CN109837294A - The preparation method and application of recombinant plasmid and preparation method thereof and the cell that can express Thermostable α-Amylase using its preparation - Google Patents

Abstract

The preparation method and application of the cell that can express Thermostable α-Amylase the invention discloses a kind of recombinant plasmid and preparation method thereof and using its preparation.The recombinant plasmid containing P43 promoter and lacO and lacI gene is prepared first；Thermostable α-Amylase gene is connected in recombinant plasmid again, contain bacillus subtilis strong promoter P43 in plasmid, substantially increase the yield of Thermostable α-Amylase, the lacO and lacI gene order contained in plasmid simultaneously, IPTG can be used and carry out inducing expression, and purpose more quick compared to microorganism mutation breeding；Then by recipient cell and and carrier containing Thermostable α-Amylase gene by can be obtained to obtain the cell that can express Thermostable α-Amylase after electroporated.When the use of bacillus subtilis being recipient cell, gene information is clear, and speed of production is fast, and culture density is big, can propose the yield and enzyme activity of Thermostable α-Amylase.

Description

Recombinant plasmid and preparation method thereof and using its preparation can express high temperature resistant alphalise starch The preparation method and application of the cell of enzyme

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of recombinant plasmid and preparation method thereof and utilize The preparation method and application of its cell that can express Thermostable α-Amylase prepared.

Background technique

High-temperatureα-amylase is that one kind is distributed widely in animals and plants and microorganism, can hydrolyze the α-Isosorbide-5-Nitrae of starch, glycogen etc. Glycosidic bond generates a kind of enzyme of dextrin and reduced sugar, since the carbon atom of the terminal residue of product is configured as α configuration, so claiming For high-temperatureα-amylase.

Bacillus in 1872 is suggested for the first time as an expressive host bacterium.People carry out bacillus at present Numerous studies, have especially carried out largely in fields such as strain improvement, genetic manipulation, competence, sporulation and its regulations Work.The bacillus that can be used as host expresses foreign gene has bacillus subtilis, bacillus licheniformis, solution starch bud Spore bacillus, bacillus thuringiensis, Bacillus sphaericus etc..Bacillus possesses a set of efficient secreting signal peptide and molecule companion Companion's system can complete the efficient secretory expression of destination protein using these elements.Bacillus is as a kind of expressive host Extensive and in-depth research has been carried out in bacterium, various countries.Bacillus can be used as a variety of prokaryotes, eucaryote and lactation Large-scale production has been put into the expressive host of the albumen in the sources such as animal, some.

Bacillus amyloliquefaciens were once used as the production engineering bacterium of mesophilicα-diastase, but in the later period of culture, nutrition The accumulation of structure change and metabolite, bacillus amyloliquefaciens initially form spore, that is, do not continue to production high temperature resistant α-shallow lake Powder enzyme.

Summary of the invention

In order to solve the above technical problems, the present invention provides a kind of recombinant plasmid and preparation method thereof and utilizing its preparation The preparation method and application of the cell of Thermostable α-Amylase can be expressed.

The technical scheme adopted by the invention is as follows:

A kind of recombinant plasmid, the recombinant plasmid is using B. subtilis-E. coli shuttle plasmid pBE2 carrier as bone Frame, and bacillus subtilis strong promoter P43 promoter and lactose behaviour are inserted at the multiple cloning sites of its EcoRI and BamHI Vertical son manipulation sequence lacO, and LacI gene is inserted at the multiple cloning sites of its NheI and PvuI.

Further, the sequence of the recombinant plasmid is as shown in SEQ ID NO:3.

The present invention also provides the preparation methods of the recombinant plasmid, and the preparation method comprises the following steps:

(1) using B. subtilis-E. coli shuttle plasmid pBE2 carrier as skeleton, using EcoRI and BamHI into Row stays overnight double digestion, recycles after digestion to plasmid fragments；

(2) using bacillus subtilis as template, using the primer P1 containing EcoRI restriction enzyme site and containing lacO and The primer P2 of BamHI restriction enzyme site expands P43 promoter sequence, obtains the lacO gene for being connected to Promoter P43；

(3) plasmid fragments that step (1) obtains are connected with the lacO gene for being connected to Promoter P43 using T4 ligase It connects, has obtained the plasmid for being connected to Promoter P43 and lacO gene；

(4) using Pet28a plasmid as template, using the primer P3 containing NheI restriction enzyme site and contain PvuI restriction enzyme site Primer P4 LacI gene is expanded；

(5) double digestion is carried out to the plasmid that step (3) obtains using NheI and PvuI, and it is obtained with step (4) To LacI gene using T4 ligase carry out stay overnight connection, be transferred to escherichia coli DH5a after connection and cultivated, used later Neomycin resistance gene screening monoclonal is sequenced, and the recombinant plasmid can be obtained.

Further, the gene order of described primer P1, P2, P3, P4 are as follows:

P1:CCGGAATTCTGATAGGTGGTATGTTTTCGC；

P2:

CGGGATCCTTGTTATCCGCTCACAAACATTCCTCTCTTACCTATAATGG；

P3:CTAGCTAGCCGGACACCATCGAATGGCGC；

P4:ATGCGATCGTCACTGCCCGCTTTCCAGT.

The present invention also provides a kind of preparation method of cell that can express Thermostable α-Amylase, the preparation method packet Include following steps:

(a) Thermostable α-Amylase gene is connected in the recombinant plasmid, and by the product after connection convert to Escherichia coli DH5a carries out resistance screening using neomycin and obtains the carrier containing Thermostable α-Amylase gene；

(b) by recipient cell and carrier containing Thermostable α-Amylase gene by can be obtained after electroporated To the cell that can express Thermostable α-Amylase.

Further, the recipient cell is bacillus subtilis, bacillus amyloliquefaciens, solution starch alkali monad, solution The thermophilic saline and alkaline coccus of starch or P. amylolyticus.

Further, the recipient cell is preferably bacillus subtilis or bacillus amyloliquefaciens, solves starch gemma bar Bacterium inherently has mesophilicα-diastase, and the alpha-amylase of secretion has corresponding protein modified system, is not necessarily to following process, What is secreted out of is mesophilicα-diastase and α-high-temperature starch enzymatic mixture.

Further, the recipient cell is preferably bacillus subtilis, is the current common host cell of biology, Its gene information is clear, and speed of production is fast, and culture density is big.

Further, the step (a) specifically includes the following steps:

(a-1) using the primer P5 with BamHI restriction enzyme site and the primer P6 with XbaI enzyme cutting site to high temperature resistant Alpha-amylase gene is expanded；

(a-2) double digestion is carried out to the recombinant plasmid using BamHI and XbaI；

(a-3) recombination after the Thermostable α-Amylase gene and double digestion for using T4 ligase to obtain step (a) Plasmid is attached, and connection product is converted to escherichia coli DH5a, is carried out resistance screening using neomycin and is obtained containing resistance to height The carrier of warm alpha-amylase gene.

Further, the gene order of described primer P5, P6 are as follows:

P5:CGGGATCCACATTGAAAGGGGAGGAGAAT；

P6:GCTCTAGACGTCCTCTCTGCTCTTCTATC。

Further, the step (b) specifically includes the following steps:

(b-1) recipient cell is cultivated in LB culture solution to bacterium solution OD600=0.5, thalline were collected by centrifugation；

(b-2) sorbitol solution of thallus ice is resuspended, after centrifugation removal supernatant, thallus is resuspended in ice again In sorbitol solution；

(b-3) suspension that step (b-2) obtains and carrier containing Thermostable α-Amylase gene electric shock is carried out to turn Change；

(b-4) after the completion of converting, sorbitol solution is added, and by the screening of Selective agar medium, picking starch is decomposed The cell that can express Thermostable α-Amylase can be obtained in the strong monoclonal of ability.

Further, in step (b-3), the electroporated condition are as follows: resistance 200 Ω, capacitor 25uF.

Further, in step (b-4), the ingredient of the Selective agar medium are as follows: 0.1g~5g beef extract, 0.1g~10g Peptone, 0.1~10g sodium chloride, 0.01g~5g soluble starch, 1g~10g agar, moisturizing to 100ml.It is formulated in this Selective agar medium can obtain the higher transformed cells for generating alpha-amylase ability.

The present invention also provides the cells that can express Thermostable α-Amylase in production Thermostable α-Amylase Using.Its enzyme activity for producing obtained Thermostable α-Amylase is in 38.6mg/mL.h or more.

In technical solution provided by the invention, the recombination matter containing P43 promoter and lacO and lacI gene is prepared first Grain；Thermostable α-Amylase gene is connected in recombinant plasmid again, bacillus subtilis strong promoter is contained in plasmid P43, the lacO for being greatly improved the yield of Thermostable α-Amylase, while having contained in plasmid and lacI gene order, can be with Inducing expression is carried out using IPTG, and purpose more quick compared to microorganism mutation breeding；Then by recipient cell and Carrier containing Thermostable α-Amylase gene can express the thin of Thermostable α-Amylase by electroporated can be obtained later Born of the same parents.When the use of bacillus subtilis being recipient cell, gene information is clear, and speed of production is fast, and culture density is big, can mention resistance to The yield and enzyme activity of high-temperatureα-amylase.

Detailed description of the invention

Fig. 1 is the connection schematic diagram that bacillus subtilis strong promoter P43 and lactose operon manipulate sequence lacO；

Fig. 2 is the connection schematic diagram that bacillus subtilis strong promoter+lactose operon manipulates sequence and carrier framework；

Fig. 3 is the bacillus coli-bacillus subtilis shuttle plasmid map of building；

Fig. 4 is the sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the carrier expression product that the present invention constructs.1 is not The bacillus subtilis of induction, the bacillus subtilis of 2 inductions, 3 protein labelings；

Fig. 5 be take abscissa absorbance as standard curve that ordinate is made of starch concentration.

Specific embodiment

The following describes the present invention in detail with reference to examples.

Embodiment 1

A kind of recombinant plasmid, the gene order contained is as shown in SEQ ID NO:3, and the recombinant plasmid is with withered grass gemma Bacillus-E. coli shuttle plasmid pBE2 carrier is skeleton, and is inserted into P43 at the multiple cloning sites of its EcoRI and BamHI and opens Mover and lacO gene, and LacI gene is inserted at the multiple cloning sites of its NheI and PvuI.

The recombinant plasmid preparation method the following steps are included:

(1) using B. subtilis-E. coli shuttle plasmid pBE2 carrier as skeleton, using EcoRI and BamHI into Row stays overnight double digestion, recycles after digestion to plasmid fragments；

(2) using bacillus subtilis as template, using the primer P1 containing EcoRI restriction enzyme site and containing lacO and The primer P2 of BamHI restriction enzyme site expands P43 promoter sequence, obtains the lacO gene for being connected to Promoter P43；Its For gene order as shown in SEQ ID NO:1, connection schematic diagram is as shown in Figure 1；

Primer P1, P2, P43 promoter, the gene order of lacO are as follows:

P1:CCGGAATTCTGATAGGTGGTATGTTTTCGC；

P2:

CGGGATCCTTGTTATCCGCTCACAAACATTCCTCTCTTACCTATAATGG；

P43 promoter: as shown in SEQ ID NO:5；

LacO:TTGTGAGCGGATAACAA.

(3) plasmid fragments that step (1) obtains are connected with the lacO gene for being connected to Promoter P43 using T4 ligase It connects, has obtained the plasmid for being connected to Promoter P43 and lacO gene, gene order is as shown in SEQ ID NO:2, connection signal Figure is as shown in Figure 2；The condition of contact of the T4 ligase is as follows:

(4) using Pet28a plasmid as template, using the primer P3 containing NheI restriction enzyme site and contain PvuI restriction enzyme site Primer P4 LacI gene is expanded；

The gene order of described primer P3, P4, LacI are as follows:

P3:CTAGCTAGCCGGACACCATCGAATGGCGC；

P4:ATGCGATCGTCACTGCCCGCTTTCCAGT；

LacI: as shown in SEQ ID NO:7.

(5) double digestion is carried out to the plasmid that step (3) obtains using NheI and PvuI, and it is obtained with step (4) To LacI gene using T4 ligase carry out stay overnight connection, be transferred to escherichia coli DH5a after connection and cultivated, used later Neomycin resistance gene screening monoclonal is sequenced, and the recombinant plasmid can be obtained, map is as shown in Figure 3

In step (5), the condition of contact of the T4 ligase is as follows:

Embodiment 2

A kind of preparation method for the cell that can express Thermostable α-Amylase, the preparation method comprises the following steps:

(a) Thermostable α-Amylase gene is connected in the recombinant plasmid in embodiment 1, and the product after connection is turned Change to escherichia coli DH5a, carries out resistance screening using neomycin and obtain the carrier containing Thermostable α-Amylase gene；Specifically Are as follows:

(a-1) the bacillus subtilis Thermostable α-Amylase gene order announced according to NCBI, design primer, with withered Careless Bacillus is template, using the primer P5 with BamHI restriction enzyme site and with the primer P6 in XbaI enzyme cutting site Thermostable α-Amylase gene is expanded, obtained high temperature resistant α-amylase gene sequence is as shown in SEQ ID NO:4.

The gene order of described primer P5, P6 are as follows:

P5:CGGGATCCACATTGAAAGGGGAGGAGAAT；

P6:GCTCTAGACGTCCTCTCTGCTCTTCTATC。

(a-2) double digestion is carried out to the recombinant plasmid in embodiment 1 using BamHI and XbaI, carries out electrophoresis after digestion Product is recycled, digestion condition is as follows:

37 DEG C of water-bath 3h；

(a-3) recombination after the Thermostable α-Amylase gene and double digestion for using T4 ligase to obtain step (a) Plasmid carries out staying overnight connection in 16 DEG C, and condition of contact is as follows:

Connection product is converted to escherichia coli DH5a, resistance screening is carried out using neomycin and obtains containing high temperature resistant α-shallow lake The carrier of powder enzyme gene.

(b) by recipient cell and carrier containing Thermostable α-Amylase gene by can be obtained after electroporated To the cell that can express Thermostable α-Amylase, specifically:

(b-1) by bacillus subtilis glycerol tube 37 DEG C in 3mL LB culture solution, 250r/min be incubated overnight, then press Fresh LB culture solution is added to according to the ratio of 1:100, and 37 DEG C, 250r/min is when cultivating to bacterium solution OD600=0.5, centrifugation is received Collect thallus；

(b-2) it is resuspended with the 1M D-sorbite of 10ml ice, low-temperature centrifugation removes supernatant.It is resuspended with 100 μ L 1M D-sorbites, It is placed in stand-by on ice；

(b-3) the 40 μ L of suspension obtained step (b-2) and the 1 μ L of carrier containing Thermostable α-Amylase gene are added Into electrotransformation pond, electrotransformation pond is put into electric converter slot carry out it is electroporated, shock parameters be 200 Ω of resistance, capacitor For 25uF；

(b-4) it after the completion of converting, takes out and 1mL 1M D-sorbite is added, be placed in shaking table 37 DEG C, 100r/min culture 2 Hour, then the cell after conversion is applied on the Selective agar medium plate containing starch, the Selective agar medium ingredient are as follows: Plate is inverted in 37 DEG C of incubators by 5% beef extract, 10% peptone, 10% sodium chloride, 5% soluble starch, 10% agar In, it is incubated overnight, the biggish single colonie of picking starch dissolution circle.Then it is seeded to 3ml LB liquid medium, is incubated overnight, is added Add the 30% isometric glycerol to sterilize.Packing is placed in -80 DEG C of refrigerators or liquid nitrogen container, and conservation, can be obtained can express The cell of Thermostable α-Amylase.

Embodiment 3

Application of the cell of Thermostable α-Amylase in production Thermostable α-Amylase can be expressed

The cell that Thermostable α-Amylase can be expressed obtained in embodiment 2 is equipped with according to the ratio addition of 1:100 In the triangular flask of 50mL LB culture solution, the shaken cultivation 16h under the conditions of 37 DEG C, 250r/min.Culture solution supernatant is collected to carry out SDS-PAGE, as shown in figure 4, more bands near 50KD as seen from the figure, illustrate the amylase gene of recombination in cell Middle expression.

Enzyme extracts and purifying: collecting fermentation liquid, 3000r/min is centrifuged 10min, removes thallus, is added in supernatant The ammonium sulfate of 65% saturation degree is saltoutd 2 hours to ammonium sulfate in 4 DEG C after completely dissolution, and then 5000r/min is centrifuged 30min, Obtain the thick enzyme of preliminary purification.

The drafting of standard curve and the measurement of enzymatic activity: it is 0.2%w/v, 0.5%w/v, 1.0%w/ that concentration, which is respectively configured, The starch fluid of v, 1.5%w/v and 2%w/v carry out the drafting of standard curve and the measurement of enzymatic activity according to table 1.

Table 1

Note: preceding 6 groups of data are used for the production of standard curve: using starch concentration as abscissa, absorbance is ordinate, is made Standard curve, as shown in Figure 5；4 groups of data are used for the measurement of enzymatic activity afterwards: after measuring absorbance, can look into from standard curve Corresponding starch concentration out finds out the amount of starch being consumed, and enzyme activity here is every milliliter of crude enzyme liquid in 40 DEG C, PH6.0's Under the conditions of, the milligram number (mg soluble starch/mLh) for the soluble starch that liquefies per hour.

Testing result is as shown in table 2:

Table 2

Test tube number	1 (control)	7.1	7.2	7.3	7.4
						A600	0	0.004	0.047	0.019	0.063
The starch concentration (%) of enzyme consumption	0	1.999	1.930	1.953	1.975
						Enzyme activity (mg/mLh)	0	39.98	38.60	39.06	39.50

The cell that can express Thermostable α-Amylase that the present invention constructs as can be seen from Table 2 can successfully express work Property Thermostable α-Amylase and activity preferably.

It is above-mentioned to express high temperature resistant α-referring to embodiment to a kind of recombinant plasmid and preparation method thereof and using what it was prepared The detailed description that the preparation method and application of the cell of amylase carries out, is illustrative without being restrictive, can be according to institute It limits range and enumerates several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, this hair should be belonged to Within bright protection scope.

SEQUENCE LISTING

<110>Guangzhou Rui Chen Biotechnology Co., Ltd

<120>a kind of recombinant plasmid and preparation method thereof and the cell that can express Thermostable α-Amylase prepared using it

Preparation method and application

<130> 1

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 330

<212> DNA

<213>it is connected to the lacO gene of Promoter P43

<400> 1

ccggaattct gataggtggt atgttttcgc ttgaactttt aaatacagcc attgaacata 60

cggttgattt aataactgac aaacatcacc ctcttgctaa agcggccaag gacgctgccg 120

ccggggctgt ttgcgttttt gccgtgattt cgtgtatcat tggtttactt atttttttgc 180

caaagctgta atggctgaaa attcttacat ttattttaca tttttagaaa tgggcgtgaa 240

aaaaagcgcg cgattatgta aaatataaag tgatagcggt accattatag gtaagagagg 300

aatgtttgtg agcggataac aaggatcccg 330

<210> 2

<211> 678

<212> DNA

<213>the plasmid gene sequence of Promoter P43 and lacO gene has been connect

<400> 2

tccctgatct cgacttcgtt ctttttttac ctctcggtta tgagttagtt caaattcgtt 60

ctttttaggt tctaaatcgt gtttttcttg gaattgtgct gttttatcct ttaccttgtc 120

tacaaacccc ttaaaaacgt ttttaaaggc ttttaagccg tctgtacgtt ccttaaggaa 180

ttctgatagg tggtatgttt tcgcttgaac ttttaaatac agccattgaa catacggttg 240

atttaataac tgacaaacat caccctcttg ctaaagcggc caaggacgct gccgccgggg 300

ctgtttgcgt ttttgccgtg atttcgtgta tcattggttt acttattttt ttgccaaagc 360

tgtaatggct gaaaattctt acatttattt tacattttta gaaatgggcg tgaaaaaaag 420

cgcgcgatta tgtaaaatat aaagtgatag cggtaccatt ataggtaaga gaggaatgtt 480

tgtgagcgga taacaaggat cctctagagt cgacctgcag gcatgcaagc ttgtattcta 540

tagtgtcacc taaatcgtat gtgtatgata cataaggtta tgtattaatt gtagccgcgt 600

tctaacgaca atatgtacaa gcctaattgt gtagcatctg gcttactgaa gcagacccta 660

tcatctctct cgtaaact 678

<210> 3

<211> 6722

<212> DNA

<213>recombinant plasmid gene order

<400> 3

aaaatccatc ttcatcggct ttttcgtcat catctgtatg aatcaaatcg ccttcttctg 60

tgtcatcaag gtttaatttt ttatgtattt cttttaacaa accaccatag gagattaacc 120

ttttacggtg taaaccttcc tccaaatcag acaaacgttt caaattcttt tcttcatcat 180

cggtcataaa atccgtatcc tttacaggat attttgcagt ttcgtcaatt gccgattgta 240

tatccgattt atatttattt ttcggtcgaa tcatttgaac ttttacattt ggatcatagt 300

ctaatttcat tgcctttttc caaaattgaa tccattgttt ttgattcacg tagttttctg 360

tattcttaaa ataagttggt tccacacata ccaatacatg catgtgctga ttataagaat 420

tatctttatt atttattgtc acttccgttg cacgcataaa accaacaaga tttttattaa 480

tttttttata ttgcatcatt cggcgaaatc cttgagccat atctgacaaa ctcttattta 540

attcttcgcc atcataaaca tttttaactg ttaatgtgag aaacaaccaa cgaactgttg 600

gcttttgttt aataacttca gcaacaacct tttgtgactg aatgccatgt ttcattgctc 660

tcctccagtt gcacattgga caaagcctgg atttacaaaa ccacactcga tacaactttc 720

tttcgcctgt ttcacgattt tgtttatact ctaatatttc agcacaatct tttactcttt 780

cagccttttt aaattcaaga atatgcagaa gttcaaagta atcaacatta gcgattttct 840

tttctctcca tggtctcact tttccacttt ttgtcttgtc cactaaaacc cttgattttt 900

catctgaata aatgctacta ttaggacaca taatattaaa agaaaccccc atctatttag 960

ttatttgttt agtcacttat aactttaaca gatggggttt ttctgtgcaa ccaattttaa 1020

gggttttcaa tactttaaaa cacatacata ccaacacttc aacgcacctt tcagcaacta 1080

aaataaaaat gacgttattt ctatatgtat caagataaga aagaacaagt tcaaaaccat 1140

caaaaaaaga caccttttca ggtgcttttt ttattttata aactcattcc ctgatctcga 1200

cttcgttctt tttttacctc tcggttatga gttagttcaa attcgttctt tttaggttct 1260

aaatcgtgtt tttcttggaa ttgtgctgtt ttatccttta ccttgtctac aaacccctta 1320

aaaacgtttt taaaggcttt taagccgtct gtacgttcct taaggaattc tgataggtgg 1380

tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt taataactga 1440

caaacatcac cctcttgcta aagcggccaa ggacgctgcc gccggggctg tttgcgtttt 1500

tgccgtgatt tcgtgtatca ttggtttact tatttttttg ccaaagctgt aatggctgaa 1560

aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc gcgattatgt 1620

aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtttgt gagcggataa 1680

caaggatcct ctagagtcga cctgcaggca tgcaagcttg tattctatag tgtcacctaa 1740

atcgtatgtg tatgatacat aaggttatgt attaattgta gccgcgttct aacgacaata 1800

tgtacaagcc taattgtgta gcatctggct tactgaagca gaccctatca tctctctcgt 1860

aaactgccgt cagagtcggt ttggttggac gaaccttctg agtttctggt aacgccgttc 1920

cgcaccccgg aaatggtcag cgaaccaatc agcagggtca tcgctagccg gacaccatcg 1980

aatggcgcaa aacctttcgc ggtatggcat gatagcgccc ggaagagagt caattcaggg 2040

tggtgaatgt gaaaccagta acgttatacg atgtcgcaga gtatgccggt gtctcttatc 2100

agaccgtttc ccgcgtggtg aaccaggcca gccacgtttc tgcgaaaacg cgggaaaaag 2160

tggaagcggc gatggcggag ctgaattaca ttcccaaccg cgtggcacaa caactggcgg 2220

gcaaacagtc gttgctgatt ggcgttgcca cctccagtct ggccctgcac gcgccgtcgc 2280

aaattgtcgc ggcgattaaa tctcgcgccg atcaactggg tgccagcgtg gtggtgtcga 2340

tggtagaacg aagcggcgtc gaagcctgta aagcggcggt gcacaatctt ctcgcgcaac 2400

gcgtcagtgg gctgatcatt aactatccgc tggatgacca ggatgccatt gctgtggaag 2460

ctgcctgcac taatgttccg gcgttatttc ttgatgtctc tgaccagaca cccatcaaca 2520

gtattatttt ctcccatgaa gacggtacgc gactgggcgt ggagcatctg gtcgcattgg 2580

gtcaccagca aatcgcgctg ttagcgggcc cattaagttc tgtctcggcg cgtctgcgtc 2640

tggctggctg gcataaatat ctcactcgca atcaaattca gccgatagcg gaacgggaag 2700

gcgactggag tgccatgtcc ggttttcaac aaaccatgca aatgctgaat gagggcatcg 2760

ttcccactgc gatgctggtt gccaacgatc agatggcgct gggcgcaatg cgcgccatta 2820

ccgagtccgg gctgcgcgtt ggtgcggata tctcggtagt gggatacgac gataccgaag 2880

acagctcatg ttatatcccg ccgttaacca ccatcaaaca ggattttcgc ctgctggggc 2940

aaaccagcgt ggaccgcttg ctgcaactct ctcagggcca ggcggtgaag ggcaatcagc 3000

tgttgcccgt ctcactggtg aaaagaaaaa ccaccctggc gcccaatacg caaaccgcct 3060

ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa 3120

gcgggcagtg acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga 3180

tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga 3240

gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat taactggcga 3300

actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc 3360

aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc 3420

cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg 3480

tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat 3540

cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata 3600

tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct 3660

ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 3720

ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 3780

cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 3840

aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct 3900

agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 3960

tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 4020

ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 4080

cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 4140

atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 4200

ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 4260

tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 4320

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 4380

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 4440

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 4500

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 4560

tcattaatgc agctgatttc actttttgca ttctacaaac tgcataactc atatgtaaat 4620

cgctcctttt taggtggcac aaatgtgagg cattttcgct ctttccggca accacttcca 4680

agtaaagtat aacacactat actttatatt cataaagtgt gtgctctgcg aggctgtcgg 4740

cagtgccgac caaaaccata aaacctttaa gacctttctt ttttttacga gaaaaaagaa 4800

acaaaaaaac ctgccctctg ccacctcagc aaaggggggt tttgctctcg tgctcgttta 4860

aaaatcagca agggacaggt agtatttttt gagaagatca ctcaaaaaat ctccaccttt 4920

aaacccttgc caatttttat tttgtccgtt ttgtctagct taccgaaagc cagactcagc 4980

aagaataaaa tttttattgt ctttcggttt tctagtgtaa cggacaaaac cactcaaaat 5040

aaaaaagata caagagaggt ctctcgtatc ttttattcag caatcgcgcc cgattgctga 5100

acagattaat aatagatttt agctttttat ttgttgaaaa aagctaatca aattgttgtc 5160

gggatcaatt actgcaaagt ctcgttcatc ccaccactga tcttttaatg atgtattggg 5220

gtgcaaaatg cccaaaggct taatatgttg atataattca tcaattccct ctacttcaat 5280

gcggcaacta gcagtaccag caataaacga ctccgcacct gtacaaaccg gtgaatcatt 5340

actacgagag cgccagcctt catcacttgc ctcccataga tgaatccgaa cctcattaca 5400

cattagaact gcgaatccat cttcatggtg aaccaaagtg aaacctagtt tatcgcaata 5460

aaaacctata ctctttttaa tatccccgac tggcaatgcc gggatagact gtaacattct 5520

cacgcataaa atcccctttc attttctaat gtaaatctat taccttatta ttaattcaat 5580

tcgctcataa ttaatccttt ttcttattac gcaaaatggc ccgatttaag cacacccttt 5640

attccgttaa tgcgccatga cagccatgat aattactaat actaggagaa gttaataaat 5700

acgtaaccaa catgattaac aattattaga ggtcatcgtt caaaatggta tgcgttttga 5760

cacatccact atatatccgt gtcgttctgt ccactcctga atcccattcc agaaattctc 5820

tagcgattcc agaagtttct cagagtcgga aagttgacca gacattacga actggcacag 5880

atggtcataa cctgaaggaa gatctgattg cttaactgct tcagttaaga ccgaagcgct 5940

cgtcgtataa cagatgcgat gatgcagacc aatcaacatg gcacctgcca ttgctacctg 6000

tacagtcaag gatggtagaa atgttgtcgg tccttgcaca cgaatattac gccatttgcc 6060

tgcatattca aacagctctt ctacgataag ggcacaaatc gcatcgtgga acgtttgggc 6120

ttctaccgat ttagcagttt gatacacttt ctctaagtat ccacctgaat cataaatcgg 6180

caaaatagag aaaaattgac catgtgtaag cggccaatct gattccacct gagatgcata 6240

atctagtaga atctcttcgc tatcaaaatt cacttccacc ttccactcac cggttgtcca 6300

ttcatggctg aactctgctt cctctgttga catgacacac atcatctcaa tatccgaata 6360

gggcccatca gtctgacgac caagagagcc ataaacacca atagccttaa catcatcccc 6420

atatttatcc aatattcgtt ccttaatttc atgaacaatc ttcattcttt cttctctagt 6480

cattattatt ggtccattca ctattctcat tcccttttca gataatttta gatttgcttt 6540

tctaaataag aatatttgga gagcaccgtt cttattcagc tattaataac tcgtcttcct 6600

aagcatcctt caatcctttt aataacaatt atagcatcta atcttcaaca aactggcccg 6660

tttgttgaac tactctttaa taaaataatt tttccgttcc caattccaca ttgcaataat 6720

ag 6722

<210> 4

<211> 1539

<212> DNA

<213>Thermostable α-Amylase gene order

<400> 4

atgaaacaac aaaaacggct ttacgcccga ttgctgacgc tgttatttgc gctcatcttc 60

ttgctgcctc attctgcagc agcggcggca aatcttaatg ggacgctgat gcagtatttt 120

gaatggtaca tgcccaatga cggccaacat tggaagcgtt tgcaaaacga ctcggcatat 180

ttggctgaac acggtattac tgccgtctgg attcccccgg catataaggg aacgagccaa 240

gcggatgtgg gctacggtgc ttacgacctt tatgatttag gggagtttca tcaaaaaggg 300

acggttcgga caaagtacgg cacaaaagga gagctgcaat ctgcgatcaa aagtcttcat 360

tcccgcgaca ttaacgttta cggggatgtg gtcatcaacc acaaaggcgg cgctgatgcg 420

accgaagatg taaccgcggt tgaagtcgat cccgctgacc gcaaccgcgt aatttcagga 480

gaacacctaa ttaaagcctg gacacatttt cattttccgg ggcgcggcag cacatacagc 540

gattttaaat ggcattggta ccattttgac ggaaccgatt gggacgagtc ccgaaagctg 600

aaccgcatct ataagtttca aggaaaggct tgggattggg aagtttccaa tgaaaacggc 660

aactatgatt atttgatgta tgccgacatc gattatgacc atcctgatgt cgcagcagaa 720

attaagagat ggggcacttg gtatgccaat gaactgcaat tggacggttt ccgtcttgat 780

gctgtcaaac acattaaatt ttcttttttg cgggattggg ttaatcatgt cagggaaaaa 840

acggggaagg aaatgtttac ggtagctgaa tattggcaga atgacttggg cgcgctggaa 900

aactatttga acaaaacaaa ttttaatcat tcagtgtttg acgtgccgct tcattatcag 960

ttccatgctg catcgacaca gggaggcggc tatgatatga ggaaattgct gaacggtacg 1020

gtcgtttcca agcatccgtt gaaatcggtt acatttgtcg ataaccatga tacacagccg 1080

gggcaatcgc ttgagtcgac tgtccaaaca tggtttaagc cgcttgctta cgcttttatt 1140

ctcacaaggg aatctggata ccctcaggtt ttctacgggg atatgtacgg gacgaaagga 1200

gactcccagc gcgaaattcc tgccttgaaa cacaaaattg aaccgatctt aaaagcgaga 1260

aaacagtatg cgtacggagc acagcatgat tatttcgacc accatgacat tgtcggctgg 1320

acaagggaag gcgacagctc ggttgcaaat tcaggtttgg cggcattaat aacagacgga 1380

cccggtgggg caaagcgaat gtatgtcggc cggcaaaacg ccggtgagac atggcatgac 1440

attaccggaa accgttcgga gccggttgtc atcaattcgg aaggctgggg agagtttcac 1500

gtaaacggcg ggtcggtttc aatttatgtt caaagatag 1539

<210> 5

<211> 411

<212> DNA

<213>P43 promoter

<400> 5

gaattccata tgggaaacag cgcggacgga gcggaatttc caatttcatg ccgcagccgc 60

ctgcgctgtt ctcatttgcg gcttccttgt agagctcagc attattgagt ggatgattat 120

attccttttg ataggtggta tgttttcgct tgaactttta aatacagcca ttgaacatac 180

ggttgattta ataactgaca aacatcaccc tcttgctaaa gcggccaagg acgctgccgc 240

cggggctgtt tgcgttttta ccgtgatttc gtgtatcatt ggtttactta tttttttgcc 300

aaagctgtaa tggctgaaaa ttcttacatt tattttacat ttttagaaat gggcgtgaaa 360

aaaagcgcgc gattatgtaa aatataaagt gatagcggta ccattggtac c 411

<210> 6

<211> 17

<212> DNA

<213> lacO

<400> 6

ttgtgagcgg ataacaa 17

<210> 7

<211> 1083

<212> DNA

<213> LacI

<400> 7

tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa 60

cgcgcgggga gaggcggttt gcgtattggg cgccagggtg gtttttcttt tcaccagtga 120

gacgggcaac agctgattgc ccttcaccgc ctggccctga gagagttgca gcaagcggtc 180

cacgctggtt tgccccagca ggcgaaaatc ctgtttgatg gtggttaacg gcgggatata 240

acatgagctg tcttcggtat cgtcgtatcc cactaccgag atatccgcac caacgcgcag 300

cccggactcg gtaatggcgc gcattgcgcc cagcgccatc tgatcgttgg caaccagcat 360

cgcagtggga acgatgccct cattcagcat ttgcatggtt tgttgaaaac cggacatggc 420

actccagtcg ccttcccgtt ccgctatcgg ctgaatttga ttgcgagtga gatatttatg 480

ccagccagcc agacgcagac gcgccgagac agaacttaat gggcccgcta acagcgcgat 540

ttgctggtga cccaatgcga ccagatgctc cacgcccagt cgcgtaccgt cttcatggga 600

gaaaataata ctgttgatgg gtgtctggtc agagacatca agaaataacg ccggaacatt 660

agtgcaggca gcttccacag caatggcatc ctggtcatcc agcggatagt taatgatcag 720

cccactgacg cgttgcgcga gaagattgtg caccgccgct ttacaggctt cgacgccgct 780

tcgttctacc atcgacacca ccacgctggc acccagttga tcggcgcgag atttaatcgc 840

cgcgacaatt tgcgacggcg cgtgcagggc cagactggag gtggcaacgc caatcagcaa 900

cgactgtttg cccgccagtt gttgtgccac gcggttggga atgtaattca gctccgccat 960

cgccgcttcc actttttccc gcgttttcgc agaaacgtgg ctggcctggt tcaccacgcg 1020

ggaaacggtc tgataagaga caccggcata ctctgcgaca tcgtataacg ttactggttt 1080

cac 1083

<210> 8

<211> 30

<212> DNA

<213> P1

<400> 8

ccggaattct gataggtggt atgttttcgc 30

<210> 9

<211> 49

<212> DNA

<213> P2

<400> 9

cgggatcctt gttatccgct cacaaacatt cctctcttac ctataatgg 49

<210> 10

<211> 29

<212> DNA

<213> P3

<400> 10

ctagctagcc ggacaccatc gaatggcgc 29

<210> 11

<211> 28

<212> DNA

<213> P4

<400> 11

atgcgatcgt cactgcccgc tttccagt 28

<210> 12

<211> 29

<212> DNA

<213> P5

<400> 12

cgggatccac attgaaaggg gaggagaat 29

<210> 13

<211> 29

<212> DNA

<213> P6

<400> 13

gctctagacg tcctctctgc tcttctatc 29

Claims (10)

1. a kind of recombinant plasmid, which is characterized in that the recombinant plasmid is with B. subtilis-E. coli shuttle plasmid pBE2 Carrier is skeleton, and P43 promoter and lacO gene is inserted at the multiple cloning sites of its EcoRI and BamHI, and at it LacI gene is inserted at the multiple cloning sites of NheI and PvuI.

2. recombinant plasmid according to claim 1, which is characterized in that the sequence of the recombinant plasmid such as SEQ ID NO:3 It is shown.

3. the preparation method of recombinant plasmid according to claim 1 or 2, which is characterized in that the preparation method include with Lower step:

(1) it using B. subtilis-E. coli shuttle plasmid pBE2 carrier as skeleton, was carried out using EcoRI and BamHI Night double digestion, recycles plasmid fragments after digestion；

(2) using bacillus subtilis as template, using the primer P1 containing EcoRI restriction enzyme site and contain lacO and BamHI The primer P2 of restriction enzyme site expands P43 promoter sequence, obtains the lacO gene for being connected to Promoter P43；

(3) plasmid fragments that step (1) obtains are connect with the lacO gene for being connected to Promoter P43 using T4 ligase, is obtained To the plasmid for being connected to Promoter P43 and lacO gene；

(4) using Pet28a plasmid as template, the primer P3 containing NheI restriction enzyme site and drawing containing PvuI restriction enzyme site are used Object P4 expands LacI gene；

(5) plasmid obtained using NheI and PvuI to step (3) carries out double digestion, and by its with obtained in step (4) LacI gene carries out staying overnight connection using T4 ligase, is transferred to escherichia coli DH5a after connection and is cultivated, later using new mould Plain resistant gene screening monoclonal is sequenced, and the recombinant plasmid can be obtained.

4. a kind of preparation method for the cell that can express Thermostable α-Amylase, which is characterized in that the preparation method include with Lower step:

(a) Thermostable α-Amylase gene is connected in recombinant plasmid of any of claims 1 or 2, and by the production after connection Object is converted to escherichia coli DH5a, is carried out resistance screening using neomycin and is obtained the carrier containing Thermostable α-Amylase gene；

(b) by recipient cell and carrier containing Thermostable α-Amylase gene by can be obtained to obtain energy after electroporated Express the cell of Thermostable α-Amylase.

5. the preparation method of the cell according to claim 4 that Thermostable α-Amylase can be expressed, which is characterized in that described Recipient cell is bacillus subtilis, bacillus amyloliquefaciens, solution starch alkali monad, the thermophilic saline and alkaline coccus of solution starch or solution starch Series bacillus.

6. the preparation method of the cell according to claim 4 or 5 that Thermostable α-Amylase can be expressed, which is characterized in that The step (a) specifically includes the following steps:

(a-1) using the primer P5 with BamHI restriction enzyme site and the primer P6 with XbaI enzyme cutting site to high temperature resistant α-shallow lake Powder enzyme gene is expanded；

(a-2) double digestion is carried out to recombinant plasmid of any of claims 1 or 2 using BamHI and XbaI；

(a-3) recombinant plasmid after the Thermostable α-Amylase gene and double digestion for using T4 ligase to obtain step (a) It is attached, connection product is converted to escherichia coli DH5a, carry out resistance screening using neomycin and obtain containing high temperature resistant α- The carrier of amylase gene.

7. the preparation method of the cell according to claim 4 or 5 that Thermostable α-Amylase can be expressed, which is characterized in that The step (b) specifically includes the following steps:

(b-1) recipient cell is cultivated in LB culture solution to bacterium solution OD600=0.5, thalline were collected by centrifugation；

(b-2) sorbitol solution of thallus ice is resuspended, after centrifugation removal supernatant, thallus is resuspended in the sorb of ice again In sugar alcohol solution；

(b-3) suspension obtained step (b-2) and the carrier containing Thermostable α-Amylase gene carry out electroporated；

(b-4) after the completion of converting, sorbitol solution is added, and by the screening of Selective agar medium, picking starch capacity of decomposition The cell that can express Thermostable α-Amylase can be obtained in strong monoclonal.

8. the preparation method of the cell according to claim 7 that Thermostable α-Amylase can be expressed, which is characterized in that step (b-3) in, the electroporated condition are as follows: resistance 200 Ω, capacitor 25uF.

9. the preparation method of the cell according to claim 7 that Thermostable α-Amylase can be expressed, which is characterized in that step (b-4) in, the ingredient of the Selective agar medium are as follows: 0.1g~5g beef extract, 0.1g~10g peptone, 0.1~10g sodium chloride, 0.01g~5g soluble starch, 1g~10g agar, moisturizing to 100ml.

10. Thermostable α-Amylase can be expressed according to what preparation method described in claim 5-9 any one was prepared Application of the cell in production Thermostable α-Amylase.