CN109837351A - Utilize the kit of real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity - Google Patents

Abstract

The invention discloses the kits using real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity, comprising: RNA extracts reagent, reverse transcription reagents, detection architecture PCR reaction solution, positive reference substance and negative controls；Wherein detection architecture PCR reaction solution includes testing goal gene upstream and downstream primer PDGFR α-F, PDGFR α-R and probe PDGFR α-Probe, detects reference gene β-actin primer β-actin-F, β-actin-R and probe β-actin-Probe.Real-time fluorescent PCR technology is combined and uses Taqman probe by the present invention, utilize the method for double standard curves, the quantitation curves for constructing reference gene β-actin and target gene PDGFR α respectively, can detect the expression relative to reference gene of PDGFR α in testee's body.

Description

Utilize the kit of real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity

Technical field

This patent is related to a kind of detection kit of the gene relative expression quantity of clinical examination purposes, using probe Taqman Real-Time Fluorescent Quantitative PCR Technique passes through the height of expression for detecting PDGFR α gene expression dose in tumor patient body Judge the curative effect and prognosis of drug.The kit can effectively save detection time, improve detection accuracy.

Background technique

The it is proposed of multiple target point inhibitory theory (multiple target point inhibits EGFR, VEGFR, FGFR, PDGFR etc.) and the development of new drug, It is significant for growth factor receptors progress relevant to neoplasm targeted therapy, wherein platelet derived growth factor PDGFR (Platelet-derived growth factor receptor, PDGFR) is even more to become after EGFR, VEGF/VEGFR New research hotspot.

PDGFR is the single transmembrane albumen that molecular weight is 180KD, and extracellular portion is ligand binding domains, intracellular part For protein kinase catalysis region.There are two types of subunit (α, β) altogether by PDGFR, exist in the case where unbound ligand PDGF with monomer； Formation dimer complex (α α, α β, β β) between receptor subunit can be triggered if in conjunction with PDGF, make receptor phosphorylation to swash Downstream signaling molecule living generates a series of biological effects.PDGFR, can as a member in receptor tyrosine protein kinase family Chemotactic, division and the proliferation for promoting cell, play positive work in the normal physiological processes such as body growth development, wound repair With.The various kinds of cell such as fibroblast, smooth muscle cell, endothelial cell and nerve cell have PDGFR distribution.But in tumor group In knitting, PDGFR can be combined because of PDGF, mediate tyrosine phosphorylation signal transduction, directly or indirectly promote tumor proliferation and Migration.In addition, research also shows that PDGFR mediates tyrosine phosphorylation access, it is hydraulic to raise tumor tissues gap, influences small point The transport of sub- compound, to reduce the intake and curative effect of anti-tumor drug.And it largely tests and clinical data also shows The expression height of PDGFR has a deep effect on the generation, deterioration and the treatment of patient, prognosis of tumour, such as the high table of PDGFR Up to gastric cancer infiltration, lymph node and DISTANT METASTASES IN and clinical stages it is closely related, it is unrelated with tumor size, tissue typing. The katabolism that extracellular matrix can be improved after PDGFR activation, is conducive to the formation of blood vessel, illustrates PDGFR in gastric cancer capilary It plays a driving role in formation, height expression and the displacement behavior of gastric cancer have substantial connection；PDGFR- β is found in the research of breast cancer It can promote the vascularization of breast cancer tissue and in early-stage breast cancer in height expression status, deterioration and progress with breast cancer It is closely related, and take part in the invasion and transfer of tumour；Colorectal cancer research shows that PDGFR- α expression and patient age, The size of tumour, Differentiation Types are unrelated, and by stages close with cancer with lymph node metastasis with Duke mesh.In addition, in liver cancer, nervus pulmonalis Also prove activation and the Tumor Angiongesis of PDGFR in the research such as endocrine cancer, epithelial ovarian cancer, the generation of tumour, development, Infiltration, transfer have close relationship.Go deep into and carry out PDGF/PDGFR antagonist and other targets with correlative study Targeted therapy is extremely promising.

Tyrosine kinase inhibitor (TKI) is to target PDGFR α to having the drug general name for inhibiting tyrosine kinase activity Tyrosine kinase inhibitor have Imatinib (Gleevec), Sutent and Sorafenib, be clinical most common antitumor One of drug.Such drug has dual anti-tumor effect, on the one hand by inhibiting RAF/MEK/ERK signal transduction pathway, directly Connect inhibition tumour growth；On the other hand by inhibiting PDGFR α to block tumor neovasculature formation, inhibit tumour thin indirectly The growth of born of the same parents.Clinical research shows that the detection of PDGFR α mRNA expression receives targeted therapy to patient and has apparent guidance meaning Justice.PDGFR α gene mutation causes expression to reduce, and experiment confirms in vitro to Imatinib (Gleevec) sensitivity；PDGFR alpha expression Level is also related to the prognosis of cancer patient in addition to related with curative effect of medication, and clinical laboratory data shows that PDGFR α low expression is suffered from Person has better 3 years progression free survival phases and 3 years overall survivals compared with high expressors.

At present clinically using PDGFR α gene as one of dynamic evaluation conditions of patients and the means of prognosis.Commonly Detection technique has the methods of fluorescence in situ hybridization technique (FISH), RT-PCR, RQ-PCR.FISH method although result is more intuitive, But test process is cumbersome, and it is various to be related to reagent type, and it is time-consuming and laborious, and result needs seasoned professional to carry out interpretation, As a result there are biggish subjectivities for interpretation.And simple RT-PCR rule is endpoint quantification, it is accurate to carry out to starting template amount Estimation.Thus being badly in need of a kind of hypersensitivity, high specific, high the degree of automation, contamination control, good method is come to PDGFR α Gene mRNA content is detected.

RQ-PCR uses Taqman fluorescence probe quantitative technology, and integrative biology, zymetology and fluorescence chemical are in one, from expansion Increase to interpretation of result and carried out under PCR reaction tube closed state, solves the problems, such as PCR product pollution and lead to false positive, Susceptibility is also improved simultaneously, result is indicated with copy number, realizes the accurate quantitative analysis to PCR product, it is easy to seek unity of standard, Good, the high sensitivity with specificity, linear relationship is good, easy to operate, high degree of automation, anti-pollution, there is biggish linear model The advantages that enclosing.It can satisfy the detection of PDGFR α gene mRNA content, and then select effective therapeutic modality and be suitably directed to Property drug, be conducive to study before medication and influence of the PDGFR alpha expression level to anti-tumor drug effectiveness after medication, convenient for anti-swollen The exploitation of tumor medicine.It is considered as presently preferred detection method, for evaluating therapeutic effect, prediction prognosis.

Summary of the invention

The present invention devises detection internal reference/target gene primer, probe sequence, using fluorescent quantitative PCR technique, utilizes It is bent to construct the two kinds of quantitative criterion of reference gene β-actin and target gene PDGFR α respectively for the method for double standard curves Line detects expression of the PDGFR α relative to reference gene.Kit by adjusting two genes primed probe ratio, with And PCR reaction condition, so that amplification efficiency and rate is reached best.

Utilize the kit of real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity, which is characterized in that the examination Agent box includes: that RNA extracts reagent, reverse transcription reagents, detection architecture PCR reaction solution, positive reference substance and negative controls；Wherein Detection architecture PCR reaction solution includes:

(1) testing goal gene upstream and downstream primer PDGFR α-F, PDGFR α-R and probe PDGFR α-Probe, sequence It arranges as follows:

PDGFR α-F:CGATTGTGGTCACCTGTGC

PDGFR α-R:TGGATGGGACTTTGATTTCTT

PDGFR α-Probe:FAM-ACCTTCAATGGACTTACCCTGGAGA-TAMRA；

(2) upstream and downstream primer β-actin-F, the β-actin-R and probe β-actin- of reference gene β-actin are detected Probe, sequence are as follows:

β-actin-F:TGAGCGAGGCTACAGCTT

β-actin-R:TCCTTGATGTCGCGCACGATTT

β-actin-Probe:FAM-ACCACCACGGCCGAGCGG-TAMRA.

Further, it includes erythrocyte cracked liquid, TRIzol, chloroform, dehydrated alcohol that the RNA, which extracts reagent,；It is described inverse Transcript reagent includes the ReverTra Ace qPCR RT Kit of TOYOBO company.

Detection architecture PCR reaction solution includes THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), testing goal base Because detecting reference gene β-actin primer β-with upstream and downstream primer PDGFR α-F, PDGFR α-R and probe PDGFR α-Probe Actin-F, β-actin-R and probe β-actin-Probe.

Further, the positive reference substance is respectively the solution for containing corresponding PDGFR α gene；The negative controls For the solution without corresponding PDGFR α gene.

Beneficial effects of the present invention: real-time fluorescent PCR technology is combined and uses Taqman probe by the present invention, utilizes double standards The method of curve constructs the quantitation curves of reference gene β-actin and target gene PDGFR α respectively, detects testee's body The expression relative to reference gene of interior PDGFR α.Compared to the △ △ CT of previous ImmunohistochemistryMethods Methods and popular Method, the kit have many advantages, such as precision height, are as a result convenient for interpretation.In addition the kit by primer needed for reaction system, visit Needle carries out rational proportion and optimization, reaches experiment condition most preferably, so that eliminating cumbersome condition gropes link, greatly promotes Conventional efficient.The kit is specific good after tested, and high sensitivity is easy to operate.Help to detect human patients with tumors's body Interior PDGFR α gene minimal residue avoids hematology recurrence, adjustment therapeutic scheme, evaluation treatment effect for timely therapeutic intervention Fruit, prediction prognosis, prevention clinical recurrence are all of great significance.

Detailed description of the invention

Fig. 1: PDGFR α standard curve of the plasmid as Quality Control.

Fig. 2: β-actin standard curve of the plasmid as Quality Control.

Fig. 3: pattern detection PDGFR α with the amplification curve of corresponding β-actin.

Specific embodiment

Embodiment 1

Early prevention, early diagnosis and the complementary finger of prognosis of this kit for human tumor on adjuvant clinical Mark；Also accurate screening can be carried out to people at highest risk.Kit includes:

1. organizing RNA extraction agent；

2. blood rna extraction agent；

3.RNA Reverse Transcription

4. detection architecture PCR reaction solution；

5. positive reference substance and negative controls.

Wherein, tissue and blood rna extraction agent and RNA Reverse Transcription are purchased from TOYOBO company related kit Equal commercial reagents.

Detection architecture PCR reaction solution: ReverTra Ace qPCR RT Kit (TOYOBO company)；TH UNDERBIRD Probe qPCR Mix (2 ×), the upstream and downstream PDGFR α primer, PDGFR α probe；The upstream and downstream β-actin primer, β-actin- Probe probe；Wherein primer and probe sequence are as follows:

PDGFR α-F:CGATTGTGGTCACCTGTGC

PDGFR α-R:TGGATGGGACTTTGATTTCTT

PDGFR α-Probe:FAM-ACCTTCAATGGACTTACCCTGGAGA-TAMRA；

β-actin-F:TGAGCGAGGCTACAGCTT

β-actin-R:TCCTTGATGTCGCGCACGATTT

β-actin-Probe:FAM-ACCACCACGGCCGAGCGG-TAMRA

Further, the positive reference substance is respectively the solution for containing corresponding PDGFR α gene；The negative controls For the solution without corresponding PDGFR α gene.

Embodiment 2

The operating process of this method:

The preparation (paraffin) of 1.RNA.Extraction step is as follows:

1.1 cut tissue or paraffin piece sample in 1.5ml centrifuge tube (wiping)

1.2 are added 1ml transparency of organization liquid, and 13000rpm is centrifuged 1min after oscillation mixes

1.3 removal supernatants are added 13000rpm after the oscillation of 500ml transparency of organization liquid mixes and are centrifuged 1min

1.4 removal supernatants are added 13000rpm after the oscillation of 1ml dehydrated alcohol mixes and are centrifuged 1min

As for 37 degree of metal bath 10min (uncapping) after 1.5 removal supernatants, until liquid is dry

1.6, which are added 150ulbuffer PKD (coming from RNeasy FFPE KIT) oscillation, mixes 1000rpm 1min

1.7 are added 10ulPK (coming from RNeasy FFPE KIT) mixing of turning upside down

1.8 in 56 DEG C of metal baths 15min, rear 80 DEG C of metal bath 15min

After 1.9 place 3min on ice, 13200rpm15min

1.10 draw supernatant to 1.5 milliliters of new centrifuge tubes, and DNase Booster buffer is added and (comes from RNeasy FFPE KIT) 16ul and DNase1 (coming from RNeasy FFPE KIT) 10ul oscillation mix after low-speed centrifugal, be stored at room temperature 15min。

1.12, which are added addition 720ul dehydrated alcohol after 320ulbuffer RBC (coming from RNeasy FFPE KIT) is mixed, mixes It is even

1.13 are added 700ul back liquid into chromatographic column (come from RNeasy FFPE KIT), 10000rpm 15S, Discard liquid in pipe

1.14 remaining liquid is added into chromatographic column, and 10000rpm 15S discards liquid in pipe

1.15 are added 500ul buffer RPE (coming from RNeasy FFPE KIT) into chromatographic column, 10000rpm 15S, Discard waste liquid

1.16 500ul buffer RPE, 10000rpm 2min are added into chromatographic column, discard waste liquid

1.17 open lid, are centrifuged 5min at full speed and discard waste liquid

1.18 30ul DEPC water is added into chromatographic column, after standing 2min, is centrifuged 1min. at full speed

Embodiment 3

1. RNA is reversed to reference to the Rever Tra Ace qPCR RT Kit kit specification of TOYOBO company cDNA。

2. reagent configures: each X ul of detection architecture PCR reaction solution is configured by detection person-portion number, every person-portion 23ul packing:

X=23ul reaction solution × (8 parts of internal references (standard curve)+8 parts of target gene (standard curve)+1 part of sun of+n parts of samples Property control+1 part of blank control of+1 part of negative control)；

3. sample-adding: 2ulcDNA in detection architecture PCR reaction solution is added；Positive control and negative control directly add 2ul positive Reference substance and negative controls；Blank control adds 2ul physiological saline or any substance is not added.

4. detection: detection carries out on real-time fluorescence PCR instrument, can include ABI7300,7500 (U.S. Applied with instrument Biosystems company) etc..Reaction condition: 95 DEG C of initial denaturation 1min；95 DEG C of 15s, 58 DEG C of 35sec 40 circulations, fluorescence signal It is acquired when 58 DEG C of 35sec.

5. result judges: threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and CT value calculates copy number automatically.

1) when the internal reference positive, testing result just thinks effective；

2) sample results Effective judgement standard:, Ct < 38, effective result；Ct > 38, null result.

Embodiment 4

Clinical sample detection

49 parts of gastric tissue sample to be checked is taken, extracts genome, reagent preparation by embodiment 2 and 3 the method for embodiment And it detects.

2ul in detection architecture PCR reaction solution is added in every part of sample.The positive is done simultaneously, negative, each portion of blank control.With The detection of fluorescent PCR instrument, time are 100 minutes.

Experimental result determines the accuracy rate of sample detection compared with the report result in special inspection laboratory.As shown in table 1, In the case where negative and positive control is errorless, testing result shows that PDGFR α gene relative expression levels are as follows:

PDGFR α gene expression detection result in 2 gastric tissue sample of table

By the statistics to 49 normal persons (PDGFR alpha expression amount/Actin internal reference expression quantity) ratio, obtain judging mark It is quasi-: to be low expression as PDGFR α/Actin < 1.24E-03；As 1.24E-03 < PDGFR α/Actin < 6.19E-03, it is Expression；As PDGFR α/Actin > 6.19E-03, for high expression.

Sequence table

<110>Nanchang Ai Dikang Laboratory of medical test Co., Ltd

<120>kit of real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity is utilized

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

cgattgtggt cacctgtgc 19

<210> 2

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

tggatgggac tttgatttct t 21

<210> 3

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

accttcaatg gacttaccct ggaga 25

<210> 4

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tgagcgaggc tacagctt 18

<210> 5

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

tccttgatgt cgcgcacgat tt 22

<210> 6

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

accaccacgg ccgagcgg 18

Claims (4)

1. utilizing the kit of real-time fluorescence quantitative PCR detection PDGFR α gene relative expression quantity, which is characterized in that the reagent Box includes: that RNA extracts reagent, reverse transcription reagents, detection architecture PCR reaction solution, positive reference substance and negative controls；Wherein examine Survey system PCR reaction solution includes:

(1) testing goal gene upstream and downstream primer PDGFR α-F, PDGFR α-R and probe PDGFR α-Probe, sequence is such as Under:

PDGFR α-F:CGATTGTGGTCACCTGTGC

PDGFR α-R:TGGATGGGACTTTGATTTCTT

PDGFR α-Probe:FAM-ACCTTCAATGGACTTACCCTGGAGA-TAMRA；

(2) upstream and downstream primer β-actin-F, the β-actin-R and probe β-actin- of reference gene β-actin are detected Probe, sequence are as follows:

β-actin-F:TGAGCGAGGCTACAGCTT

β-actin-R:TCCTTGATGTCGCGCACGATTT

β-actin-Probe:FAM-ACCACCACGGCCGAGCGG-TAMRA.

2. kit as described in claim 1, which is characterized in that the RNA extract reagent include erythrocyte cracked liquid, TRIzol, chloroform, dehydrated alcohol；The reverse transcription reagents include the ReverTra Ace qPCR RT Kit of TOYOBO company.

3. kit as claimed in claim 1 or 2, which is characterized in that the positive reference substance is respectively to contain corresponding PDGFR The solution of α gene；The negative controls are the solution without corresponding PDGFR α gene.

4. kit as claimed in claim 3, which is characterized in that real-time fluorescence quantitative PCR response procedures: 95 DEG C of 1min become in advance Property；95 DEG C of 15sec, 58 DEG C of 35sec, 40 circulations.