CN108384898A - Kit and its application method for detecting Respiratory Syncytial Virus(RSV) A, Type B - Google Patents
Kit and its application method for detecting Respiratory Syncytial Virus(RSV) A, Type B Download PDFInfo
- Publication number
- CN108384898A CN108384898A CN201810458231.5A CN201810458231A CN108384898A CN 108384898 A CN108384898 A CN 108384898A CN 201810458231 A CN201810458231 A CN 201810458231A CN 108384898 A CN108384898 A CN 108384898A
- Authority
- CN
- China
- Prior art keywords
- rsv
- syncytial virus
- respiratory syncytial
- type
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a kind of kit and application method for detecting Respiratory Syncytial Virus(RSV) A, Type B, which forms by the detection pipe containing detection reagent, positive quality control product and without RNase water；Wherein, detection reagent single tube dispenses, and is dry powder, includes the primer and TaqMan fluorescence probes of the specific and conserved sequence of Respiratory Syncytial Virus(RSV) A, Type B.Respiratory Syncytial Virus(RSV) A, Type B can quick and precisely be detected, and can be easy to be easy-to-use in various environment, ensure that the timeliness, specificity and sensitivity of detection；For specific primer probe is designed on Respiratory Syncytial Virus(RSV) A, the respective conserved sequence of Type B, it can detect simultaneously and distinguish Respiratory Syncytial Virus(RSV) A, Type B；It solves the problems, such as Cord blood and using cumbersome, detection reagent can preserve under 4 DEG C of low temperature or room temperature, when use, which only needs the sample of nucleic acid extracted is added, can go up machine testing.
Description
Technical field
The present invention relates to molecular biology fields, and in particular to a kind of examination for detecting Respiratory Syncytial Virus(RSV) A, Type B
Agent box and its application method.
Background technology
Respiratory Syncytial Virus(RSV) (Respiratory Syncytial Virus, RSV) is a kind of single strand RNA virus, is belonged to
Paramyxoviridae is to cause one of most common reason of infant's lower respiratory tract viral infection in world wide.Due to RSV
It can cause syncytium formation in cell, respiratory syncystial is named as according to its cytopathy feature in cell culture
Virus.
The most significant features of RSV are the severity that rsv infection can only adjust with postoperative infection each time, and the antibody of generation is simultaneously
Permanent protection cannot be generated to body, therefore RSV can repeated infection.Mother pass antibody can not pre- aseptic generation, thus
The young infant of birth soon can fall ill, and often cause children's interstitial pneumonia and bronchiolitis, be to cause child virus
The most common pathogen of pneumonia.Infant's symptom is heavier, can there is high fever, rhinitis, pharyngitis and laryngitis, shows as capillary branch gas later
Pipe inflammation and pneumonia.A small number of sick children can concurrent tympanitis, pleurisy and myocarditis etc..After adult and older children infect, main table
It is now respiratory tract infection.3~7 days incubation periods, rsv infection have apparent seasonality, and main outbreak of epidemic is in winter-spring season, every year
2 months November~next years be outbreak of epidemic peak season.
Respiratory Syncytial Virus(RSV) is made of the nucleocapsid and coating of package strand RNA, 10 hatching egg of genome encoding
White matter, including 7 kinds of structural proteins (G, F, M1, M2, P, L, N) and 3 kinds of non-structural proteins (NS1, NS2, SH), wherein G-protein and F
Albumen is located at the surface of virion, is main glycoprotein.RSV can be divided into two hypotype of A, B according to antigenic difference, and two is sub-
The main distinction between type is that the gene difference of G-protein, G-protein are the maximum albumen that makes a variation in RSV strains, and there is only 5%
Antigen correlation.It has been reported that A respiratory syncytial virus subtypes have stronger pathogenic, infant compared to subtype B
After infection, subtype B ratio A hypotypes are stronger and effective to the antigen-reactive of homotype G-protein.
China will appear the popular asthma caused by respiratory syncytial virus infection every the several years and suppress type pneumonia, often result in number
100000 human hairs disease, different year A, subtype B can alternately become popular dominant strain.RSVA, RSVB hypotype infant are to cough, breathe heavily
Breath is cardinal symptom, is secondly nasal congestion, fever, expiratory dyspnea, two hypotype clinical manifestation no significant differences.Utilize molecule skill
Art can quickly and accurately carry out parting, avoid misapplying or abusing alkaline drug, to respiratory tract infection early diagnosis and just
The meaning really treated is very great.
The detection method for being directed to Respiratory Syncytial Virus(RSV) currently on the market mainly has viral cultivation, immunodetection and glimmering
Light PCR methods.Cultivation is pathogen to be cultivated on defined medium, then carry out observation analysis to the result of generation.Exempt from
Epidemic disease method is that specific binding occurs come testing goal albumen by antigen-antibody.Fluorescent PCR method is led to during PCR amplification
Fluorescence signal is crossed, PCR processes are monitored in real time, qualitative or quantitative testing goal gene.
The antigen or pathogen that immunization detection reagent is directed in sample cause the specific antibody that body generates,
And antibody test has window phase, is easy to fail to pinpoint a disease in diagnosis at the initial stage of a disease；Immunization detection sensitivity, specificity are relatively low, and sample is easy to pollute
And interfering substance is more, excessive concentration or it is too low when all be easy to cause result misjudgement, need repeat detect, check could really
It examines, the confidence level of detection is poor；Time-consuming longer using cultivation detection, culture effect is poor, and many pathogen can not cultivate, delay
Best occasion for the treatment.
Although there are common fluorescence PCR detection reagent preferable sensitivity and specificity, kit to be generally more
Pipe liquid reagent is constituted, and is in charge of is stored at -20 DEG C in liquid form, and when use needs to melt multitube reagent, according to certain
Ratio mixed, be configured to detection reaction solution, sample nucleic acid is then added, is put into fluorescence quantitative PCR instrument and is detected,
Testing result is finally analyzed according to amplification curve；There is higher requirement for transport and preservation condition, operating method etc., holds
Yi Yin preserves improper and operation error and causes testing result insincere.
In addition, respiratory syncytial virus infection is increased, but at present on the market temporarily without using fluorescence quantitative PCR method to exhaling
Inhale the similar kit that road syncytial virus carries out parting detection.
Invention content
The technical problem to be solved by the present invention is to providing one kind can while quick and precisely detect, and can be in various environment
The easy easy-to-use kit for detecting Respiratory Syncytial Virus(RSV) A, Type B.
In order to solve the above technical problems, the technical solution adopted by the present invention is, this is used to detect Respiratory Syncytial Virus(RSV) A, B
The kit of type is formed by the detection pipe containing detection reagent, positive quality control product and without RNase water；Wherein, detection reagent single tube
Packing is dry powder, includes that the primer of the specific and conserved sequence of Respiratory Syncytial Virus(RSV) A, Type B and TaqMan fluorescence are visited
Needle；
The primer sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.1 and SEQ ID NO.2；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.4 and SEQ ID NO.5；
The TaqMan probe sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.3；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.6.
Above-mentioned technical proposal can quick and precisely detect Respiratory Syncytial Virus(RSV) A, Type B, and can be in various environment
It is easy to be easy-to-use, it ensure that the timeliness, specificity and sensitivity of detection；It is respective conservative for Respiratory Syncytial Virus(RSV) A, Type B
Specific primer probe is designed in sequence, and marks different fluorescence signals on probe, can simultaneously be detected and be distinguished and exhale
Inhale road syncytial virus A, Type B；It solves the problems, such as Cord blood and uses cumbersome, detection reagent in kit of the invention
It for single tube dry powder, can be preserved under 4 DEG C of low temperature or room temperature, when use, which only needs the sample of nucleic acid extracted is added, can go up machine examination
It surveys；Detection pipe agent prescription is by optimizing and revising in kit, handles as dry powder, can be protected under 4 DEG C of low temperature or room temperature
It deposits 1 year or more, does not influence detection result, when use, which only needs sample is added, can go up machine testing, easy-to-use；Kit uses
TaqMan probe Fluorescence PCR assay is detected for Respiratory Syncytial Virus(RSV) A, Type B, and the sequence of design primer and probe exists
Respiratory Syncytial Virus(RSV) A, Type B gene in all very conservative, high specificity, and testing result can be obtained in 2 hours, spirit
Sensitivity is up to 10copies/ μ L.
Wherein, SEQ ID NO.1：CCATTCGCATCTCGCGTT；
SEQ ID NO.2：CATCGCACGTCAACAACG；
SEQ ID NO.3：GTAGGCTACATGTGGAAGAATGC；
SEQ ID NO.4：GTACACAAGGCTCCACAA；
SEQ ID NO.5：CGTATGATGTGTTGTAGCA；
SEQ ID NO.6：CTGTACAACTGTTCACACGTCTAGAA.
Preferably, the detection reagent further include have PCR buffer solutions, trehalose, bovine serum albumin(BSA), dATP, dUTP,
dCTP、dGTP、MgCl2, HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
UNG enzymes/anti-pollution systems of dUTP are used, the pollution interference that previous PCR reaction product is brought can be reduced；It will reverse
Record enzyme is blended in a PCR reaction tube with HotStart Taq enzymes and uses, and first progress process of reverse-transcription synthesizes cDNA, then into
Row PCR amplification, does not add random primer, and one step of process is completed, and without uncapping, can reduce laboratory operating procedures, when saving
Between, while also avoiding the sample contamination that operation of uncapping may be brought；Used probe is the TaqMan of 5 ' end fluorescent markers
The oligonucleotides of mark fluorescent reporter group (R) and fluorescent quenching group (Q) are distinguished in probe, probe both ends.When probe is complete,
That is stochastic regime and when without PCR product hybridized state, the fluorescence that reporter group is sent out is quenched group absorptions.Expand in fluorescent PCR
In increasing process, 5 ' the end excision enzymes of HotStart Taq enzymes when special PCR product and TaqMan probe generation hybridization reaction
For activity simultaneously also probe cleavage, the fluorescence that reporter group is released can be built in the fluorescence in instrument
Meter detects.PCR often passes through a cycle, and fluorescence signal is also as target fragment, there are one the process that sync index increases,
Fluorescence signal power just represent template ribonucleic acid copy number number.Therefore the present invention cannot be only used for simple qualitative inspection
It surveys, also can be used as the quantitative detection of sample concrete content.
Preferably, final concentration of 100~1000nM of the primer in amplification system；The probe is in amplification system
Final concentration of 50~500nM；Final concentration of 1%~10%w/v of the trehalose in amplification system；The ox blood is pure
Final concentration of 0.1%~5%w/v of the albumen in amplification system；The HotStart Taq enzymes, reverse transcriptase, UNG enzymes are expanding
Final concentration of 0.5U~5U in increasing system；The final concentration of described dATP, dUTP, dCTP, dGTP in amplification system is
0.1mM~2mM；The MgCl2Final concentration of 1.5mM~10mM in amplification system..
Wherein, M=mol/L is concentration unit；W/v is mass volume ratio；In addition, the concentration of enzyme is in a reactant
1U in system.
Preferably, the plasmid containing Respiratory Syncytial Virus(RSV) A types and Type B amplification gene sequence in the positive quality control product.
Preferably, the preparation method of the detection reagent is：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h is frozen under the conditions of being put into -80 DEG C
More than；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
The invention solves another technical problem be to provide a kind of application method of aforementioned agents box, this method includes
Following steps：
(1) DNA/RNA of sample is extracted into template altogether, be separately added into without RNase water, each 25 μ L of positive quality control product it is different
In detection pipe, pipe lid is covered, carries out fluorescent PCR detection；
(2) condition of pcr amplification reaction is：50 DEG C of 15~30min of reverse transcription；92~97 DEG C of 1~10min of pre-degeneration；92
~97 DEG C of 10~15s of denaturation；58~62 DEG C of annealing extend 35~50s；40~45 cycles；
(3) availability deciding：
The Ct values that no RNase water detects are Undet or 40, and value≤35 Ct that positive quality control product detects are otherwise real
It tests and is considered as in vain；
(4) result interpretation：
Pattern detection pipe Ct values are Undet or 40, which is judged as that feminine gender, sample rna extraction failure wait for test sample
It is limited less than detection without RNA or content in this；
Value≤35 pattern detection pipe Ct, the sample results are judged as that corresponding pathogen is positive, pattern detection success；
Pattern detection pipe Ct values are 38~40, need reinspection primary, if Ct values are still 38~40, are judged as feminine gender；
According to the above interpretation method, it is logical to correspond to fluorescence in conjunction with the Respiratory Syncytial Virus(RSV) A types and Type B that pattern detection pipe detects
The Ct values in road judge the testing result of two kinds of hypotypes.
The present invention has the advantage that compared with common fluorescent PCR methods, immunization and bacterial cultivation etc.：
1. high specificity：The primed probe of the present invention is directed to the specific conservative region of Respiratory Syncytial Virus(RSV) A types/Type B
Sequence design, high specificity.
2. sensibility is high：The present invention can detect the objective gene sequence of 10copies/ μ L concentration.
3. being easy to preserve：The powdered reagent of prepackage single tube in the detection pipe of the present invention, it is convenient to preserve.
4. single tube parting：Two kinds of Respiratory Syncytial Virus(RSV) Asias are distinguished according to the difference of fluorescence signal in a detection pipe
Type.
5. detection process is reacted for stopped pipe, and process of reverse-transcription and PCR amplification process are combined, experimental procedure is reduced, and
Greatly reduce the possibility of pollution and result error.
7. easy to operate quick：Without preparing detection reagent, it is only necessary to which sample-adding is primary, you can upper machine testing, from specimen transfer
It can be completed within 3 hours to obtaining a result.
6. result interpretation is clear, objective；If desired can also quantitative analysis be carried out to result.
7. safety：Do not include poisonous and harmful substance in whole system, the post-processing of PCR product is not necessarily to, to operator and ring
Border is all non-hazardous.
Description of the drawings
Fig. 1 is the PCR amplification curve graph of the embodiment of the present invention 1；
Fig. 2 is the PCR amplification curve graph of the embodiment of the present invention 2.
Specific implementation mode
Embodiment 1：The present embodiment is used to detect Respiratory Syncytial Virus(RSV) A types, the kit of Type B, by containing detection examination
It the detection pipe of agent, positive quality control product and is formed without RNase water；Wherein, detection reagent single tube dispenses, and is dry powder, includes
Respiratory Syncytial Virus(RSV) A types, the primer of the specific and conserved sequence of Type B and TaqMan fluorescence probes；
The primer sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.1 and SEQ ID NO.2；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.4 and SEQ ID NO.5；
The TaqMan probe sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.3；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.6.
Detection reagent further include have PCR buffer solutions, trehalose, bovine serum albumin(BSA), dATP, dUTP, dCTP, dGTP,
MgCl2, HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
Final concentration of 100nM of the primer in amplification system；Final concentration of 50nM of the probe in amplification system；Institute
State final concentration of 1%w/v of the trehalose in amplification system；The bovine serum albumin(BSA) is final concentration of in amplification system
0.2%w/v；The HotStart Taq enzymes, the final concentration of reverse transcriptase, UNG enzymes in amplification system are 1U；It is described
The final concentration of dATP, dUTP, dCTP, dGTP in amplification system is 0.5mM；The MgCl2End in amplification system is dense
Degree is 5.5mM；Plasmid containing Respiratory Syncytial Virus(RSV) A types, Type B amplification gene sequence in positive quality control product.
The dry powder preparation method of detection reagent is：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h is frozen under the conditions of being put into -80 DEG C
More than；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
The reaction system of the kit is 25 μ L, and directly 25 μ L sample nucleic acids of extraction are added in single detection pipe.
The operation of kit and result judgement：
(1) by the DNA/RNA of sample extract altogether template (being extracted in sputum, Nasopharyngeal swabs from people etc.), without RNase water,
Each 25 μ L of positive quality control product are separately added into different PCR reaction tubes, are made into reaction system, are covered the centrifugation of pipe lid mixing, are put into
Fluorescent PCR detection is carried out in fluorescence quantitative PCR instrument；
(2) condition for the pcr amplification reaction being arranged in instrument is：50 DEG C of reverse transcription 30min；92 DEG C of pre-degeneration 10min；94
DEG C denaturation 15s；58 DEG C of annealing extend 40s；40 cycles；
(3) after the completion of reacting, baseline is set as adjust automatically, is divided testing result according to amplification curve diagram and Ct values
Analysis；
(4) availability deciding：
The Ct values that no RNase water detects are Undet or 40, and value≤35 Ct that positive quality control product detects are otherwise real
It tests and is considered as in vain；
(5) result interpretation：
Pattern detection hole Ct values are Undet or 40, which is judged as that feminine gender, sample rna extraction failure wait for test sample
It is limited less than detection without RNA or content in this；
Pattern detection hole value≤35 Ct, the sample results are judged as that corresponding pathogen is positive, pattern detection success；
Pattern detection hole Ct values are 35-40, need reinspection primary, if Ct values are still 35-40, are judged as feminine gender.
The Ct values of fluorescence channel are corresponded in conjunction with the Respiratory Syncytial Virus(RSV) A types and Type B that pattern detection pipe detects to judge two
The testing result of kind virus.
Fig. 1 is the PCR amplification curve graph of the present invention, wherein 1 is fluorescence threshold, 2 be negative control, and 3 be positive quality control product,
4 be to need the sample detected again, and 5 be the sample of Respiratory Syncytial Virus(RSV) A type positive findings, and 6 be Respiratory Syncytial Virus(RSV) Type B
The sample of positive findings.Positive quality control product 3 detects two amplification curves, and Ct values all ＜ 35, negative control 2 without amplification curve,
Show that result is effective；The Ct values ＞ 35 of 4 amplification curve of sample, it is proposed that detect again；Sample 5 and 6 has amplification curve, and Ct values
＜ 35, is determined as positive findings.
Embodiment 2：
Respiratory Syncytial Virus(RSV) A types, the plasmid sample of Type B and three's mixing are detected respectively with the kit of the present invention
Plasmid sample, concentration are respectively 105copies/μL.It is detected in the same manner as shown in Example 1.
Testing result show kit of the present invention can in a detection pipe and meanwhile detect two kinds of Respiratory Syncytial Virus(RSV),
And two fluorescence signal channels are not interfere with each other, and as a result see Fig. 2.Wherein 1 is fluorescence threshold, and 2 be negative control, and 3 be the two mixing
Plasmid, 4 be Respiratory Syncytial Virus(RSV) A pattern sheets, and 5 be Respiratory Syncytial Virus(RSV) Type B sample.Negative control 2 is mixed without amplification curve
Conjugative plasmid sample 3 detects two amplification curves, respectively two channels, and Ct values all ＜ 35, shows that result is effective；Sample 4 and 5
All only there is amplification curve there are one channel, and Ct values result is identical with concentration mixes plasmid no significant difference.
Test result shows that this kit can detect Respiratory Syncytial Virus(RSV) A types, Type B simultaneously, can also detect individual event
And do not interfere the fluorescence signal channel of another.
The basic principles and main features and advantage of the present invention have been shown and described above.The technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, and the above embodiments and description only describe the originals of the present invention
Reason, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, such as primer is expanding
Final concentration in system is selected within the scope of 100~1000nM, and final concentration of the probe in amplification system is in 50~500nM
It is selected in range, final concentration of the trehalose in amplification system is selected in 1%~10% range, bovine serum albumin
The final concentration in amplification system is selected in 0.1%~5% range in vain, HotStart Taq enzymes, reverse transcriptase, UNG
Final concentration of the enzyme in amplification system is selected within the scope of 0.5U~5U, and dATP, dUTP, dCTP, dGTP are in amplification body
Final concentration in system is selected within the scope of 0.1mM~2mM, MgCl2Final concentration in amplification system 1.5mM~
It is selected within the scope of 10mM, these changes and improvements all fall within the protetion scope of the claimed invention.It is claimed
Range is defined by the appending claims and its equivalent thereof.
Sequence table
<110>The Nanjing bio tech ltd Lan Yu
<120>Kit and its application method for detecting Respiratory Syncytial Virus(RSV) A, Type B
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>Respiratory Syncytial Virus(RSV) A types (respiratory syncytial virus)
<400> 1
ccattcgcat ctcgcgtt 18
<210> 2
<211> 18
<212> DNA
<213>Respiratory Syncytial Virus(RSV) A types (respiratory syncytial virus)
<400> 2
catcgcacgt caacaacg 18
<210> 3
<211> 23
<212> DNA
<213>Respiratory Syncytial Virus(RSV) A types (respiratory syncytial virus)
<400> 3
gtaggctaca tgtggaagaa tgc 23
<210> 4
<211> 18
<212> DNA
<213>Respiratory Syncytial Virus(RSV) Type B (respiratory syncytial virus)
<400> 4
gtacacaagg ctccacaa 18
<210> 5
<211> 19
<212> DNA
<213>Respiratory Syncytial Virus(RSV) Type B (respiratory syncytial virus)
<400> 5
cgtatgatgt gttgtagca 19
<210> 6
<211> 26
<212> DNA
<213>Respiratory Syncytial Virus(RSV) Type B (respiratory syncytial virus)
<400> 6
ctgtacaact gttcacacgt ctagaa 26
Claims (6)
1. a kind of kit for detecting Respiratory Syncytial Virus(RSV) A, Type B, which is characterized in that the kit is by containing detection examination
It the detection pipe of agent, positive quality control product and is formed without RNase water；Wherein, detection reagent single tube dispenses, and is dry powder, includes
The primer and TaqMan fluorescence probes of the specific and conserved sequence of Respiratory Syncytial Virus(RSV) A, Type B；
The primer sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.1 and SEQ ID NO.2；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.4 and SEQ ID NO.5；
The TaqMan probe sequence of the specific and conserved sequence is：
Respiratory Syncytial Virus(RSV) A types, SEQ ID NO.3；
Respiratory Syncytial Virus(RSV) Type B, SEQ ID NO.6.
2. the kit according to claim 1 for detecting Respiratory Syncytial Virus(RSV) A, Type B, which is characterized in that described
Detection reagent further includes having PCR buffer solutions, trehalose, bovine serum albumin(BSA), dATP, dUTP, dCTP, dGTP, MgCl2、
HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
3. the kit according to claim 1 for detecting Respiratory Syncytial Virus(RSV) A, Type B, which is characterized in that described
Final concentration of 100~1000nM of the primer in amplification system；The probe in amplification system final concentration of 50~
500nM；Final concentration of 1%~10%w/v of the trehalose in amplification system；The bovine serum albumin(BSA) is in amplification system
In final concentration of 0.1%~5%w/v；The HotStart Taq enzymes, the end of reverse transcriptase, UNG enzymes in amplification system are dense
Degree is 0.5U~5U；The final concentration of described dATP, dUTP, dCTP, dGTP in amplification system is 0.1mM~2mM；It is described
MgCl2Final concentration of 1.5mM~10mM in amplification system.
4. the kit according to claim 1 for detecting Respiratory Syncytial Virus(RSV) A, Type B, which is characterized in that described
Plasmid containing Respiratory Syncytial Virus(RSV) A types and Type B amplification gene sequence in positive quality control product.
5. being used to detect the kit of Respiratory Syncytial Virus(RSV) A, Type B according to claim 1-4 any one of them, feature exists
In the preparation method of the detection reagent is：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h or more is frozen under the conditions of being put into -80 DEG C；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
6. a kind of application method using claim 1-5 any one of them kits, this approach includes the following steps：
(1) DNA/RNA of sample extracted into template altogether, be separately added into different detections without RNase water, each 25 μ L of positive quality control product
Guan Zhong covers pipe lid, carries out fluorescent PCR detection；
(2) condition of pcr amplification reaction is：50 DEG C of 15~30min of reverse transcription；92~97 DEG C of 1~10min of pre-degeneration；92~97
DEG C denaturation 10~15s；58~62 DEG C of annealing extend 35~50s；40~45 cycles；
(3) availability deciding：
The Ct values that no RNase water detects are Undet or 40, and value≤35 Ct that positive quality control product detects, otherwise experiment regard
It is invalid；
(4) result interpretation：
Pattern detection pipe Ct values are Undet or 40, which is judged as that feminine gender, sample rna extraction fail, in sample to be tested
It is limited less than detection without RNA or content；
Value≤35 pattern detection pipe Ct, the sample results are judged as that corresponding pathogen is positive, pattern detection success；
Pattern detection pipe Ct values are 38~40, need reinspection primary, if Ct values are still 38~40, are judged as feminine gender；
According to the above interpretation method, fluorescence channel is corresponded in conjunction with the Respiratory Syncytial Virus(RSV) A types and Type B that pattern detection pipe detects
Ct values judge the testing result of two kinds of hypotypes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810458231.5A CN108384898B (en) | 2018-05-14 | 2018-05-14 | Kit for detecting respiratory syncytial virus A, B type and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810458231.5A CN108384898B (en) | 2018-05-14 | 2018-05-14 | Kit for detecting respiratory syncytial virus A, B type and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108384898A true CN108384898A (en) | 2018-08-10 |
| CN108384898B CN108384898B (en) | 2021-04-13 |
Family
ID=63070900
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810458231.5A Active CN108384898B (en) | 2018-05-14 | 2018-05-14 | Kit for detecting respiratory syncytial virus A, B type and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108384898B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831601A (en) * | 2020-12-30 | 2021-05-25 | 济南国益生物科技有限公司 | Primer probe set, kit and detection method for multiple detection of respiratory syncytial virus subtype based on fluorescent RMA method |
| CN112921126A (en) * | 2021-04-23 | 2021-06-08 | 宁波海尔施基因科技有限公司 | Human respiratory syncytial virus typing detection multiplex RT-qPCR kit, primer probe composition and use method thereof |
| CN114592096A (en) * | 2022-03-31 | 2022-06-07 | 长沙艾迪康医学检验实验室有限公司 | Primer for trace respiratory syncytial virus typing detection and application thereof |
| CN116219075A (en) * | 2023-03-15 | 2023-06-06 | 北京华瑞康源生物科技发展有限公司 | Primer pair capable of covering 45 types of genotype syncytial viruses, probe combination, detection method and kit |
| CN116676428A (en) * | 2023-07-27 | 2023-09-01 | 广东省林业科学研究院 | Fluorescent quantitative PCR primer and method for detecting type A and type B of pangolin respiratory syncytial virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1544656A (en) * | 2003-11-14 | 2004-11-10 | 武汉大学 | Fluorescence quantitative PCR reagent kit and detection method for human respiratory syncytial virus |
| CN104017901A (en) * | 2014-03-07 | 2014-09-03 | 邓瑛 | Method and kit for simultaneously detecting human type A and type B respiratory syncytial viruses and human metapneumoviruses |
| CN107603866A (en) * | 2017-08-07 | 2018-01-19 | 南京岚煜生物科技有限公司 | Detect the micro-fluidic chip kit and its application method of 10 kinds of respiratory tract infection pathogen |
-
2018
- 2018-05-14 CN CN201810458231.5A patent/CN108384898B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1544656A (en) * | 2003-11-14 | 2004-11-10 | 武汉大学 | Fluorescence quantitative PCR reagent kit and detection method for human respiratory syncytial virus |
| CN104017901A (en) * | 2014-03-07 | 2014-09-03 | 邓瑛 | Method and kit for simultaneously detecting human type A and type B respiratory syncytial viruses and human metapneumoviruses |
| CN107603866A (en) * | 2017-08-07 | 2018-01-19 | 南京岚煜生物科技有限公司 | Detect the micro-fluidic chip kit and its application method of 10 kinds of respiratory tract infection pathogen |
Non-Patent Citations (2)
| Title |
|---|
| HUH, HEE JAE等: "Performance Evaluation of Allplex Respiratory Panels 1, 2, and 3 for Detection of Respiratory Viruses and Influenza A Virus Subtypes", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| LOEFFELHOLZ, MJ等: "Comparison of the FilmArray Respiratory Panel and Prodesse Real-Time PCR Assays for Detection of Respiratory Pathogens", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831601A (en) * | 2020-12-30 | 2021-05-25 | 济南国益生物科技有限公司 | Primer probe set, kit and detection method for multiple detection of respiratory syncytial virus subtype based on fluorescent RMA method |
| CN112921126A (en) * | 2021-04-23 | 2021-06-08 | 宁波海尔施基因科技有限公司 | Human respiratory syncytial virus typing detection multiplex RT-qPCR kit, primer probe composition and use method thereof |
| CN114592096A (en) * | 2022-03-31 | 2022-06-07 | 长沙艾迪康医学检验实验室有限公司 | Primer for trace respiratory syncytial virus typing detection and application thereof |
| CN116219075A (en) * | 2023-03-15 | 2023-06-06 | 北京华瑞康源生物科技发展有限公司 | Primer pair capable of covering 45 types of genotype syncytial viruses, probe combination, detection method and kit |
| CN116219075B (en) * | 2023-03-15 | 2023-09-22 | 北京华瑞康源生物科技发展有限公司 | Primer pair capable of covering 45 types of genotype syncytial viruses, probe combination, detection method and kit |
| CN116676428A (en) * | 2023-07-27 | 2023-09-01 | 广东省林业科学研究院 | Fluorescent quantitative PCR primer and method for detecting type A and type B of pangolin respiratory syncytial virus |
| CN116676428B (en) * | 2023-07-27 | 2023-11-14 | 广东省林业科学研究院 | Fluorescent quantitative PCR primer for detecting pangolin respiratory syncytial virus A and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108384898B (en) | 2021-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Recent advances in the detection of respiratory virus infection in humans | |
| CN108384898A (en) | Kit and its application method for detecting Respiratory Syncytial Virus(RSV) A, Type B | |
| CN112280897A (en) | Respiratory tract infection pathogen nucleic acid joint detection kit | |
| CN108300808A (en) | A kind of African hog cholera virus fluorescent PCR detection kit, preparation method and application method | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN105734168A (en) | Multiplex PCR detection kit for nucleic acids of twelve respiratory viruses | |
| CN108546786A (en) | Kit and its application method for detecting rhinovirus, Respiratory Syncytial Virus(RSV) and parainfluenza virus | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| CN108486282A (en) | It is a kind of to be used to detect A type, the kit of influenza B virus and its application method | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| CN108411039A (en) | Kit and its application method based on micro-fluidic chip detection Respiratory Syncytial Virus(RSV) A, Type B | |
| CN108504775A (en) | A kind of detection A type, the kit of influenza B virus and its application method based on micro-fluidic chip | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| US20230374615A1 (en) | Compositions, kits, methods for detecting and identifying pathogens that cause respiratory tract infections and use thereof | |
| CN114317837B (en) | Multiplex PCR primer and probe combination for detecting pathogen and application thereof | |
| Coiras et al. | Oligonucleotide array for simultaneous detection of respiratory viruses using a reverse‐line blot hybridization assay | |
| CN108315488A (en) | Primer, RT-PCR detection kit and method, application for identifying avian infectious bronchitis virus strain type | |
| CN111808987A (en) | 2019 novel coronavirus S protein gene isothermal color development amplification primer group, screening kit and detection method | |
| CN108559790A (en) | The kit and its application method of three kinds of respiratory pathogens are detected based on micro-fluidic chip | |
| CN104419713A (en) | Loop-mediated isothermal amplification based human respiratory syncytial virus detection kit | |
| CN116479189A (en) | Whole-gene capturing method, primer combination and kit for syncytial virus subtype B | |
| CN101580883B (en) | Respiratory syncytial virus real-time fluorescence PCR detection kit | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN108676922A (en) | Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods | |
| CN115011734A (en) | Kit for detecting various respiratory viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |