CN109825646A - A kind of RCA method detecting herpes simplex virus -1 (HSV-1) - Google Patents

A kind of RCA method detecting herpes simplex virus -1 (HSV-1) Download PDF

Info

Publication number
CN109825646A
CN109825646A CN201910189807.7A CN201910189807A CN109825646A CN 109825646 A CN109825646 A CN 109825646A CN 201910189807 A CN201910189807 A CN 201910189807A CN 109825646 A CN109825646 A CN 109825646A
Authority
CN
China
Prior art keywords
hsv
rca
probe
buffer
herpes simplex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910189807.7A
Other languages
Chinese (zh)
Inventor
朱世新
朱玉华
石康
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HUBEI LANGDE MEDICAL TECHNOLOGY Co Ltd
Original Assignee
HUBEI LANGDE MEDICAL TECHNOLOGY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by HUBEI LANGDE MEDICAL TECHNOLOGY Co Ltd filed Critical HUBEI LANGDE MEDICAL TECHNOLOGY Co Ltd
Priority to CN201910189807.7A priority Critical patent/CN109825646A/en
Publication of CN109825646A publication Critical patent/CN109825646A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of RCA methods for detecting herpes simplex virus -1 (HSV-1), complete in accordance with the following steps: (1) extraction of specimen dna;(2) hybridization of capture probe, the cyclisation connection and digestion of (3) padlock probe, (4) RCA amplification, then with agarose gel electrophoresis, electrophoresis result is observed by gel imager.Padlock probe combination RCA technology of the present invention is a kind of new method for detecting herpes simplex virus -1 (HSV-1), and by padlock probe specific recognition target-gene sequence, RCA expands amplification detection signal.This method is not required to special installation, easy to operate, the good, high sensitivity of specificity, has unique advantage in terms of viral diagnosis.

Description

A kind of RCA method detecting herpes simplex virus -1 (HSV-1)
Technical field
The present invention relates to field of biotechnology, specifically, being related to a kind of detection herpes simplex virus -1 (HSV-1) RCA method.
Background technique
Herpe simplex is a kind of virus dermatopathy caused by herpes simplex virus, and Chinese medicine is known as herpes simplex.It can cause people The a variety of diseases of class, such as gingivostomatitis, keratoconjunctivitis, encephalitis and genital system infection and neonatal infection.In infection host Afterwards, latent infection is often established in nerve cell, will appear asymptomatic toxin expelling again after activation, propagation chain is maintained in crowd, Circulation in cycles.Herpe simplex belongs to herpetoviridae a Chordopoxvirinae, and about 180 nanometers of virus particle size.According to antigen The virus is divided into 1 type and 2 types at present by the difference of property.1 type is mainly obtained by lip lesion, and the primary infection of HSV-1 is often limited to It is especially the most common with gingivostomatitis in pars oralis pharyngis.Clinical manifestation is gum and swallows cheek bleb, fever, sore-throat in groups, after ulceration Form ulcer.Encephalitis, skin bleb eczema can additionally be caused.Adult can cause pharyngitis and tonsillitis.Virus lays dormant exists Gasserian ganglion.Herpes simplex virus the whole world it is widely distributed, infected in crowd it is extremely widespread, hide and recurrent infection person compared with It is more.Virus can enter body by skin, the direct contact of mucous membrane or property route of exposure, and patient and carrier are the infections of the disease Source.Typical changes in histopathology is infected cell in the change of balloon sample, intranuclear inclusion and formation of multinucleate giant cell etc..
Have much for the inspection method of herpes simplex virus -1 (HSV-1), including virus purification culture, complement combine examination It tests, neutralization test, immunofluorescence and enzyme-linked immunosorbent assay and DNA detection etc., but is directed to herpes simplex virus -1 at present (HSV-1) the main still Serologic detection of detection method and PCR detection, respectively for there are antibody and etiology nucleic acid in serum It is detected.The specificity and sensitivity of Serologic detection be not high, often results in false positive results;PCR method high sensitivity, spy It is anisotropic strong, but reaction condition requires height, and there is also certain false positive reactions.
Summary of the invention
Technical problem to be solved by the present invention lies in provide a kind of side RCA for detecting herpes simplex virus -1 (HSV-1) Method, the detection method is easy to operate, the detection time period is short, high specific and sensitivity are able to detect by rolling-circle replication method Herpes simplex virus -1 (HSV-1) out.
Technical scheme is as follows: a kind of RCA method detecting herpes simplex virus -1 (HSV-1), according to as follows Step is completed:
(1) the viral DNA extracts kit step process that sample to be measured is pressed to Qiagen company, obtains and contains herpesviral -1 (HSV-1) genome DNA sample;
(2) the genomic DNA sample containing herpesviral -1 (HSV-1) hybridization of capture probe: is sequentially added in reaction tube Product, padlock probe, capture probe, mix well, and 55 ± 1 DEG C of water-baths hybridize 0.5-1.5h, are slowly cooled to room temperature, addition is dissolved in In 2 × combination buffer the coated magnetic bead of Streptavidin (2 ×: the combination buffer of 2 times of working concentrations, similarly hereinafter, strepto- parent Shanghai bioengineering Co., Ltd is purchased from the coated magnetic bead of element), it mixes, is placed at room temperature for 20-25min, Magnetic Isolation.With 1 × Combination buffer clean magnetic bead 2 times (1 ×: the combination buffer of 1 times of working concentration, similarly hereinafter), discard washing lotion.(hybridization meaning: will Virus target gene to be detected is separated from viral genome, improves detection efficiency and accuracy)
(3) the cyclisation connection and digestion of padlock probe: hybrid product made from deionized water, step (2) and 10 × E.coli Buffer is mixed gently and is reacted 3-5min at 95 ± 1 DEG C, and after 45 ± 1 DEG C of incubation 35-40min, it is slow that 10 × BSA is added Fliud flushing and E.coli DNA ligase mix, and 37 ± 1 DEG C carry out cyclisation connection reaction 35-40min;Add 10 × Exonuclease I exonuclease of I Buffer and Exonuclease mixes, and reacts 0.5-1.5h at 37 ± 1 DEG C, finally I exonuclease 3-5min of Exonuclease (10 × E.coli used in reaction system is inactivated under the conditions of 95 ± 1 DEG C Buffer, 10 × BSA buffer, E.coli DNA ligase, 10 × Exonuclease I Buffer and Exonuclease I Exonuclease is purchased from Shanghai bioengineering Co., Ltd), circularizing probes connection product can be obtained;(cyclisation connection meaning: Target sequence DNA is connected into the DNA of single stranded circle by E.coli DNA ligase, provides cricoid DNA mould for next step RCA amplification Plate;Digestion meaning: I exonuclease of Exonuclease cuts the DNA of linear target DNA or connection error, prevents Only non-annularity DNA cloning expands RCA and generates interference)
(4) RCA is expanded: circularizing probes connection product, primer and 10 × phi29 Buffer obtained in step (3) are taken, It mixes gently, carries out ice bath 1-2min after 3-5min is reacted at 95 ± 1 DEG C;Phi29 archaeal dna polymerase, dNTPs liquid is added, mixes Carry out RCA reaction 1.5-2.5h (phi29 archaeal dna polymerase, dNTPs and phi29 used in reaction system for 37 ± 1 DEG C afterwards Buffer is purchased from Shanghai bioengineering Co., Ltd), obtain amplified production;
(5) agarose gel electrophoresis that amplified production made from step (4) is 1.0-2.0% with mass concentration is taken Complete the detection to herpes simplex virus -1 (HSV-1).Electrophoresis result is observed by gel imager, as shown in Fig. 2, there are naked eyes Bands visible, which amplifies, to be come and positive for herpes simplex virus -1 (HSV-1), otherwise is herpes simplex virus -1 (HSV-1) yin Property.
Designed probe, primer for RCA reaction is in the step (2) (4):
Primer (specific binding target dna, enables the linear growth of amplified reaction product, improves detection sensitivity)
5'-TCTACGTCTTCATTCCTTTAATATTATAGTATTACTAACACTCG-3'SEQ NO1;
Probe is:
Padlock probe is (since the end of probe 5 ' and the connection at 3 ' ends need two sections of identification sequences of probe and target sequence completely mutual It mends, by being locked on target dna for DNA probe specificity, therefore makes RCA reaction that there is high specific, while list can be distinguished The mutation in one site)
5’-GAATTACGGTTCTAGAACTCAAGCCCAATTACCACAATTCTCCTTAGCGACCGACAGATGTCGGA 5 ' ends of AGAAGACAGTTTCGACGAATTTAAGACACCGTAGTCC-3 ' probe carry out phosphorylation modification, SEQ NO2;
Capture probe (probe of one section of special marking, can specificity combining target DNA on target sequence, then by The absorption of affine magnetic bead specificity is conducive to enhance following amplification specificity and sensitivity)
Biotin-TCTACGTCTTCATTCCTTCAGATCCAGAATAACCATAGCTACCAGA SEQ NO3。
By adopting the above technical scheme, the present invention expands amplification detection by padlock probe specific recognition target-gene sequence, RCA Signal is a kind of new method for detecting herpes simplex virus -1 (HSV-1).This method is not required to special installation, easy to operate, special Property good, high sensitivity, in terms of viral diagnosis have unique advantage.
The utility model has the advantages that padlock probe combination RCA technology of the present invention be it is a kind of detection herpes simplex virus -1 (HSV-1) it is new Method, by padlock probe specific recognition target-gene sequence, RCA expands amplification detection signal.Padlock probe is by 5 ' Side Template knots Close area, intermediate catenation sequence area and 3 ' Side Template combined areas composition.When 5 ' ends and 3 ' ends are with target sequence complete complementary, probe two Section forms phosphodiester bond under the action of DNA ligase and is connected cyclization, annular template is provided for RCA amplification, after cyclisation Probe can carry out rolling-circle replication and ramification amplification by primer.Conversely, if there is variation on target sequence or without to be detected Target gene, probe can not be connected to ring-type, and duplication also can not just carry out.
The present invention has prominent meaning: (1) diversity relative to existing detection technique simultaneously.Universal primer in RCA The a plurality of different padlock probe of amplification that efficiency can be waited, overcomes many problems in the amplification methods such as PCR, such as reactant and The phenomenon that amplified production reacts to each other and interferes;(2) high specific.When detecting target sequence using padlock probe, due to probe The connection at 5 ' ends and 3 ' ends needs the two sections of identification sequences and target sequence complete complementary of probe, therefore the reaction of RCA has Gao Te The opposite sex can distinguish the mutation of single site;(3) highly sensitive.The amplification efficiency of linear RCA can achieve 105Times, and index The amplification efficiency of RCA can reach 109Times;(4) high-throughput.PCR etc. traditional nucleic acid amplification technologies are because its amplified production is spread Feed liquor phase and the amplified signal that persistent accumulation cannot be generated, therefore be not suitable for carrying out nucleic acid amplification on chip, but RCA then may be used To solve this problem, because of its ring-shaped sequence that will form closure on target, the signal energy that RCA is generated is ensured that It enough focuses on a bit, amplification in situ and slide glass amplification is realized with this.
This method is not required to special installation, easy to operate, the good, high sensitivity of specificity, has in low virus load context of detection There is unique advantage.
Detailed description of the invention
Fig. 1 be embodiment 1RCA detect various concentration template electrophoresis result (swimming lane 1,2,3,4 respectively represents final concentration of 5nM, 500pM, 50pM, 5pM template group RCA product electrophoresis result).
Fig. 2 be the different samples of embodiment 2 carry out RCA detection electrophoresis result (swimming lane 1,2,3,4,5,6,7,8,9,10, 11,12 be the 1st to No. 12 sample RCA product group electrophoresis result).
Specific embodiment
The present invention is further illustrated With reference to embodiment:
Embodiment 1
The detection of the minimal detectable concentration of RCA amplified reaction is completed in accordance with the following steps:
(1) known -1 (HSV-1) positive sample of herpes simplex virus is pressed to the viral DNA extracts kit of Qiagen company Step processing on operational manual, obtains the DNA (virus genom DNA) of sample, and it is dense to survey DNA with ultramicrospectrophotometer It spends (NanoDrop 2000C), and is diluted to the template that detection final concentration is respectively 5pM, 50pM, 500pM and 5nM;
(2) 6 μ of dilution various concentration in step (1) hybridization of capture probe: are sequentially added into hybridization reaction pipe L DNA sample, 1 μm of 1 μ l of ol/L padlock probe, 1 μm of 1 μ l of ol/L capture probe, mix well, and 55 DEG C of water-baths hybridize 1h, slowly Be cooled to room temperature, be added 40 μ l be dissolved in the coated magnetic bead of Streptavidin in 2 × combination buffer (2 ×: 2 times of working concentrations, magnetic Pearl is purchased from Shanghai bioengineering Co., Ltd), it mixes, is placed at room temperature for 20min, Magnetic Isolation.Magnetic is cleaned with 1 × combination buffer Pearl 2 times (1 ×: 1 times of working concentration), discard washing lotion.
(3) the cyclisation connection and digestion of padlock probe: every pipe is separately added into miscellaneous made from deionized water 16ul, step (2) Product and 10 × E.coli Buffer2 μ l are handed over, is mixed gently, reacts 5min at 95 DEG C, after 45 DEG C of incubations 40min, addition 10 × 2 μ l of BSA buffer and 0.4 μ l E.coli DNA ligase mix, and 37 DEG C carry out cyclisation connection reaction 40min;Add 10 I I exonuclease of Buffer2 μ l and Exonuclease of × Exonuclease, 1.8 μ l is mixed, 37 DEG C of reaction 1h, finally Inactivated under the conditions of 95 DEG C I exonuclease 5min of Exonuclease (used enzyme in reaction system, BSA buffer and Buffer is purchased from Shanghai bioengineering Co., Ltd), obtain circularizing probes connection product;
(4) RCA is expanded: being taken 42 μ l of circularizing probes connection product obtained in step (3), is separately added into 100 μm of ol/L and draws 1 μ l and 10 × phi29 Buffer1 μ l of object, mixes gently, 5min is reacted at 95 DEG C, then carry out ice bath 1-2min;Phi29 is added 1 μ l of archaeal dna polymerase, 1 μ l of dNTPs liquid, after mixing 37 DEG C carry out RCA reaction 2h (used enzyme in reaction system, dNTPs and Buffer is purchased from Shanghai bioengineering Co., Ltd);
(5) taking amplified production mass concentration made from step (4) is 1.0% agarose gel electrophoresis, be can be completed Detection to the minimal detectable concentration of herpes simplex virus -1 (HSV-1).Electrophoresis result, such as Fig. 1 are observed by gel imager It is shown.
Designed primer, probe for RCA reaction is in the step (2) (4):
Primer 5 '-TCTACGTCTTCATTCCTTTAATATTATAGTATTACTAACACTCG-3 ' SEQ NO1;
Probe is:
Padlock probe
5’-GAATTACGGTTCTAGAACTCAAGCCCAATTACCACAATTCTCCTTAGCGACCGACAGATGTCGGA 5 ' ends of AGAAGACAGTTTCGACGAATTTAAGACACCGTAGTCC-3 ' probe carry out phosphorylation modification, SEQ NO2.
Capture probe
Biotin-TCTACGTCTTCATTCCTTCAGATCCAGAATAACCATAGCTACCAGA SEQ NO3。
The minimal detectable concentration sample of herpes simplex virus -1 (HSV-1) is examined by the inspection method of embodiment 1 It surveys, obtains:
It is respectively the template of 5pM, 50pM, 500pM and 5nM, RCA amplified production electricity with method detection final concentration of the invention Result of swimming is as shown in Figure 1.The results show that RCA is showed no amplified production, template final concentration below template final concentration 5pmol/L The visible bright band of 50pmol/L or more shows that the minimal detectable concentration of RCA is 50pmol/L.As a result it prompts, rolling circle amplification RCA method can preferably meet the detection of low virus load sample.
Embodiment 2
A kind of specific detection for the RCA method detecting herpes simplex virus -1 (HSV-1), is completed in accordance with the following steps:
(1) sample to be measured is handled by the step on the viral DNA extracts kit operational manual of Qiagen company, is obtained Obtain the DNA (virus genom DNA) of sample;
(2) 6 μ l DNA samples, 1 μm of 1 μ of ol/L padlock probe the hybridization of capture probe: are sequentially added in hybridization reaction pipe L, 1 μm of 1 μ l of ol/L capture probe, mixes well, and 55 DEG C of water-baths hybridize 1h, are slowly cooled to room temperature, and 40 μ l are added and are dissolved in 2 × knot Close buffer in the coated magnetic bead of Streptavidin (2 ×: 2 times of working concentrations, magnetic bead be purchased from Shanghai bioengineering Co., Ltd), It mixes, is placed at room temperature for 20min, Magnetic Isolation.Clean magnetic bead 2 times with 1 × combination buffer (1 ×: 1 times of working concentration), it discards Washing lotion.
(3) the cyclisation connection and digestion of padlock probe: hybrid product made from deionized water 16ul, step (2) and 10 × E.coli Buffer2 μ l, mixes gently, and reacts 5min at 95 DEG C, and after 45 DEG C of incubation 40min, 10 × BSA buffer, 2 μ l is added It with 0.2 μ l E.coli DNA ligase, mixes, 37 DEG C carry out cyclisation connection reaction 40min;Add 10 × Exonuclease I I exonuclease of Buffer2 μ l and Exonuclease, 2 μ l, mixes, and 37 DEG C of reaction 1h are finally inactivated under the conditions of 95 DEG C (used enzyme, BSA buffer and buffer are raw purchased from Shanghai in reaction system by I exonuclease 5min of Exonuclease Object Engineering Co., Ltd), obtain circularizing probes connection product;
(4) RCA is expanded: taking 42 μ l of circularizing probes connection product obtained in step (3), 100 μm of 1 μ l of ol/L primer are added It with 10 × phi29 Buffer1 μ l, mixes gently, 5min is reacted at 95 DEG C, then carry out ice bath 1-2min;Phi29 DNA is added 1 μ l of polymerase, 1 μ l of dNTPs liquid, after mixing 37 DEG C carry out RCA reaction 2h (used enzyme in reaction system, dNTPs and Buffer is purchased from Shanghai bioengineering Co., Ltd);
(5) taking amplified production mass concentration made from step (4) is 1.0% agarose gel electrophoresis, be can be completed Detection to herpes simplex virus -1 (HSV-1).Electrophoresis result is observed by gel imager, as shown in Fig. 2, there are naked eyes visible Band, which amplifies, to be come and positive for herpes simplex virus -1 (HSV-1), otherwise negative for herpes simplex virus -1 (HSV-1).
Designed primer, probe for RCA reaction is in the step (2) (4):
Primer 5 '-TCTACGTCTTCATTCCTTTAATATTATAGTATTACTAACACTCG-3 ' SEQ NO1;
Padlock probe
5’-GAATTACGGTTCTAGAACTCAAGCCCAATTACCACAATTCTCCTTAGCGACCGACAGATGTCGGA 5 ' ends of AGAAGACAGTTTCGACGAATTTAAGACACCGTAGTCC-3 ' probe carry out phosphorylation modification, SEQ NO2.
Capture probe
Biotin-TCTACGTCTTCATTCCTTCAGATCCAGAATAACCATAGCTACCAGA SEQ NO3。
Herpes simplex virus -1 (HSV-1) had clinically been detected no to 12 by the detection method of embodiment 2 RCA detection is carried out with patient specimen, is obtained:
DNA are extracted to 12 samples by the inspection method of embodiment 2, DNA is then subjected to RCA detection, as the result is shown 7 Example is the positive, and 5 are feminine gender.
The positive test symbol and clinical detection result of herpes simplex virus -1 (HSV-1) are completely the same, illustrate detection The result is that satisfied.
Sequence table
<110>Hubei Lang De medical science and technology Co., Ltd
<120>a kind of RCA method for detecting herpes simplex virus -1 (HSV-1)
<160> 3
<170> PatentIn version 3.4
<210> 1
<211> 44
<212> DNA
<213>artificial sequence
<400> 1
5’-TCTACGTCTTCATTCCTTTAATATTATAGTATTACTAACACTCG-3’
<210> 2
<211> 102
<212> DNA
<213>artificial sequence
<400> 2
5’-GAATTACGGTTCTAGAACTCAAGCCCAATTACCACAATTCTCCTTAGCGACCGACAGATGTCGGAAGAA GACAGTTTCGACGAATTTAAGACACCGTAGTCC-3’
<210> 3
<211> 46
<212> DNA
<213>artificial sequence
<400> 3
Biotin-TCTACGTCTTCATTCCTTCAGATCCAGAATAACCATAGCTACCAGA

Claims (4)

1. a kind of RCA method for detecting herpes simplex virus -1 (HSV-1), which is characterized in that complete in accordance with the following steps:
(1) the viral DNA extracts kit step process that sample to be measured is pressed to Qiagen company, obtains and contains herpesviral -1 (HSV-1) genome DNA sample;
(2) genome DNA sample, lock containing herpesviral -1 (HSV-1) hybridization of capture probe: are sequentially added in reaction tube Formula probe, capture probe, mix well, 55 ± 1 DEG C of water-baths hybridization, cooled to room temperature after the completion of hybridization, and addition is dissolved in 2 × The coated magnetic bead of the Streptavidin of combination buffer mixes, is placed at room temperature for, Magnetic Isolation, cleans magnetic with 1 × combination buffer Pearl for several times, discards washing lotion, obtains hybrid product;
(3) the cyclisation connection and digestion of padlock probe: hybrid product and 10 × E.coli made from deionized water, step (2) Buffer is mixed gently, and 3-5min is reacted at 95 ± 1 DEG C, and after being then incubated at 45 ± 1 DEG C again, 10 × BSA buffering is added Liquid and E.coli DNA ligase mix, and cyclisation connection reaction is carried out at 37 ± 1 DEG C;After the reaction was completed be added 10 × Exonuclease I exonuclease of I Buffer and Exonuclease mixes, and reacts at 37 ± 1 DEG C, exists after the reaction was completed I exonuclease of Exonuclease is inactivated under the conditions of at 95 ± 1 DEG C, obtains circularizing probes connection product;
(4) RCA is expanded: circularizing probes connection product, addition primer and 10 × phi29 Buffer obtained in step (3) are taken, 3-5min is reacted after mixing at 95 ± 1 DEG C, then carries out ice bath;Phi29 archaeal dna polymerase, dNTPs liquid are added, after mixing In 37 ± 1 DEG C of progress RCA reactions, amplified production is obtained;
(5) agarose gel electrophoresis for taking amplified production made from step (4) has naked eyes bands visible to amplify and to be list Pure herpesviral -1 (HSV-1) is positive, otherwise negative for herpes simplex virus -1 (HSV-1), can be completed to herpe simplex disease The detection of -1 (HSV-1) of poison;
The designed primer for RCA reaction is in the step (4):
5'-TCTACGTCTTCATTCCTTTAATATTATAGTATTACTAACACTCG-3' SEQ NO1;
Padlock probe in the step (2) are as follows:
5’-GAATTACGGTTCTAGAACTCAAGCCCAATTACCACAATTCTCCTTAGCGACCGACAGATGTCGGAAGAA 5 ' ends of GACAGTTTCGACGAATTTAAGACACCGTAGTCC-3 ' probe carry out phosphorylation modification SEQ NO2;
Capture probe in the step (2) are as follows:
Biotin-TCTACGTCTTCATTCCTTCAGATCCAGAATAACCATAGCTACCAGA
SEQ NO3。
2. the RCA method of detection herpes simplex virus -1 (HSV-1) according to claim 1, which is characterized in that step (2) padlock probe in, capture probe concentration be 0.5-1.5 μm of ol/L, and padlock probe, capture probe are relative to DNA sample The 10-20% of product volume.
3. the RCA method of detection herpes simplex virus -1 (HSV-1) according to claim 1, which is characterized in that step (3) 18-25% of 10 × E.coli Buffer relative to hybrid product volume made from step (2) in;10 × BSA buffer 18-25% relative to hybrid product volume made from step (2);E.coli DNA ligase is obtained relative to step (2) The 1.5-2.5% of hybrid product volume;10 × Exonuclease I Buffer is relative to hybrid product body made from step (2) Long-pending 18-25%;18-25% of the Exonuclease I relative to hybrid product volume made from step (2).
4. the RCA method of detection herpes simplex virus -1 (HSV-1) according to claim 1, which is characterized in that step (4) additive amount of primer is the 1.8-3% of circularizing probes connection product in;The additive amount of 10 × phi29 Buffer is probe ring Change the 9.5-15% of connection product;The additive amount of phi29 archaeal dna polymerase is the 1.8-3% of circularizing probes connection product.
CN201910189807.7A 2019-03-13 2019-03-13 A kind of RCA method detecting herpes simplex virus -1 (HSV-1) Pending CN109825646A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910189807.7A CN109825646A (en) 2019-03-13 2019-03-13 A kind of RCA method detecting herpes simplex virus -1 (HSV-1)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910189807.7A CN109825646A (en) 2019-03-13 2019-03-13 A kind of RCA method detecting herpes simplex virus -1 (HSV-1)

Publications (1)

Publication Number Publication Date
CN109825646A true CN109825646A (en) 2019-05-31

Family

ID=66869282

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910189807.7A Pending CN109825646A (en) 2019-03-13 2019-03-13 A kind of RCA method detecting herpes simplex virus -1 (HSV-1)

Country Status (1)

Country Link
CN (1) CN109825646A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101979668A (en) * 2010-11-05 2011-02-23 武汉百泰基因工程有限公司 Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting herpes simplex viruses 1
CN105624329A (en) * 2014-10-29 2016-06-01 上海仁度生物科技有限公司 Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1
CN107619884A (en) * 2017-10-24 2018-01-23 湖北朗德医疗科技有限公司 A kind of RCA methods for detecting Epstein-Barr virus
CN107630108A (en) * 2017-10-24 2018-01-26 湖北朗德医疗科技有限公司 A kind of RCA methods for detecting zika virus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101979668A (en) * 2010-11-05 2011-02-23 武汉百泰基因工程有限公司 Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting herpes simplex viruses 1
CN105624329A (en) * 2014-10-29 2016-06-01 上海仁度生物科技有限公司 Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1
CN107619884A (en) * 2017-10-24 2018-01-23 湖北朗德医疗科技有限公司 A kind of RCA methods for detecting Epstein-Barr virus
CN107630108A (en) * 2017-10-24 2018-01-26 湖北朗德医疗科技有限公司 A kind of RCA methods for detecting zika virus

Similar Documents

Publication Publication Date Title
KR102098772B1 (en) Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR
CN114934102B (en) Primer group and kit for simultaneously detecting multiple respiratory tract pathogen nucleic acids based on icosaPCR
CN107619884A (en) A kind of RCA methods for detecting Epstein-Barr virus
CN105624329B (en) Herpes simplex virus type 1 real-time fluorescence nucleic acid isothermal amplification detection kit
CN111621597A (en) Virus recombinase-polymerase amplification detection method
CN108384898A (en) Kit and its application method for detecting Respiratory Syncytial Virus(RSV) A, Type B
CN101660005A (en) Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof
CN101760560A (en) Fluorescent PCR detection method for human cytomegalovirus (HCMV)
CN110551607A (en) mycobacterium tuberculosis drug-resistant gene multiple detection method based on RCA amplification
JP2017505120A (en) Control for NGS system and method of using the same
CN105779644B (en) The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus
CN112301159A (en) RDA method and kit for rapidly detecting influenza B virus
KR20230057778A (en) Method and Kit for Diagnosing Bovine tuberculosis using PNA
CN104419713A (en) Loop-mediated isothermal amplification based human respiratory syncytial virus detection kit
JP2020533974A (en) Respiratory syncytial virus species nicking and elongation amplification reaction (NEAR)
CN108977578A (en) Detect the kit and its method of H7N9 avian influenza virus
CN113151496A (en) Primer, probe, kit and method for visual rapid detection of schistosoma mansoni nucleic acid by LFD-RPA
CN112646927A (en) Fluorescent RAA kit for detecting bovine sarcoidosis virus, detection method and application thereof
CN111471800A (en) Kit for detecting novel coronavirus and amplification primer composition thereof
WO2020125295A1 (en) Primers, probes, kit and detection method for detecting human immunodeficiency virus nucleic acids
CN109825646A (en) A kind of RCA method detecting herpes simplex virus -1 (HSV-1)
US20230250496A1 (en) Rapid detection kit for human pathogenic coronaviruses: betacoronavirus group b/c and sars-cov-2
CN102031314A (en) Primer and probe sequence for human metapneumovirus nucleonic acid detection
CN109852728A (en) A kind of RCA method detecting herpes simplex virus-2 (HSV-2)
KR102076343B1 (en) Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190531