniformly, is placed on magnetic stirring apparatus and is stirred overnight, whole operation process carries out at 4 DEG C.Dissolved inclusion body is in height
4 DEG C of 10000 rpm is centrifuged 30 min in fast centrifuge, collects supernatant and crosses 0.45 μm of filter membrane, that is, is prepared for chorion precursor egg
It is white.
3. the purifying of estradiol choriogenin recombinant protein
The supernatant containing destination protein 2. obtained using step chelates magnetic bead using nickel ion to purify the total egg of Escherichia coli
Bastard halibut ChgH recombinant protein in white.Centrifuge tube equipped with 2 mL bead suspensions is placed on magnetic separator, magnetic is carried out
Property separation, remove preservation liquid, 5mL Binding Buffer (20 mM Na be added3PO4, 500 mM NaCl, 5~50 mM
Imidazoles) into the above-mentioned centrifuge tube equipped with magnetic bead, liquid-transfering gun is blown and beaten for several times, and magnetic bead is made to suspend again, carries out Magnetic Isolation, removal
Supernatant.After above-mentioned pretreated magnetic bead and crude protein sample are sufficiently mixed suspension, it is placed in room temperature rotation mixing on shaking table and is incubated for
30 min, Magnetic Isolation remove solution standby detection.10mL Washing Buffer (20 mM Na are added3PO4, 500 mM
NaCl, 50 ~ 100 mM imidazoles) into magnetic bead pipe, piping and druming mixes again, Magnetic Isolation, collects cleaning solution standby detection, repeats
Above-mentioned steps 1 time.10 mL Washing Buffer are added again, new pipe is transferred to after resuspension, 1 ~ 10mL Elution is added
Buffer (20 mM Na3PO4, 500 mM NaCl, 500 mM imidazoles) and piping and druming mixing, Magnetic Isolation, collecting eluent is
Obtain the estradiol choriogenin recombinant protein of high-purity.Fig. 2 is the detection to prepared Bastard halibut estradiol choriogenin sterling
As a result.
(2) preparation of estradiol choriogenin polyclonal antibody
Mouse is immunized using the Bastard halibut estradiol choriogenin sterling that step 1 obtains, 0.1 mL is contained to the chorion precursor of 70 μ g
It is injected into mouse peritoneal after albumen and the emulsification of isometric not formula Freund's complete adjuvant, after two weeks with same dose of estradiol choriogenin
With incomplete Freund's adjuvant it is fully emulsified after booster immunization, after a week tail vein injection chorion precursor egg are carried out to Balb/c mouse
White carry out booster immunization, puts to death mouse after three days, takes the serum of mouse, using Protein G affinity column from ascites supernatant
Middle purifying adaptive immune globulin IgG.The antibody of purifying is dialysed through ultrapure water after 24 h, i.e. acquisition Bastard halibut estradiol choriogenin
Polyclonal antibody.
(3) preparation of the anti-Bastard halibut estradiol choriogenin polyclonal antibody of horseradish peroxidase-labeled mouse
1 mg horseradish peroxidase is added to the 0.1 M NaIO4 solution that 2 ml newly match, is protected from light 20 min of stirring at room temperature；
Solution is fitted into bag filter, with the sodium-acetate buffer dialysed overnight of 1mM pH4.4；0.16 M glycol water is added
0.5 ml is placed at room temperature for 30 min；The Bastard halibut estradiol choriogenin polyclonal antibody of 3 mg purifying is added, is packed into bag filter,
Dialysed overnight is slowly stirred with 0.05 M pH9.5 carbonate buffer solution, makes the anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse
In conjunction with horseradish peroxidase；The NaBH of the 5mg/ml newly matched is added4Solution 0.1ml is mixed, and is packed into bag filter, at 4 DEG C with
PBS dialysed overnight；3000 r/min are centrifuged 30min, and collecting supernatant is the anti-Bastard halibut ovum of horseradish peroxidase-labeled mouse
Shell precursor protein polyclonal antibody.
Finally, by the Bastard halibut estradiol choriogenin sterling 1 of preparation, the anti-Bastard halibut estradiol choriogenin Anti-TNF-α of mouse
Body 1, horseradish peroxidase-labeled Bastard halibut estradiol choriogenin polyclonal antibody 1, one piece of 96 hole elisa Plates of blank, with
And in 1 coating buffer, confining liquid, sample diluting liquid, cleaning solution, developing solution and terminate liquid loading box body, constitute examination of the invention
Agent box.
Its concrete composition is as follows:
1) 1 piece of 96 hole elisa Plates of blank；
2) Bastard halibut estradiol choriogenin sterling 1 is diluted to required concentration with sample diluting liquid using preceding；
3) the anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse 1 is diluted to 3 μ g/ml with coating buffer using preceding；
4) the Bastard halibut estradiol choriogenin polyclonal antibody 1 of horseradish peroxidase-labeled, uses sample diluting liquid before use
It is diluted by the volume ratio of 1:4000；
5) each 1 of coating buffer, cleaning solution, confining liquid, sample diluting liquid, developing solution, terminator, the coating buffer are 50mM
9.6 carbonate buffer solution of pH: 1.59g Na2CO3, 2.93g NaHCO3, add distilled water to 1000ml；Cleaning solution is containing 0.05%
The 150mM pH7.4 phosphate buffer of Tween-20: 8.0g NaCl, 0.2g KCl, 2.9g Na2HPO412H2O, 0.2g
KH2PO4,0.5 ml Tween-20, adds distilled water to 1000ml；Confining liquid is the pH7.4 phosphate buffer containing 2% BSA:
0.2g BSA is dissolved in the phosphate buffer of 10 ml pH 7.4；Sample diluting liquid is containing 0.05% Tween-20,1% BSA
150mM phosphate buffer, pH 7.4:0.1g BSA are dissolved in 10ml confining liquid；Developing solution is that the Rider Beijing Nuo Bo science and technology is limited
The TMB one pack system developing solution of company's production；Terminate liquid is the H of 2M2SO4Aqueous solution.
The sandwich ELISA lcits of detection Bastard halibut estradiol choriogenin of the invention, can be used for endocrine disturbing chemistry
The detection of substance.It is divided into following steps when use:
1) with the Bastard halibut estradiol choriogenin polyclonal antibody in coating buffer dilution kit to 5 μ g/ml, in 96 hole of blank
100 holes μ l/ are added in ELISA Plate, 4 DEG C of coatings overnight, discard solution in hole, wash liquid 3 times；
2) confining liquid is added in 96 hole elisa Plates, 300 holes μ L/ are incubated for 1 hour at room temperature, discard solution in hole, washing 3
It is secondary；
3) Bastard halibut estradiol choriogenin sterling is diluted to 3.9 with sample diluting liquid, 7.8,15.62,31.25,62.5,
125,250 ng/mL；Each sterling, 100 hole μ L/ of sample to be tested are added in 96 hole elisa Plates, is incubated for 1 hour, discards at 37 DEG C
Solution in hole washs 5 times；
4) in 96 hole elisa Plates 1:4000 times of sample diluting liquid diluted horseradish peroxidase-labeled of addition Bastard halibut
Estradiol choriogenin polyclonal antibody, 100 holes μ L/ are incubated at room temperature 1 hour, discard solution in hole, are washed 5 times；
5) developing solution, 100 holes μ L/, in 37 DEG C of room temperature dark place, 10 min of reaction are added in 96 hole elisa Plates；
6) add terminate liquid, 50 holes μ L/ after apparent yellow to be presented；
7) light absorption value in each hole under 450 nm wavelength is measured with microplate reader, measurement carries out within 15 minutes after adding terminate liquid；
8) calculate: using the logarithm of the concentration of reference substance as abscissa, OD value is that ordinate makees standard curve, with reference substance
Concentration and OD value calculate the linear regression equation of standard curve, and the OD value of sample is substituted into equation, it is dense to calculate sample
Degree, multiplied by extension rate, the actual concentrations of Bastard halibut estradiol choriogenin as in sample.Kit of the invention is to brown tooth
The ELISA testing result of flounder estradiol choriogenin standard items is as shown in Figure 3.
Sequence table
<110>Chinese Marine University
<120>Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213>Bastard halibut (Paralichthys olivaceus)
<400> 1
cacccaagtt ttcaagtctc agcagtc 27
<210> 2
<211> 26
<212> DNA
<213>Bastard halibut (Paralichthys olivaceus)
<400> 2
ccgcttactg agcagggtca atgaat 26
Claims (6)
1. a kind of sandwich ELISA lcits for detecting Bastard halibut estradiol choriogenin, including 1 piece of 96 hole elisa Plates of blank, coating
Liquid, confining liquid, sample diluting liquid, cleaning solution, developing solution, terminate liquid each 1,
Characterized by further comprising Bastard halibut estradiol choriogenin sterlings 1, the anti-Bastard halibut estradiol choriogenin Anti-TNF-α of mouse
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse 1 of body 1, horseradish peroxidase-labeled.
2. the sandwich ELISA lcits of detection Bastard halibut estradiol choriogenin according to claim 1, it is characterised in that institute
The Bastard halibut estradiol choriogenin sterling stated is to prepare using the following method:
(1) pass through intramuscular injection 17βEstradiol induction Bastard halibut liver largely transcribes Chg H mRNA, extracts liver with Trizol
Dirty total serum IgE obtains cDNA through reverse transcription, using the cDNA after inverting as template, utilizes primers F:
CACCCAAGTTTTCAAGTCTCAGCAGTC, R:CCGCTTACTGAGCAGGGTCAATGAAT carry out PCR amplification, recycle purpose
Segment；After being connect target fragment with pClone007 carrier with T4 ligase, connection product is converted to DH5 α competent cell
In, and be sequenced, sequencing is correctly expanded culture, plasmid is extracted, PCR amplification is carried out with above-mentioned primer, glue is cut and returns
Receive target fragment；
(2) after connecting the target fragment of recycling with pDE1 expression vector, connection product is converted to expressive host bacterium BL21
(DE3)；And the host strain correctly expressed is expanded and is cultivated, that is, the IPTG of final concentration of 0.1 mM is added, is placed in 37 DEG C of constant temperature and shakes
Shake culture 10 hours in bed, cultured 5000 rpm of bacterium solution is centrifuged 20 min, collects precipitating, after lysate is handled,
Inclusion body is collected by centrifugation again, 30 mL lysates (100 mM Tris, 500 mM NaCl, 10 mM miaows are added into inclusion body
Azoles, 8 M urea, pH8.0), 4 DEG C are stirred overnight；Dissolved 10000 rpm of inclusion body is centrifuged 30 min, collects supernatant simultaneously
0.45 μm of filter membrane is crossed, magnetic beads for purifying is chelated using nickel ion, is i.e. acquisition Bastard halibut estradiol choriogenin sterling.
3. the sandwich ELISA lcits of detection Bastard halibut estradiol choriogenin according to claim 2, it is characterised in that institute
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of the mouse stated is to prepare using the following method:
The Bastard halibut estradiol choriogenin sterling and isometric not formula that the 0.1 mL above-mentioned steps for containing 70 μ g are obtained are complete
Mouse peritoneal is injected into after adjuvant emulsion, it is incomplete with same dose of Bastard halibut estradiol choriogenin sterling and Freund after two weeks
Booster immunization is carried out to Balb/c mouse after adjuvant is fully emulsified, after a week tail vein injection Bastard halibut estradiol choriogenin sterling
Booster immunization is carried out, the serum of mouse is taken after three days, purifies adaptive immune ball from serum using Protein G affinity column
Protein I gG, for the Immunoglobulin IgG of purifying through PBS buffer solution 24 h of dialysis, i.e. the acquisition anti-Bastard halibut estradiol choriogenin of mouse is more
Clonal antibody.
4. the sandwich ELISA lcits of detection Bastard halibut estradiol choriogenin as claimed in claim 3, it is characterised in that described
The anti-Bastard halibut estradiol choriogenin polyclonal antibody of horseradish peroxidase-labeled mouse be to prepare using the following method:
1 mg horseradish peroxidase is added to the 0.1 M NaIO that 2 ml newly match4Solution is protected from light 20 min of stirring；By solution
It is fitted into bag filter, with the sodium-acetate buffer dialysed overnight of 1 mM pH4.4；0.16 M glycol water, 0.5 ml is added,
It is placed at room temperature for 30 min；The Bastard halibut estradiol choriogenin polyclonal antibody that 1 mg above-mentioned steps obtain is added, then with 0.05
M pH9.5 carbonate buffer solution dialysed overnight makes the anti-Bastard halibut estradiol choriogenin polyclonal antibody of mouse and horseradish peroxidase
Enzyme sufficiently combines；The NaBH of 5mg/ml is added4Solution 0.1ml is mixed, and is packed into bag filter, PBS dialysed overnight at 4 DEG C；3000
R/min is centrifuged 30 min, and collecting supernatant is that the anti-Bastard halibut estradiol choriogenin of horseradish peroxidase-labeled mouse is polyclonal
Antibody.
It is examined 5. Bastard halibut estradiol choriogenin sandwich ELISA lcits described in claim 1 are polluted in marine environment estrogen
Application in survey.
6. utilizing Bastard halibut estradiol choriogenin sandwich ELISA lcits detection endocrine disturbing chemistry described in claim 1
The method of substance, it is characterised in that the following steps are included:
1) with the Bastard halibut estradiol choriogenin polyclonal antibody in coating buffer dilution kit to 5 μ g/ml, in 96 hole of blank
100 holes μ l/ are added in ELISA Plate, 4 DEG C of coatings overnight, discard solution in hole, wash liquid 3 times；
2) confining liquid is added in 96 hole elisa Plates, 300 holes μ L/ are incubated for 1 hour at room temperature, discard solution in hole, washing 3
It is secondary；
3) Bastard halibut estradiol choriogenin sterling is diluted to 3.9 with sample diluting liquid, 7.8,15.62,31.25,62.5,
125,250 ng/mL are as reference substance；Each sterling, 100 hole μ L/ of sample to be tested are added in 96 hole elisa Plates, is incubated at 37 DEG C
1 hour, solution in hole is discarded, is washed 5 times；
4) in 96 hole elisa Plates 1:4000 times of sample diluting liquid diluted horseradish peroxidase-labeled of addition Bastard halibut
Estradiol choriogenin polyclonal antibody, 100 holes μ L/ are incubated at room temperature 1 hour, discard solution in hole, are washed 5 times；
5) developing solution, 100 holes μ L/, in 37 DEG C of room temperature dark place reaction 10min are added in 96 hole elisa Plates；
6) add terminate liquid, 50 holes μ L/ after apparent yellow to be presented；
7) light absorption value in each hole under 450 nm wavelength is measured with microplate reader, measurement carries out within 15 minutes after adding terminate liquid；
8) calculate: using the logarithm of the concentration of reference substance as abscissa, OD value is that ordinate makees standard curve, with reference substance
Concentration and OD value calculate the linear regression equation of standard curve, and the OD value of sample is substituted into equation, it is dense to calculate sample
Degree, multiplied by extension rate, the actual concentrations of Bastard halibut estradiol choriogenin as in sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910070322.6A CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910070322.6A CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109884323A true CN109884323A (en) | 2019-06-14 |
| CN109884323B CN109884323B (en) | 2021-08-20 |
Family
ID=66926865
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910070322.6A Expired - Fee Related CN109884323B (en) | 2019-01-25 | 2019-01-25 | Paralichthys olivaceus egg shell precursor protein sandwich ELISA kit, detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109884323B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199595A (en) * | 2010-03-24 | 2011-09-28 | 香港城市大学 | Expression box, transgenic fish and uses thereof |
-
2019
- 2019-01-25 CN CN201910070322.6A patent/CN109884323B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199595A (en) * | 2010-03-24 | 2011-09-28 | 香港城市大学 | Expression box, transgenic fish and uses thereof |
Non-Patent Citations (5)
| Title |
|---|
| AUGUSTINE ARUKWE ,ET AL.: "Molecular cloning of rainbow trout (Oncorhynchus mykiss) eggshell zona radiata protein complementary DNA: mRNA expression in 17β-estradiol- and nonylphenol-treated fish.", 《COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY PART B 132》 * |
| JEE-HYUN JUNG, ET AL.: "Comparative analysis of distinctive transcriptome profiles with biochemical evidence in bisphenol S- and benzo[a]pyrene-exposed liver tissues of the olive flounder Paralichthys olivaceus.", 《PLOS ONE》 * |
| TIM D.WILLIAMS, ET AL.: "Gene expression responses of European flounder (Platichthys flesus) to 17-β estradiol.", 《TOXICOLOGH LETTER》 * |
| 刘慧 主编: "《现代食品微生物学实验技术》", 28 February 2017, 中国农业大学出版社 * |
| 马淑伟，等: "金鱼卵黄原蛋白单抗夹心ELISA的开发及其在环境雌激素检测中的应用。", 《中国海洋大学学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109884323B (en) | 2021-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107266569B (en) | Preparation method of tussah silk fibroin monoclonal antibody | |
| CN108107217B (en) | Classical swine fever virus truncated E2 protein and application thereof | |
| CN109709338B (en) | Enzyme linked immunosorbent assay kit for detecting skeletal muscle troponin I of cattle or sheep and preparation method and application thereof | |
| CN102731615B (en) | Detection reagent and detection method for PRRSV | |
| CN105541655B (en) | The general artificial semiantigen of Capsaicinoids, artificial complete antigen and its application | |
| CN103756973B (en) | A kind of indirect ELISA testing kit of GCRV | |
| CN102967709B (en) | Detect enzyme linked immunological kit and the application thereof of zearalenone medicine | |
| CN101863981A (en) | Preparation method of anti-bisphenol A monoclonal antibody | |
| CN105606826A (en) | Kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay | |
| CN109001450A (en) | A kind of kit and preparation method detecting chicken Mycoplasma synoviae antibody | |
| CN107422112A (en) | A kind of immune reagent kit for detecting ethopabate, preparation method and application | |
| CN109705216B (en) | Monoclonal antibody for resisting bovine skeletal muscle troponin I and application thereof | |
| CN109810191B (en) | Monoclonal antibody for resisting sheep skeletal muscle troponin I and application thereof | |
| CN109239351B (en) | Lotus root latent virus double-antibody sandwich enzyme-linked immunosorbent assay kit and preparation and detection methods thereof | |
| CN101982777B (en) | Duck plague virus antigen capturing ELISA method based on anti-recombination UL51 albumen antibody | |
| CN106811470A (en) | A kind of preparation method of dog relaxation precipitinogen recombinant protein and dog relaxation precipitinogen polyclonal antibody | |
| CN102731661B (en) | Multi-epitope fusion antigen for detecting virus serum antibody of porcine reproductive and respiratory syndrome and kit prepared with multi-epitope fusion antigen | |
| CN103059117A (en) | High throughput screening of important schistosoma japonicum antigens and application of antigens in schistosomiasis diagnosis | |
| CN109884323A (en) | Bastard halibut estradiol choriogenin sandwich ELISA lcits and its detection method and application | |
| CN104031886A (en) | Method of detecting monensin by immunomagnetic bead purification-enzyme-linked immunoassay and special monoclonal antibody used therein | |
| CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| CN105424928B (en) | Immunochromatography strip detecting porcine reproductive and respiratory syndrome virus antibodies and preparation method and application thereof | |
| CN106198974A (en) | The ELISA detection kit of IHNV antibody in a kind of quick detection rainbow trout serum | |
| CN105315166B (en) | The preparation method and its application in quantum dot immune fluorescent kit of salbutamol haptens and antigen | |
| CN109884324A (en) | Detect immunofluorescent reagent box and the application of Bastard halibut estradiol choriogenin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210820 Termination date: 20220125 |