CN109797126B - Recombinant bacterium for producing L-serine and construction method thereof - Google Patents

Abstract

The invention relates to a recombinant bacterium for producing L-serine, which has improved expression of a glycine cleavage system GCV compared with an original bacterium, wherein the original bacterium is a strain capable of accumulating L-serine. The invention also provides a construction method of the recombinant bacterium. Compared with a wild strain, the growth and glucose consumption capability of the recombinant strain provided by the invention are not obviously weakened, and the yield of L-serine is obviously improved.

Description

Recombinant bacterium for producing L-serine and construction method thereof

Technical Field

The invention relates to the field of microbial fermentation, in particular to a recombinant bacterium for producing L-serine and a construction method thereof.

Background

L-serine is a protein amino acid that can provide nutrition for the growth and development of the central nervous system of mammals and can maintain the normal growth and development of mammalian embryos. At the same time, it is a direct donor of one-carbon units (C1) required for the synthesis of many important intracellular biological substances, and occupies an important position in the whole metabolic network of the organism. L-serine can also be used as a synthesis precursor of various useful compounds, and has wide applications in the industrial fields of chemical industry, pharmacy, cosmetics, food and the like.

At present, the industrial production method of L-serine mainly comprises a protein hydrolysis method, an immobilized enzyme method, a chemical synthesis method and a precursor fermentation method. The protein hydrolysis extraction method has the defects of high raw material cost, low utilization rate, complex extraction process, great environmental pollution and the like. The immobilized enzyme method adopts the immobilized enzyme or immobilized cell technology and utilizes Serine Hydroxymethyltransferase (SHMT) to carry out reverse reaction to catalyze glycine and formaldehyde to generate L-serine. Due to strong catalytic specificity, mild reaction conditions and fewer byproducts, the SHMT is a main method for producing L-serine by enzyme method in various countries in the world. The product produced by the chemical synthesis method is DL-serine, and the L-serine is obtained by chemical resolution, so the production cost is high and the process is complex. The precursor fermentation method for producing L-serine mainly comprises the steps of adding glycine and methanol as precursors for synthesizing the L-serine, and synthesizing the L-serine through a reverse reaction catalyzed by SHMT, or catalyzing glycine and a C1 donor to synthesize the L-serine by utilizing a methylotrophic bacterial intracellular enzyme system. The precursor fermentation method has the disadvantages of high cost and low substrate conversion rate, so that the market demand is difficult to meet.

L-serine is positioned in the middle of amino acid metabolism, has extremely high metabolic transport speed and is very difficult to accumulate compared with other amino acids. Therefore, the industrial production of L-serine by direct microbial fermentation using inexpensive sugar-containing materials has not yet been achieved.

In the prior art, strains capable of accumulating L-serine are usually isolated and selected by traditional breeding methods such as screening directly from the environment, ultraviolet mutagenesis, screening of mutant strains by substrate analogs, and the like. At present, the species (strains) bred by the L-serine strain mainly comprise Brevibacterium flavum (Brevibacterium flavum), Pseudomonas putida (Pseudomonas putida), Corynebacterium glutamicum (Corynebacterium glutamicum) and the like. The L-serine producing strain is obtained by taking Brevibacterium flavum as a starting strain through a traditional mutagenesis and screening method at Xinjiang academy of agricultural sciences and Xinjiang university of agriculture. The method comprises the steps of obtaining a strain corynebacterium glutamicum SYPS-062 capable of directly fermenting and producing L-serine by utilizing a sugar raw material through a direct screening method, and establishing an optimal fermentation condition by analyzing the influence of the concentrations of substances such as different carbon sources, different nitrogen sources and different vitamins in a culture medium on the accumulation of the L-serine, so that the yield of the L-serine reaches 6.6 g/L. However, the L-serine strains obtained by traditional mutation breeding screening inevitably accumulate secondary mutation, so that the strains grow slowly, and the characteristics of low environmental tolerance, byproduct generation, easy degeneration of characters and the like of the strains limit the production efficiency of the L-serine.

In the prior art, L-serine engineering bacteria can also be constructed by system metabolic engineering modification. Peters-Wendisch et al can construct engineered bacteria capable of producing L-serine 9g/L by increasing the expression of the serACB gene in the serine synthesis pathway (Peters-Wendisch, P., Stolz, M., Etterich, H., Kennerknecht, N., Sahm, H., Eggeling, L.applied and Environmental Microbiology, 2005,71: 7139-. Zhang et al inhibit serine hydroxymethyltransferase activity by blocking folate metabolic pathway, block serine from decomposing to glycine, and only up to 8g/L acid production of L-serine (Zhang, X., Xu, G., Li, H., Dou, W., Xu, Z. applied Biochemistry Biotechnology,2014,173: 1607-. However, this method has a serious inhibition of the growth of the cells and a long fermentation time.

Therefore, there is a lack of producing bacteria for producing L-serine by direct fermentation with excellent performance.

Disclosure of Invention

The invention aims to provide a recombinant bacterium with excellent performance for producing L-serine and a construction method thereof.

To achieve the above object, a first aspect of the present invention provides a recombinant bacterium that produces L-serine, wherein the recombinant bacterium has an increased expression of the glycine cleavage system GCV as compared to an initial bacterium, which is a strain capable of accumulating L-serine.

According to the first aspect of the present invention, there is provided a recombinant bacterium having a decreased expression of serine O-acetyltransferase CysE as compared to the starting bacterium. Preferably, the inactivation of the gene encoding serine O-acetyltransferase cysE and/or the expression of the cysE gene in the recombinant bacterium is mediated by regulatory elements with low transcriptional or low expression activity. More preferably, the inactivation isKnocking out cysE gene in the recombinant bacteria, wherein the regulatory element with low transcription or low expression activity is P_homA promoter. Even more preferably, P_homThe nucleotide sequence of the promoter is shown as the 928-1057 nucleotide from the 5' end of SEQ ID NO. 2. According to a first aspect of the invention there is provided a recombinant bacterium having one or more copies of the gcv gene encoding a glycine cleavage system. Preferably, the gcv gene source is selected from one or more of Escherichia coli, Pseudomonas putida, Burkholderia Multivorans, Bacillus subtilis and Bacillus cereus. More preferably, the gcv gene is selected from one or more of a gcvT gene encoding aminomethyltransferase, a gcvH gene encoding a carrier protein, and a gcvP gene encoding glycine dehydrogenase. Still preferably, the nucleotide sequences of the gcvT gene and the gcvH gene are shown as SEQ ID No.3, and the nucleotide sequence of the gcvP gene is shown as SEQ ID No. 4.

According to the recombinant bacterium provided by the first aspect of the present invention, the expression of the gcv gene is mediated by a regulatory element with high transcriptional or high expression activity. Preferably, the regulatory element with high transcription or high expression activity is P₄₅A promoter. More preferably, said P₄₅The nucleotide sequence of the promoter is shown as 1005-1182 th nucleotide from 5' end in SEQ ID NO. 5.

According to the first aspect of the present invention, there is provided a recombinant bacterium having reduced expression of serine hydroxymethyltransferase GlyA, serine dehydratase SdaA, pyruvate carboxylase Pyc and/or aconitase Acn as compared to the starting bacterium. Preferably, the recombinant bacterium has the glyR gene of the GlyA transcription factor, the sdaA gene encoding serine dehydratase, the pyc gene encoding pyruvate carboxylase and/or the acn gene encoding aconitase inactivated and/or the expression of the glyA gene, sdaA gene, cysE gene, pyc gene and/or acn gene encoding GlyA mediated by regulatory elements with low transcription or low expression activity. More preferably, the inactivation is the knockout of the glyR gene, sdaA gene, pyc gene and/or acn gene in the recombinant bacterium, and the regulatory element with low transcription or low expression activity is P_homA promoter. Even more preferably, P_homThe nucleotide sequence of the promoter is shown as the 928-1057 nucleotide from the 5' end of SEQ ID NO. 2.

According to the first aspect of the present invention, there is provided a recombinant bacterium having an increased 3-phosphoglycerate dehydrogenase serA as compared with the starting bacterium^rThe phosphoserine transaminase serC, the phosphoserine phosphatase serB and/or the threonine efflux transporter ThrE, wherein serA^rserA released from feedback inhibition by serine. Preferably, the recombinant bacterium has one or more codes serA^rserA of^rGene, serC gene encoding serC, a copy of serB gene encoding serB and/or thrE gene encoding ThrE, and/or serA^rThe expression of the gene, serC gene, serB gene and/or thrE gene is mediated by regulatory elements with high transcriptional or high expression activity. More preferably, the regulatory element with high transcription or high expression activity is P_eftuPromoter and/or P_sodA promoter. Also preferably, said serA^rThe nucleotide sequence of the gene is shown as SEQ ID NO.13, the nucleotide sequence of the serC gene is shown as SEQ ID NO.11, the nucleotide sequence of the serB gene is shown as SEQ ID NO.12, the nucleotide sequence of the thrE gene is shown as the 332-th 1801-th nucleotide from the 5' end of SEQ ID NO.16, and the P gene_eftuThe nucleotide sequence of the promoter is shown as SEQ ID NO.23 from 629-828 th nucleotide at the 5' end, and the P is_sodThe nucleotide sequence of the promoter is shown as the 635-th and 826-th nucleotides from the 5' end of SEQ ID NO. 26.

According to the first aspect of the present invention, there is provided a recombinant bacterium, wherein the starting bacterium is a bacterium selected from the group consisting of Corynebacterium, Microbacterium, and Brevibacterium. Preferably, the bacterium of the genus Corynebacterium is selected from the group consisting of Corynebacterium glutamicum, Corynebacterium pekinense, Corynebacterium efficiens, Corynebacterium crenatum, Corynebacterium thermoaminogenes, Corynebacterium ammoniagenes Corynebacterium aminogenes, Corynebacterium lilium lividum, Corynebacterium calophyllum callosum and Corynebacterium lividum hercules, and is selected from the group consisting of a strain of Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium lactofermentum. More preferably, the initiating bacterium is wild-type Corynebacterium glutamicum ATCC 13032.

Although examples of regulatory elements with high transcription or high expression activity are given in the above-described different embodiments, none of the regulatory elements with high transcription or high expression activity is particularly limited in the present invention as long as they can function to enhance the expression of the gene to be promoted. Exemplary regulatory elements useful in the present invention include P-producing bacteria₄₅、P_eftu、P_sod、P_glyA、P_pck、P_pgkPromoters, and the like, but are not limited thereto.

Although examples of regulatory elements with low transcription or low expression activity are given in the above-described different embodiments, none of the regulatory elements with low transcription or low expression activity is particularly limited in the present invention as long as they function to reduce the expression of the gene to be promoted.

The second aspect of the present invention provides a method for constructing the recombinant bacterium of the first aspect, wherein the method comprises the following steps:

the expression of the GCV of the glycine cleavage system in the outbreak of bacteria, which is a strain capable of accumulating L-serine, is improved.

The construction method according to the second aspect of the present invention, wherein the expression of GCV in the development promoting bacteria is achieved by:

introducing GCV-encoding GCV gene into the strain,

increasing the copy number of the gcv gene in the starter bacterium, and/or

The regulatory element of the gcv gene in the outbreak is replaced by a regulatory element with high transcription or high expression activity.

Preferably, the gcv gene is selected from one or more of a gcvT gene encoding aminomethyltransferase, a gcvH gene encoding a carrier protein, and a gcvP gene encoding glycine dehydrogenase, and the regulatory element with high transcription or high expression activity is a P45 promoter.

More preferably, the nucleotide sequences of the gcvT gene and the gcvH gene are shown as SEQ ID NO.3, the nucleotide sequence of the gcvP gene is shown as SEQ ID NO.4, and the nucleotide sequence of the P45 promoter is shown as 1005-1182 th nucleotide from the 5' end of SEQ ID NO. 5.

The construction method according to the second aspect of the present invention, wherein the construction method comprises the steps of:

reducing the expression of serine hydroxymethyltransferase GlyA, serine dehydratase SdaA, serine O-acetyltransferase CysE, pyruvate carboxylase Pyc and/or aconitase Acn in the hairing bacteria.

Preferably, said reducing the expression of GlyA, SdaA, CysE, Pyc and/or Acn is achieved by:

inactivating the glyR gene encoding the GlyA transcription factor GlyR, the sdaA gene encoding SdaA, the cysE gene encoding CysE, the pyc gene encoding Pyc, and/or the Acn gene encoding Acn in the outbreak, and/or

The regulatory elements of the glyA gene, the sdaA gene, the cysE gene, the pyc gene and/or the acn gene are replaced by regulatory elements with low transcriptional or expression activity.

More preferably, the inactivation is a knock-out of the glyR gene, sdaA gene, cysE gene, pyc gene and/or acn gene in the outbreak, and the regulatory element of low transcription or low expression activity is P_homA promoter.

Still preferably, the knockout of the glyR gene, sdaA gene, cysE gene, pyc gene and/or acn gene is performed by introducing upstream and downstream homologous arm fragments of the glyR gene, sdaA gene, cysE gene, pyc gene and/or acn gene of the starting bacterium into the starting bacterium for homologous recombination.

Preferably, the nucleotide sequences of the upstream and downstream homologous arm fragments of the glyR gene of the trichogenous bacteria are shown in SEQ ID NO.1, and the nucleotide sequences of the upstream and downstream homologous arm fragments of the sdaA gene are shown in SEQ ID NO.8The nucleotide sequences of the upstream and downstream homologous arm segments of the cysE gene are shown in SEQ ID NO.10, the nucleotide sequences of the upstream and downstream homologous arm segments of the pyc gene are shown in SEQ ID NO.15, and P is_homThe nucleotide sequence of the promoter is shown as the 928-1057 nucleotide from the 5' end of SEQ ID NO. 2.

The construction method according to the second aspect of the present invention, wherein the construction method comprises the steps of:

3-phosphoglycerate dehydrogenase serA for increasing said growth bacteria^rThe phosphoserine transaminase serC, the phosphoserine phosphatase serB and/or the threonine efflux transporter ThrE, wherein serA^rserA released from feedback inhibition by serine.

Preferably, the improvement is achieved by:

introduction of the code serA into the outbreak^rserA of^rA gene, a serC gene encoding serC, a serB gene encoding serB and/or a thrE gene encoding ThrE,

increasing serA in said outgrowth^rCopy number of the gene, serC gene, serB gene and/or thrE gene, and/or

serA in the strain will grow^rThe regulatory elements of the gene, serC gene, serB gene and/or thrE gene are replaced with regulatory elements with high transcription or high expression activity.

More preferably, the regulatory element with high transcription or high expression activity is P_eftuPromoter and/or P_sodA promoter.

Also preferably, said serA^rThe nucleotide sequence of the gene is shown as SEQ ID NO.13, the nucleotide sequence of the serC gene is shown as SEQ ID NO.11, the nucleotide sequence of the serB gene is shown as SEQ ID NO.12, the nucleotide sequence of the thrE gene is shown as the 332-th 1801-th nucleotide from the 5' end of SEQ ID NO.16, and the P gene_eftuThe nucleotide sequence of the promoter is shown as SEQ ID NO.23 from 629-828 th nucleotide at the 5' end, and the P is_sodThe nucleotide sequence of the promoter is shown as the 635-th and 826-th nucleotides from the 5' end of SEQ ID NO. 26.

In the construction method of the present invention, the introduction of a certain gene or the increase in the copy number of a certain gene can be achieved by constructing a recombinant plasmid containing the gene and then introducing the recombinant plasmid into the starting bacterium, or by directly inserting a certain gene into an appropriate site on the chromosome of the starting bacterium.

In the construction method of the present invention, "inactivation" refers to the change of the corresponding modified object, thereby achieving a certain effect, including, but not limited to, site-directed mutagenesis, insertional inactivation and/or knock-out.

In a third aspect of the present invention, there is provided a method for producing L-serine, comprising the step of fermentatively culturing the recombinant bacterium of the first aspect.

The recombinant bacterium for producing L-serine has the L-serine production intensity of 0.01-1 g/L/h after 24 hours of fermentation, and the L-serine yield of 0.5-50 g/L after the fermentation is finished.

The invention firstly provides a combined transformation strategy for simultaneously expressing a glycine cracking system (gcvTHP) derived from escherichia coli on the basis of reducing the expression of serine hydroxymethyltransferase and improving the supply of intracellular active one-carbon units, solves the problem that the inhibition effect on the growth of thalli is reduced due to the reduction of the supply of one-carbon units caused by the reduction of the expression of serine hydroxymethyltransferase, can furthest reduce the decomposition of L-serine into glycine, simultaneously supplements one-carbon units necessary for the growth and metabolism of bacteria by the glycine cracking system, and obviously improves the yield of L-serine, thereby being practically used for producing the L-serine by bacterial fermentation.

Experiments prove that compared with the existing L-serine engineering bacteria and L-serine fermentation production method, the recombinant bacteria for producing L-serine with clear genetic background are constructed; by adopting a combined transformation strategy of reducing the expression of serine hydroxymethyl transferase in the starting strain and simultaneously expressing a glycine cracking system and improving the supply of intracellular active one-carbon units, the growth and glucose consumption capacity of the recombinant strain provided by the invention are not obviously weakened compared with that of a wild strain, and the yield of L-serine is obviously improved.

The recombinant strain for producing L-serine provided by the invention has short fermentation period, is easy to control the process and the cost, develops and proves a new method for improving the fermentation yield of the L-serine in practice, and observes the effect of improving the yield by superposition, thereby being used for producing the L-serine by bacterial fermentation in practice and being convenient to popularize and apply.

Drawings

FIG. 1 shows the expression of serA^rSchematic representation of the CB recombinant plasmid pWYE 1151;

FIG. 2 is an enzyme activity diagram of serine hydroxymethyltransferase GlyA of example 4;

FIG. 3 is a schematic diagram of an example 5 of detecting protein expression of GCV system by SDS-PAGE and Western blotting, wherein A is SDS-PAGE electrophoresis intracellular protein expression, B is Western blotting intracellular protein expression, lane 1 is CG220 engineering bacteria intracellular protein, lane 2 is CG050 engineering bacteria intracellular protein, and lane 3 is CG067 engineering bacteria intracellular protein;

FIG. 4 is a schematic diagram of recombinant plasmid pWYE1153 for expressing ThrE;

FIG. 5 is a graph showing a fermentation process of the L-serine engineered bacterium CG383 in a fermentation tank in accordance with example 10; and

FIG. 6 is a fermentation process graph of the fermentation tank of the L-serine engineering bacteria CG454 of example 10.

Detailed Description

The following detailed description of the present invention, taken in conjunction with the accompanying drawings and examples, is provided to enable the invention and its various aspects and advantages to be better understood. However, the specific embodiments and examples described below are for illustrative purposes only and are not limiting of the invention.

The strains and plasmids used or constructed in the present invention are shown in the following table.

TABLE strains and plasmids used or constructed according to the invention

Reference herein to "starter bacteria" (or also "chassis bacteria") is to the initial strain used in the genetic engineering strategy of the present invention. The strain can be a naturally-occurring strain, or a strain bred by means of mutagenesis, genetic engineering or the like.

The execution sequence of each step in the method mentioned herein is not limited to the sequence presented in the text unless otherwise specified, that is, the execution sequence of each step may be changed, and other steps may be inserted between two steps as required.

For the sake of understanding, the present invention will be described in detail below by way of specific examples. It is to be expressly understood that the description is illustrative only and is not intended as a definition of the limits of the invention. Many variations and modifications of the present invention will be apparent to those skilled in the art in light of the teachings of this specification.

In addition, the present invention incorporates publications which are intended to more clearly describe the invention, and which are incorporated herein by reference in their entirety as if reproduced in their entirety.

The present invention is further illustrated by the following examples. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art and commercially available instruments and reagents, and can be referred to in the molecular cloning laboratory manual (3 rd edition) (scientific publishers), microbiological experiments (4 th edition) (advanced education publishers) and manufacturer's instructions of the corresponding instruments and reagents. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Comparative example 1 construction of SER-3 and SER-8 recombinant bacteria

SER-3 and SER-8 recombinant bacteria were constructed according to the materials and methods described in the literature Metabolic engineering and flux analysis of Corynebacterium glutamicum for L-serine production (Lai, S., Zhang, Y., Liu, S., Liang, Y., Shang, X., Chai, X., Wen, T.Y., Science China Life Sciences,2012,55: 283-.

Wherein the SER-3 recombinant strain is a recombinant strain WT-delta sdaAsera obtained by deleting 398bp inside the sdaA gene in wild-type C.glutamcum ATCC13032, deleting the protein coded by the serA gene from amino acid 197 to the tail end and deleting the glyR gene^rΔ glyR; the SER-8 recombinant bacterium is prepared from recombinant plasmid pXMJ19-serA^rRecombinant strain SER-3/pWYE1118 obtained by introducing SER-3 recombinant strain into pgk.

EXAMPLE 1 acquisition of L-serine Chassis engineering bacteria

According to previous studies of the inventors, the example of the present invention performed the functions of blocking serine catabolism and releasing the feedback inhibition of serine on the key enzyme serA on the wild type corynebacterium glutamicum ATCC13032, so as to obtain the Chassis bacteria for implementing the above-mentioned multi-target modification of the present invention.

First, the sdaA gene encoding serine hydratase was knocked out (SEQ ID NO.17), blocking catabolism of serine to pyruvate. Next, the serA gene (SEQ ID NO.18) encoding 3-phosphoglycerate dehydrogenase on the chromosome was subjected to deletion-end mutation (SEQ ID NO.13) to release the feedback inhibition of serA by serine.

Blocking of the L-serine cleavage pathway in Corynebacterium glutamicum wild-type ATCC13032

Primers were designed based on the sdaA gene of Corynebacterium glutamicum ATCC13032 in Genbank and the sequences upstream and downstream thereof, respectively.

PCR amplification of the upstream homology arm of the 439bp sdaA gene was performed using Corynebacterium glutamicum ATCC13032 genomic DNA as a template and P1 and P2 as primers; the 481bp downstream homology arm of the sdaA gene is amplified by using P3 and P4 as primers. And then, amplifying by using the purified PCR product as a template and P1 and P4 as primers by using an overlap extension PCR (SOE) technology to obtain a 920bp PCR product which is a fragment (SEQ ID NO.8) of the upstream and downstream homologous arms of the sdaA gene.

Wherein, the 1 st to 439 th nucleotides from the 5 'end of SEQ ID NO.8 are the upstream homology arm of the sdaA gene, and the 440 st and 920 th nucleotides from the 5' end of SEQ ID NO.8 are the downstream homology arm of the sdaA gene.

The 920bp PCR product was digested simultaneously with EcoRI and HindIII, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested simultaneously. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P1 and P4 as primers to obtain 920bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out EcoRI and HindIII double enzyme digestion identification on the plasmids to obtain 920bp as a positive clone.

The positive plasmid is sent for sequencing, and as a result, the plasmid is a recombinant plasmid obtained by inserting the nucleotide shown by SEQ ID NO.8 in the sequence table into a vector pK18mobsacB and is named as pK18 mobsacB-delta sdaA.

The sequences of the primers used above are as follows:

P1 GCGGAATTCATCGGTATCGGACCATCATC(EcoRI)

P2 CTGCCTCTGGATGAATGGTT

P3 AACCATTCATCCAGAGGCAGGCGGGATTTTTTGACAGGTT

P4 GGGTAAGCTTAACACTCCGTCATCGACAC(HindIII)

P5 ATGGCTATCAGTGTTGTTGA

P6 TCGCCAAGCAAGACAAAATC

the homologous recombinant plasmid pK18 mobsacB-delta sdaA with correct sequence determination is electrically transformed into Corynebacterium glutamicum ATCC13032, colonies with the recombinant plasmid integrated onto the chromosome are obtained by kanamycin resistance forward screening, and positive colonies with two homologous recombinations are obtained by sucrose lethal reverse screening. The positive colonies were identified by PCR amplification using P5 and P6 as primers to obtain 1019bp recombinant strain designated Corynebacterium glutamicum CG007(WT- Δ sdaA).

The recombinant strain extracts genomic DNA for sequencing, and the result proves that 398bp internal deletion of the sdaA gene in Corynebacterium glutamicum wild type ATCC13032 and the construction of Corynebacterium glutamicum CG007 (WT-delta sdaA) are successful.

Secondly, mutation of gene serA on chromosome

The mutation of the chromosome serA gene is realized by deleting the protein coded by the serA gene from the 197 th amino acid to the tail end by a homologous recombination method and removing the C tail end to realize the effect of releasing the feedback inhibition and regulation of the metabolic end product serine on the 3-phosphoglycerate dehydrogenase coded by the serA gene.

The method comprises the following specific steps:

the sequence 1045bp of the serA gene is amplified by PCR by taking the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P7 and P8 as primers, and the downstream homologous arm 489bp of the serA gene is amplified by taking P9 and P10 as primers. And then amplifying by overlapping extension PCR (SOE) technology by using the purified PCR product as a template and P7 and P10 as primers to obtain 1534bp of a segment (SEQ ID NO.9) containing the serA gene and a downstream homologous arm thereof.

Wherein, the 1 st 1045 th nucleotide from the 5 'end of SEQ ID NO.9 is serA gene, and the 1046 th and 1534 th nucleotides from the 5' end of SEQ ID NO.9 is a fragment of the downstream homology arm of serA gene.

And respectively carrying out double enzyme digestion on the purified and recovered PCR product by BamH I and SphI, and then respectively connecting the purified and recovered PCR product with a knockout vector pK18mobsacB subjected to the same double enzyme digestion treatment. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P7 and P10 as primers to obtain a positive transformant taking 1534bp as the recombinant plasmid, extracting the plasmid from the correctly identified transformant, and carrying out BamH I and SphI double-enzyme digestion identification on the plasmid to obtain 1534bp as the recombinant plasmid.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.9 in a sequence table into a vector pK18mobsacB, and is named as pK18mobsacB-serA^r。

The sequences of the primers used above are as follows:

P7 CGGGATCCGCCTGTTGTAGACGGACA(BamHI)

P8 TTAAGCCAGATCCATCCACACAG

P9 CTGTGTGGATGGATCTGGCTTAA GGCGGTTTTCGCTCTTTT

P10 ACATGCATGCCCGGGTAAAGTGCATGAAAC(SphI)

P11 TGTTTCTAGTCGCACGCCA

P12 AATGTTGAGCATTGCGCC

the homologous recombinant plasmid pK18mobsacB-serA with correct sequence determination^rElectrotransformation is carried out to Corynebacterium glutamicum CG007, a colony obtained by integrating a recombinant plasmid on a chromosome through kanamycin resistance forward screening is obtained, and a positive bacterium subjected to two times of homologous recombination is obtained through sucrose lethal reverse screening. Carrying out PCR amplification identification on the positive bacterial colony by taking P11 and P12 as primers to obtain 1591bp recombinant bacteria which are named as Corynebacterium glutamicum CG019 (WT-delta sdaAsera A)^r)。

The recombinant strain extracts genomic DNA and performs sequencing, and the result proves that the protein coded by the serA gene in the Corynebacterium glutamicum wild type ATCC13032 is successfully deleted from amino acid 197 to the tail end, and the Corynebacterium glutamicum CG019 (WT-delta sdaAsera)^r) The construction was successful.

Example 2 knockout of the Gene cysE on chromosome, recombinant bacterium CG029 was obtained

Serine is converted to O-acetyl-serine under the catalysis of the serine acetyltransferase encoded by the cysE gene, which further conversion can lead directly to cysteine. Deletion of the cysE gene encoding serine acetyltransferase (SEQ ID NO.19) blocked the participation of serine in cysteine synthesis.

Primers were designed based on the cysE gene of Corynebacterium glutamicum ATCC13032 and the upstream and downstream sequences thereof, respectively, in Genbank.

PCR amplification is carried out on the upstream homology arm of 262bp cysE gene by taking Corynebacterium glutamicum ATCC13032 genome DNA as a template and P13 and P14 as primers; the downstream homology arms of the 331bp cysE gene were amplified using P15 and P16 as primers. And then, the purified PCR product is used as a template, P13 and P16 are used as primers, and the PCR product of 593bp is obtained by adopting overlap extension PCR (SOE) amplification and is a fragment (SEQ ID NO.10) of the upstream and downstream homologous arms of the cysE gene.

Wherein, the 1 st to 262 th nucleotides from the 5 'end of the SEQ ID NO.10 are the upstream homology arm of the cysE gene, and the 263 rd and 593 rd nucleotides from the 5' end of the SEQ ID NO.10 are the downstream homology arm of the cysE gene.

The 593bp PCR product was digested with BamHI and HindIII, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested with BamHI and HindIII. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P13 and P16 as primers to obtain 593bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out BamHI and HindIII double enzyme digestion identification on the plasmids to obtain 593bp as a positive clone.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is a recombinant plasmid obtained by inserting the nucleotide shown by SEQ ID NO.10 in the sequence table into a vector pK18mobsacB and is named as pK18 mobsacB-delta cysE.

The sequences of the primers used above are as follows:

P13 CGGGATCCAGCGACTGTTAACCACTCAAGCTC(BamHI)

P14 TTTCTAAATCGCCTCGGGCTGCT

P15 AGCAGCCCGAGGCGATTTAGAAAATCTTAGGTCCCATCACCATCGG

P16 CCCAAGCTTCTAAAGAACTAGCTGGCACAGGG(HindIII)

P17 CGCTACGTCTCCACCGTTCTTTAC

P18 CTCTGCAGTCGCTGGCTTCATTCA

the homologous recombinant plasmid pK18 mobsacB-delta cysE with correct sequence determination is electrically transformed into Corynebacterium glutamicum CG019, a colony with the recombinant plasmid integrated on a chromosome is obtained by forward screening of kanamycin resistance, and a positive colony with two homologous recombinations is obtained by reverse screening of sucrose lethal. Carrying out PCR amplification identification on the positive bacterial colony by taking P17 and P18 as primers to obtain 690bp recombinant bacteria named as Corynebacterium glutamicum CG029 (WT-delta sdaAsera A)^rΔcysE)。

The genomic DNA extracted from the recombinant strain was sequenced, and it was confirmed that the cysE gene in Corynebacterium glutamicum wild-type ATCC13032 had been successfully deleted, Corynebacterium glutamicum CG029(WT- Δ sdaAsera)^rΔ cysE) was successfully constructed.

Example 3 construction of plasmid-containing L-serine recombinant bacterium CG381

In this embodiment, in practiceserA was further overexpressed on the basis of CG029 obtained in example 1^rThe gene, and the serC gene and the serB gene are simultaneously over-expressed to increase the metabolic flux of a serine synthesis pathway, then a glyR gene for coding a transcription activator is knocked out, the glyR is the activator of the glyA gene, the transcription expression level of the glyA gene is weakened by knocking out the glyR, and the glyR and the serA gene are over-expressed^rAnd transforming and combining the CB to obtain the recombinant engineering bacterium CG 381.

One, containing serA^rConstruction of recombinant plasmid pWYE1151 of three genes of serCserB

The serC gene was PCR-amplified using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P19 and P20 as primers. The PCR product was digested simultaneously with Xba I and Not I, and ligated to the Corynebacterium glutamicum-E.coli shuttle expression plasmid pXMJ19 which had been digested simultaneously. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P19 and P20 as primers to obtain 1144bp of positive transformants, extracting plasmids from the correctly identified transformants, carrying out XbaI and NotI double enzyme digestion identification on the plasmids to obtain 1144bp of positive transformants, and naming the transformants as recombinant plasmids pXMJ 19-serC. pXMJ19-serC was further sequenced and the plasmid was a recombinant plasmid obtained by inserting a serC fragment into the plasmid pXMJ 19.

The serB gene was amplified by PCR using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P21 and P22 as primers. The PCR product was digested with NotI and SmaI, and ligated to pXMJ19-serC digested with the same enzymes. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P21 and P22 as primers to obtain 1332bp of positive transformants, extracting plasmids of the correctly identified transformants, carrying out NotI and SmaI double-enzyme digestion identification on the plasmids to obtain 1332bp of positive transformants, and naming the transformants as recombinant plasmids pXMJ 19-serCB. pXMJ19-serCB was further sequenced, and this plasmid was a recombinant plasmid obtained by inserting a serB fragment into the recombinant plasmid pXMJ 19-serC.

PCR amplification of serA Using genomic DNA of Corynebacterium glutamicum ATCC13032 as template and P23 and P24 as primers^rA gene. The PCR product was digested simultaneously with SmaI and EcoRI, and ligated to pXMJ19-serCB digested simultaneously with the same restriction enzyme. Transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by adopting P23 and P24 as primers to obtain 1016bp positive transformants, extracting plasmids of the transformants with correct identification, carrying out SmaI and EcoRI double enzyme digestion identification on the plasmids to obtain 1016bp positive transformants, and obtaining a recombinant plasmid pXMJ19-serCB-serA^rNamed pWYE1151 (see FIG. 1).

Wherein, 14 th to 1144 th nucleotides from 5 ' end of SEQ ID NO.11 are serC, 16 th to 1318 th nucleotides from 5 ' end of SEQ ID NO.12 are serB, and 15 th to 1017 th nucleotides from 5 ' end of SEQ ID NO.13 are serA^r。

pXMJ19-serA^r-serCB^rThe plasmid was serA by further sequencing^rThe fragment was inserted into SmaI and EcoRI of plasmid pXMJ 19-serCB.

P19 GCTCTAGAAAAGGAGGA AGACATGACCGACTTCCCCACC(XbaI)

P20 GCGGCCGCTATTACTTCCTTGCAAAACCGCCATC(NotI)

P21 GCGGCCGCAAAGGAGGA GTTGCCATGACTGAACTCATCCAG(NotI)

P22 TCCCCCGGG TCGAGAAGCGAATCTTTAGGCATTG(SmaI)

P23 TCCCCCGGGAAAGGAGGA AACTT GTGAGCCAGAATGGCCGTC(SmaI)

P24 GCGGAATTC TTA AGCCAGATCCATCCACACAGC(EcoRI)

II, construction of recombinant bacteria CG039 and CG381 of L-serine

Primers were designed based on the upstream and downstream sequences of the glyR transcriptional regulator of Corynebacterium glutamicum ATCC13032, respectively, in Genbank.

Using Corynebacterium glutamicum ATCC13032 genome DNA as a template and P25 and P26 as primers, and carrying out PCR amplification on 532bp glyR transcription regulatory factor gene upstream homology arms; the downstream homology arm of the 513bp glyR transcription regulatory factor is amplified by taking P27 and P28 as primers. And then, amplifying by using the purified PCR product as a template and P25 and P28 as primers by using an overlap extension PCR (SOE) technology to obtain a 1045bp PCR product which is a fragment (SEQ ID NO.1) of the upstream and downstream homology arms of the glyR transcription regulatory factor.

Wherein, the 1 st to 532 th nucleotides from the 5 'end of the SEQ ID NO.1 are the upstream homologous arms of the glyR transcription regulatory factor, and the 533 rd and 1045 th nucleotides from the 5' end of the SEQ ID NO.1 are the downstream homologous arms of the glyR gene.

The 1045bp PCR product was digested with BamHI and HindIII, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested with BamHI and HindIII. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P25 and P28 as primers to obtain 1045bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out BamHI and HindIII double enzyme digestion identification on the plasmids to obtain 1045bp as a positive clone.

The positive plasmid is sent for sequencing, and as a result, the plasmid is a recombinant plasmid obtained by inserting the nucleotide shown by SEQ ID NO.1 in the sequence table into a vector pK18mobsacB, and is named as pK18 mobsacB-delta glyR.

The sequences of the primers used above are as follows:

P25 CAGGATCCACATTTTGAGCCAGCGCT(BamHI)

P26 TGTTTAAGTTTAGTGGATGGG GATATCGGTTGCTGAAATT

P27 CCCATCCACTAAACTTAAACA TGGGATAACGGAGGTCAT

P28 TCAAGCTTATATTCAACCCTACTCAA(HindIII)

P29 TTCCGGGCAGCTTTTTGTAGTTCC

P30 TCGACGCCGGTGTTGCAGTAAAGA

electrically transforming the homologous recombinant plasmid pK18 mobsacB-delta glyR with correct sequence determination into Corynebacterium glutamicum CG029, and forward screening by kanamycin resistance to obtain recombinant plasmidColonies which are synthesized on the chromosome are subjected to sucrose lethal reverse screening to obtain colonies which undergo two times of homologous recombination. Carrying out PCR amplification identification on the positive bacterial colony by taking P29 and P30 as primers to obtain 1578bp recombinant bacteria named as Corynebacterium glutamicum CG039 (WT-delta sdaA delta cysEserA)^rΔglyR)。

The recombinant strain extracts genomic DNA for sequencing, and the result proves that the glyR transcriptional regulatory factor in the corynebacterium glutamicum wild type ATCC13032 is successfully deleted, and the corynebacterium glutamicum CG039 (WT-delta sdaA delta cysEserA)^rΔ glyR) was successfully constructed.

The plasmid pWYE1151 is transformed into the Chassis engineering bacteria CG039 constructed above, and the identification of the correctly identified transformant extracted plasmid further confirms that the over-expression plasmid is successfully transformed into the engineering bacteria, namely L-serine engineering bacteria CG381 (WT-delta sdaA delta cysEserA)^rΔ glyR/pWYE1151) was successfully constructed.

Example 4 construction of engineered L-serine bacteria CG067 and CG188 for attenuating serine hydroxymethyltransferase Activity

The glyA gene encodes serine hydroxymethyltransferase (SEQ ID NO.20), and on the basis of the engineering bacterium CG039 obtained above, the self promoter of the glyA gene of the serine hydroxymethyltransferase is replaced by a weak promoter P_hom(nucleotide No. 928-1058 from 5' end of SEQ ID NO.2), engineering bacteria CG067 and over-expression serA were constructed^rAnd transforming and combining the CB to obtain the recombinant engineering bacterium CG 188.

Construction of recombinant bacteria CG067 and CG188 of L-serine

Primers were designed based on the glyA gene sequence of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream sequence, respectively.

PCR amplification of 927bp glyA upstream homology arm is carried out by taking Corynebacterium glutamicum ATCC13032 genome DNA as a template and P31 and P32 as primers; amplifying 130bp P by using P33 and P34 as primers_homPromoter sequences (Zhang, Y., Shang, X., Lai, S., Zhang, G., Liang, Y., Wen, T.,2012.Development and application of an array-expressed expression construct and promoter uptake in Corynebacterium glutamicum microorganism.78, 5831-5838.); to purify the aboveThe PCR product is used as a template, P31 and P34 are used as primers, and the overlapping extension PCR technology (SOE) is adopted for amplification to obtain a 1057bp PCR product which is a fragment of the upstream homologous arm of the glyA gene and P_homA promoter sequence fragment. Using Corynebacterium glutamicum ATCC13032 genome DNA as template, P35 and P36 as primer, PCR amplifying 919bp glyA gene partial sequence, using purified PCR product as template, using P31 and P36 as primer, adopting overlap extension PCR technology (SOE) amplification to obtain 1976bp PCR product, said PCR product being analyzed by sequencing, and being fragment of glyA gene upstream homologous arm and P_homA promoter sequence fragment and a glyA gene partial sequence (SEQ ID NO. 2).

Wherein the 1 st to 927 th nucleotides from the 5 'end of SEQ ID NO.2 are the upstream homologous arms of the glyA transcription regulatory factor, and the 928 rd and 1058 th nucleotides from the 5' end of SEQ ID NO.2 are P_homThe promoter sequence, the 1059-1976 th nucleotide from the 5' end of SEQ ID NO.2 is the partial sequence of the glyA gene.

The 1976bp PCR product was digested simultaneously with HindIII and XbaI and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested simultaneously. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P31 and P36 as primers to obtain 1976bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out BamHI and HindIII double enzyme digestion identification on the plasmids to obtain 1976bp as a positive clone.

The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.2 in a sequence table into a vector pK18mobsacB and named as pK18mobsacB-P_hom-glyA。

The sequences of the primers used above are as follows:

P31 CCCAAGCTTCATCCTCACCCGTTCCAC(HindIII)

P32 AGTTTTCAACGG GTGAAACCTTCCCCACGC

P33 GGAAGGTTTCAC CCGTTGAAAACTAAAAAGCTGG

P34 TTGTCCTCCTTT TACTTTGTTTCGGCCACCC

P35 CGAAACAAAGTA AAAGGAGGA CAACCATGACCGATGCCCACCAAG

P36 GCTCTAGAATGCGAGCACCCTCCAACG(XbaI)

P37 AGCAAAAATGAACAGCTTGG

P38 AACCTCAGTGAATGCAGGAA

the homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_homThe glyA is electrically transformed into Corynebacterium glutamicum CG039, colonies with recombinant plasmids integrated on chromosomes are obtained by kanamycin resistance forward screening, and positive colonies with two homologous recombination are obtained by sucrose lethal reverse screening. Carrying out PCR amplification identification on the positive bacterial colony by taking P37 and P38 as primers to obtain 1578bp recombinant bacteria named as Corynebacterium glutamicum CG067 (WT-delta sdaA delta cysEserA)^rΔglyR P_hom-glyA)。

The recombinant strain extracts genomic DNA for sequencing, and the result proves that the glyR transcription regulatory factor in the corynebacterium glutamicum wild type ATCC13032 is successfully deleted, and the corynebacterium glutamicum CG067 (WT-delta sdaA delta cysEserA)^rΔglyR P_homglyA) was successfully constructed.

The recombinant plasmid pWYE1151 was electrotransformed into Corynebacterium glutamicum CG067(WT- Δ sdaA Δ cysEserA)^rΔglyR P_hom-glyA) to obtain recombinant strain CG188 of L-serine.

Secondly, determining specific enzyme activity of serine hydroxymethyl transferase (SHMT) in engineering bacteria

The reaction was measured as follows (0.5 mL): 50mM D, L-beta-phenylserine (D, L-beta-phenylserine), 50. mu.M pyridoxal phosphate, 1mM Na₂EDTA,25mM sodium sulfate, 50mM Hepes buffer (pH 7.5), appropriate amount of cell lysate. The reaction was carried out at 30 ℃ for 5 min. The amount of benzaldehyde (benzaldehyde) produced was reflected by detecting the change in absorbance at 279 nm. The enzyme activity unit (U) is defined as the amount of enzyme required to produce 1nmol of benzaldehyde per minute.

As shown in FIG. 2, the specific activity of SHMT in the wild type strain ATCC13032 (i.e., WT) at the logarithmic phase was 43.47. + -. 3.19nmol min^-1mg^-1While the specific activity of SHMT in the stationary phase is increased to 56.34 +/-3.12nmol min^-1mg^-1(ii) a In engineering bacteria CG039 for activating transcription factor knockout of glyR, the specific activity of SHMT in logarithmic phase is 26.48 +/-1.43 nmol min^-1mg^-1While the specific activity of SHMT in the stationary phase is 27.11 + -1.01 nmol min^-1mg^-1The specific activity is reduced by 39.0 percent and 51.8 percent in a logarithmic phase and a stationary phase respectively; further replacement of the promoter of the glyA gene itself with P_homIn the engineering bacterium CG067 of the promoter, the specific activity of SHMT in the logarithmic phase is 10.07 +/-0.37 nmol min^-1mg^-1While the specific activity of SHMT in the stationary phase is 14.87 +/-1.69 nmol min^-1mg^-1The specific activity is reduced by 76.9% and 73.6% in the logarithmic phase and the stationary phase respectively, which shows that the two modification strategies can obviously reduce the specific activity of the intracellular SHMT enzyme.

Example 5 construction of L-serine high-yield recombinant bacteria CG220, CG383 and CG050 incorporating Glycine cleavage System

The gcvTHP gene encodes a glycine cleavage system, in which the gcvT gene encodes aminomethyltransferase, the gcvH gene encodes a carrier protein (SEQ ID NO.3), and the gcvP gene encodes glycine dehydrogenase (SEQ ID NO. 4). On the basis of the constructed engineering bacteria CG067, P is respectively recombined by homologous recombination₄₅-gcvTH and P₄₅Integration of gcvP into the site of glyR knock-out, respectively, construction of engineered CG220, and overexpression of serA^rAnd transforming and combining the CB to obtain the recombinant engineering bacterium CG 383. On the basis of the constructed engineering bacterium CG039, a plasmid for expressing a gcvTHP system is introduced to obtain a recombinant engineering bacterium CG 050.

First, glycine cracking system is integrated to engineering bacteria CG067 chromosome

Primers were designed to amplify the open reading frames of the gcvTH gene and the gcvP gene, respectively, based on the sequence of the gcvTHP operon of E.coli W3110 in Genbank.

The gcvTH gene and the gcvP gene of an escherichia coli glycine cleavage system are respectively linked with a strong promoter P of corynebacterium glutamicum₄₅Fusion (see Zhang, Y., Shang, X., Lai, S., Zhang, G., Liang, Y., Wen, T.,2012.Development and application of an antibody expression construct by influencing expression index i. fusion methodn Corynebacterium glutamicum. apple Environ Microbiol.78,5831-5838.) is connected with a traceless knockout vector pK18mobsacB to respectively construct two recombinant vectors pK18mobsacB-up-P₄₅-gcvTH-down and pK18mobsacB-gcvTH-P₄₅-gcvP-down, P will be generated by two rounds of recombination experiments₄₅-gcvTH and P₄₅the-gcvP is sequentially integrated into a delta glyR locus to construct genetically engineered bacterium CG220(WT delta sdaAsera A)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyA)。

II, recombinant plasmid pK18mobsacB-Up-P₄₅Construction of-gcvTH-Down

PCR amplification is carried out on 1005bp delta glyR upstream homology arms by taking Corynebacterium glutamicum ATCC13032 genome DNA as a template and P41 and P42 as primers; amplifying 177bp P45 promoter sequence by taking P43 and P44 as primers; and (3) amplifying by using the purified PCR product as a template and P41 and P44 as primers by adopting an overlap extension PCR (SOE) technology to obtain a 1182bp PCR product which is a fragment of an upstream homology arm of the delta glyR gene and a P45 promoter sequence fragment (SEQ ID NO. 5).

Wherein the 1 st to 1005 st nucleotides from the 5 'end of SEQ ID NO.5 are the upstream homology arm of delta glyR, and the 1006 th and 1182 nd nucleotides from the 5' end of SEQ ID NO.5 are P₄₅A promoter sequence.

The 1182bp PCR product was digested simultaneously with NheI and HindIII and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested simultaneously. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P41 and P44 as primers to obtain 1182bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out NheI and HindIII double enzyme digestion identification on the plasmids to obtain 1182bp as a positive clone.

The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.5 in a sequence table into a vector pK18mobsacB and is named as pK18mobsacB-Up-P₄₅。

With large intestine rodUsing the genome DNA of the strain W3110 as a template and P39 and P40 as primers, and carrying out PCR amplification on 1624bp gcvTH gene sequence (SEQ ID NO. 3); the 1624bp PCR product was subjected to double digestion with HindIII and BamHI, and then subjected to double digestion with the homologous recombinant vector pK18mobsacB-Up-P₄₅And (4) connecting. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P39 and P40 as primers to obtain 1624bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out HindIII and BamHI double enzyme digestion identification on the plasmids to obtain 1624bp as a positive clone.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is obtained by inserting nucleotide shown as SEQ ID NO.3 in a sequence table into a vector pK18mobsacB-Up-P₄₅The resulting recombinant plasmid was named pK18mobsacB-Up-P₄₅-gcvTH。

Using Corynebacterium glutamicum ATCC13032 genome DNA as a template and P45 and P46 as primers, and carrying out PCR amplification on a delta glyR downstream homology arm sequence (SEQ ID NO. 6); the PCR product is subjected to double enzyme digestion by BamHI and EcoRI, and then is subjected to double enzyme digestion treatment with the homologous recombinant vector pK18mobsacB-Up-P₄₅-a gcvTH connection. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by adopting P45 and P46 as primers to obtain 649bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out BamHI and EcoRI double enzyme digestion identification on the plasmids to obtain 649bp as a positive clone.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is obtained by inserting nucleotide shown as SEQ ID NO.6 in a sequence table into a vector pK18mobsacB-Up-P₄₅The recombinant plasmid obtained in-gcvTH, named pK18mobsacB-Up-P₄₅-gcvTH-down。

Thirdly, recombinant plasmid pK18mobsacB-gcvTH-P₄₅Construction of-gcvP-down

PCR amplifying 544bp gcvTH partial sequence by taking Escherichia coli W3110 genome DNA as a template and P49 and P50 as primers; with P51 andp52 as primer to amplify 177bp P₄₅A promoter sequence; using the purified PCR product as a template, using P49 and P52 as primers, and adopting an overlap extension PCR (SOE) technology to amplify to obtain a PCR product of 721bp, which is a gcvTH partial sequence and P₄₅A promoter sequence fragment (SEQ ID NO. 7).

Wherein the 1 st to 544 th nucleotides from the 5 'end of SEQ ID NO.7 are gcvTH partial sequence, and the 545 nd and 721 th nucleotides from the 5' end of SEQ ID NO.7 are P₄₅A promoter sequence.

The 721bp PCR product was digested simultaneously with NheI and HindIII, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested simultaneously. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P49 and P52 as primers to obtain a 721bp positive transformant, extracting plasmids from the correctly identified transformants, and carrying out NheI and HindIII double enzyme digestion identification on the plasmids to obtain 721bp positive clone.

The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.7 in a sequence table into a vector pK18mobsacB and is named as pK18mobsacB-gcvTH-P₄₅。

Taking Escherichia coli W3110 genome DNA as a template and P47 and P48 as primers, and carrying out PCR amplification on a 2896bp gcvP gene sequence; the 2896bp PCR product is subjected to double enzyme digestion by HindIII and BamHI, and then is subjected to double enzyme digestion treatment with the homologous recombinant vector pK18mobsacB-gcvTH-P₄₅And (4) connecting. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P47 and P48 as primers to obtain 2896bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out HindIII and BamHI double enzyme digestion identification on the plasmids to obtain 2896bp as a positive clone.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is shown as SEQ ID NO.4 in a sequence tableNucleotide insertion vector pK18mobsacB-gcvTH-P₄₅The resulting recombinant plasmid was named pK18mobsacB-gcvTH-P₄₅-gcvP。

Taking the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P45 and P46 as primers, and carrying out PCR amplification on a sequence of a 649bp delta glyR downstream homology arm; the 649bp PCR product is subjected to double enzyme digestion by BamHI and EcoRI, and then is subjected to double enzyme digestion treatment with the homologous recombinant vector pK18mobsacB-gcvTH-P₄₅-a gcvP connection. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by adopting P45 and P46 as primers to obtain 649bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out BamHI and EcoRI double enzyme digestion identification on the plasmids to obtain 649bp as a positive clone.

The positive plasmid is sent to be sequenced, and as a result, the plasmid is obtained by inserting nucleotide shown as SEQ ID NO.6 in a sequence table into a vector pK18mobsacB-gcvTH-P₄₅The recombinant plasmid obtained in-gcvP, designated pK18mobsacB-gcvTH-P₄₅-gcvP-down。

The sequences of the primers used above are as follows:

P39 CCCAAGCTTAAAGGAGGA CAAGATGGCACAACAGAC(HindIII)

P40 CGGGATCC AAACGTGCAGTGAATTGTGA(BamHI)

P41 CTAGCTAGC ATCAACGCAG AAACCCG(NheI)

P42 AGAAAAACAC GATACGGTTGCTGAAATT

P43 CAACCGTATC GTGTTTTTCTGTGATCCTC

P44 GATAAGCTT GCTTTTAAAACCATGCA(HindIII)

P45 CGGGATCC GTCGGGGCCTTTCACTG(BamHI)

P46 ACAGAATTC GCCTGGCATTAGCGTTTAG(EcoRI)

P47 GATAAGCTTAAAGGAGGA ACCATCGCTCATGACACA(HindIII)

P48 CGGGATCC GAATTACTGGTATTCGCTAATCGGT(BamHI)

P49 CTAGCTAGC TGTGCGTAACGGCAAAGC(NheI)

P50 AGAAAAACAC AAACGTGCAGTGAATTGTGA

P51 CTGCACGTTT GTGTTTTTCT GTGATCCTC

P52 GATAAGCTT GCTTTTAAAACCATGCA(HindIII)

P53 AAAAAGACCTCTCCTGGATTAC

P54 TTGCCGTTACGCACAAA

P55 ACAGCGAAACCGAAATGA

P56 AGCGTACCCGCCACC

construction of recombinant bacteria CG216, CG220 and CG383

The homologous recombinant plasmid pK18mobsacB-Up-P with correct sequence determination₄₅And (3) electrically transforming the-gcvTH-down into an L-serine recombinant bacterium CG067, obtaining a bacterial colony of which the recombinant plasmid is integrated on a chromosome through kanamycin resistance forward screening, and obtaining a positive bacterial colony which generates two times of homologous recombination through sucrose lethal reverse screening. Carrying out PCR amplification identification on the positive colonies by taking P53 and P54 as primers to obtain 728bp recombinant strain WT delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH-P_homglyA, named CG 216.

The homologous recombinant plasmid pK18mobsacB-gcvTH-P with correct sequence determination₄₅And (3) electrically transforming the gene-gcvP-down into Corynebacterium glutamicum CG216, obtaining a colony of the recombinant plasmid integrated on a chromosome through kanamycin resistance forward screening, and obtaining a positive colony of two homologous recombinations through sucrose lethal reverse screening. Performing PCR amplification identification on the positive colonies by taking P55 and P56 as primers to obtain 1118bp recombinant strain WT-delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_homglyA, designated Corynebacterium glutamicum CG 220.

The recombinant bacterium extracts genome DNA for sequencing, and the result proves that P is successfully synthesized₄₅Gcv System P in E.coli under the control of a promoter₄₅-gcvTH::P₄₅Integration of gcvP into Corynebacterium glutamicum CG067, plasmid-free L-serine recombinant bacterium CG220(WT- Δ sdaAsera)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_homglyA) was successfully constructed.

Recombinant plasmid is preparedPlasmid pWYE1151 was electrotransformed into Corynebacterium glutamicum CG220(WT- Δ sdaAsera A)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyA) to obtain recombinant strain CG383 of L-serine.

Fifthly, constructing L-serine high-yield recombinant bacterium CG050 for expressing gcvTHP system on plasmid

The P45 promoter was PCR-amplified using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P101 and P44 as primers. The PCR product was digested simultaneously with Nar I and Hind III, and ligated to the C.glutamicum-E.coli shuttle expression plasmid pXMJ19 which had been digested simultaneously. Transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P101 and P44 as primers to obtain 177bp positive transformants, extracting plasmids of the correctly identified transformants, carrying out double enzyme digestion identification on the plasmids by Nar I and Hind III to obtain 177bp positive transformants, and naming the plasmids as recombinant plasmids pXMJ19-P₄₅。pXMJ19-P₄₅The plasmid was P by further sequencing analysis₄₅The promoter fragment (nucleotide 1005-1182 from the 5' end of SEQ ID NO.5) was inserted into the plasmid pXMJ 19.

The gcvTH gene (1624bp) was PCR amplified using E.coli W3110 genomic DNA as template and P39 and P40 as primers. The PCR product was digested simultaneously with Hind III and BamHI, and then digested simultaneously with pXMJ19-P₄₅And (4) connecting. Transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P39 and P40 as primers to obtain 1624bp positive transformants, extracting plasmids of the correctly identified transformants, carrying out Hind III and BamHI double enzyme digestion identification on the plasmids to obtain 1624bp positive transformants which are named as recombinant plasmids pXMJ19-P₄₅-gcvTH。pXMJ19-P₄₅gcvTH was further sequenced and analyzed by inserting the gcvTH fragment (SEQ ID NO.3) into the recombinant plasmid pXMJ19-P₄₅The resulting recombinant plasmid.

The gcvP gene (2896bp) was PCR-amplified using the genomic DNA of E.coli W3110 as template and P102 and P103 as primers. The PCR product was digested with BamHI and EcoRI, and then digested with pXMJ19-P₄₅-a gcvTH connection. Transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing chloramphenicol (20 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P102 and P103 as primers to obtain 2896bp positive transformants, extracting plasmids of the correctly identified transformants, carrying out BamHI and EcoRI double enzyme digestion identification on the plasmids to obtain 2896bp positive transformants, and obtaining a recombinant plasmid pXMJ19-serCB-P₄₅-gcvTHP。pXMJ19-P₄₅The gcvTHP was further sequenced by inserting the gcvP fragment (SEQ ID NO.4) into the recombinant plasmid pXMJ19-P₄₅-gcvTH. The sequences of the primers used above are as follows:

P101 AGTCATGGCGCCCAACCGTATC GTGTTTTTCTGTGATCCTC(NarI)

P44 GATAAGCTT GCTTTTAAAACCATGCA(HindIII)

P39 CCCAAGCTTAAAGGAGGACAAGATGGCACAACAGAC(HindIII)

P40 CGGGATCC AAACGTGCAGTGAATTGTGA(BamHI)

P102 CGGGATCCAAAGGAGGAACCATCGCTCATGACACA(BamHI)

P103 GCGGAATTC GAATTACTGGTATTCGCTAATCGGT(EcoRI)

the recombinant plasmid pXMJ19-P₄₅Electrotransformation of-gcvTHP to Corynebacterium glutamicum CG039(WT- Δ sdaAsera)^rDelta cysE delta glyR), obtaining the recombinant bacterium CG 050.

Sixth, expression of glycine cleavage system in L-serine engineering bacteria CG220 and CG050

Expression of gcvTHP protein was detected by Western blotting.

To examine whether or not the GcvT, GcvH, and GcvP proteins integrated into the genome of corynebacterium glutamicum were expressed, the GcvT, GcvH, and GcvP proteins were expressed and purified in escherichia coli, and polyclonal antibodies to the three proteins were prepared and obtained.

Extracting total intracellular proteins of recombinant bacteria CG220, CG050 and CG067 of L-serine by using an ultrasonic disruption method, and taking 20ul of sample to perform conventional SDS-PAGE gel electrophoresis. After electrophoresis is finished, the separation gel is taken out, a small corner is cut at the upper right corner to be used as a mark, the cut gel, the PVDF membrane soaked in methanol and the filter paper are placed in a culture dish added with transfer liquid, the balance is carried out for about 10min, and air bubbles in the filter paper and the transfer membrane and redundant SDS on the gel are removed. The transfer tank was laid flat with the glove on the base, and 3 sheets of the buffer-soaked filter paper, the PVDF membrane, the gel that had just completed electrophoresis, and the other 3 sheets of the buffer-soaked filter paper were stacked in order. The glass rod was rolled on the laminated filter paper to remove air bubbles. The membrane is rotated for 1h under a constant current of 10mA, and the transfer membrane is taken out after the operation is finished.

The membranes were transferred to a dish containing blocking solution and incubated overnight at room temperature on a destaining shaker for 1h or 4 ℃. Diluting the primary antibody with a confining liquid at a ratio of 1: 10000; taking out the membrane from the confining liquid, sucking off the residual liquid with filter paper, placing into a hybridization bag, placing the membrane protein face down on the antibody liquid surface, lifting the four corners of the membrane to remove residual bubbles, sealing with a sealer, and incubating at room temperature for 1 h. Wash four times with TBST on a decolourizing shaker at room temperature for 10min each time. Adding a diluted secondary antibody diluent of 1:10000TBST into a culture dish, incubating the culture dish on a shaking table at room temperature for 1-2 h, and then decoloring the culture dish with TBST on the shaking table at room temperature for washing for four times, 10min each time.

The PVDF film is firstly put on the preservative film. Mixing the two reagents A and B of the ECL in an EP tube in equal volume, then uniformly dripping the mixed reagents on the protein surface of the PVDF membrane, after reacting for 1-2min, sucking the redundant ECL working solution on the PVDF membrane, transferring the ECL working solution to one side of a preservative film which is pre-laid in an X-piece clamp, and turning over the other side to cover the preservative film. The preservative film is fixed on the film clamp by transparent glue.

In a dark room, respectively putting the developing solution and the fixing solution into a plastic tray; taking out the X-ray film under a red light, and cutting the X-ray film into a proper size by using a paper cutter; opening the X-ray film holder, placing the X-ray film on the film, and exposing for 1-2 min; and after exposure is finished, taking out the X-ray film, quickly immersing the X-ray film into a developing solution for development, and immediately stopping development after an obvious strip appears. After the development is finished, immediately immersing the X-ray film into the fixing solution, wherein the fixing time is generally 5-10 min, and the film is transparent; after washing off the residual fixer with tap water, the plate was dried at room temperature.

Through Western blotting experiments, expression of GcvT, GcvH and GcvP proteins is detected in genetically engineered bacteria (see figure 3), and the fact that a glycine cleavage system is in P is proved₄₅Constitutive expression can be carried out in engineering bacteria CG220 and CG050 under the control of the promoter.

Example 6 construction of L-serine high-producing recombinant bacteria CG395 and CG399 with attenuated acn Gene expression

acn gene encodes aconitase (SEQ ID NO.21), and on the basis of the constructed engineering bacteria CG220, the self promoter of acn gene is replaced by weak promoter P_homReducing the expression of acn gene, constructing engineering bacteria CG391 and over-expressing serA^rAnd transforming and combining CB to obtain the high-yield engineering bacterium CG 399.

Primers were designed based on the acn gene sequence of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream sequence, respectively.

PCR amplification 573bp acn upstream homology arms by taking Corynebacterium glutamicum ATCC13032 genomic DNA as a template and P57 and P58 as primers; amplifying 130bp P by using P59 and P60 as primers_homPromoter sequences (Zhang, Y., Shang, X., Lai, S., Zhang, G., Liang, Y., Wen, T.,2012.Development and application of an array-expressing expression system by failure inducing microorganism in Corynebacterium glutamicum Microbiol.78, 5831-5838.); using the purified PCR product as a template, using P57 and P60 as primers, and adopting overlap extension PCR (SOE) amplification to obtain 703bp PCR product which is a fragment of acn gene upstream homology arm and P_homA promoter sequence fragment. Using Corynebacterium glutamicum ATCC13032 genome DNA as template, using P61 and P62 as primer, PCR amplifying 599bp acn gene partial sequence, using purified PCR product as template, using P57 and P62 as primer, adopting overlap extension PCR technology (SOE) amplification to obtain 1302bp PCR product, which is the fragment of acn gene upstream homologous arm and P62 gene upstream homologous arm_homPromoter sequence fragment and acn gene partial sequence (SEQ ID NO.14)

Wherein, the 1 st to 573 th nucleotides from the 5' end of SEQ ID NO.14Is an upstream homologous arm of the acn transcription regulatory factor, and the 574-703 th nucleotide from the 5' end of SEQ ID NO.14 is P_homThe promoter sequence, the 704 nd and 1302 th nucleotides from the 5' end of SEQ ID NO.14 are acn gene partial sequences.

The 1302bp PCR product was digested with BamHI and EcoRI, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been digested with BamHI and EcoRI. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by adopting P57 and P62 as primers to obtain 1302bp as a positive transformant, extracting plasmids of the correctly identified transformants, and carrying out BamHI and EcoRI double enzyme digestion identification on the plasmids to obtain 1302bp as a positive clone.

The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.14 in a sequence table into a vector pK18mobsacB and is named as pK18mobsacB-P_hom-acn。

The sequences of the primers used above are as follows:

P57 CGGGATCCGCCAAAGCAACCAACCCC(BamHI)

P58 CTTTTTAGTTTTCAACGGTCGGATTTGCTCGAAAT

P59 CGAGCAAATCCGACCGTTGAAAACTAAAAAGCTGG

P60 GCGTCTGCTTCGGCTACTTTGTTTCGGCCACCC

P61 GCCGAAACAAAGTAGCCGAAGCAGACGCCGTCG

P62 CGGAATTCTGACCTGGTGGACGATAC(EcoRI)

P63 GTGAATCGAATTTCGGGGCT

P64 GAGGGATCAGCATGGACACT

the homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_homAcn into Corynebacterium glutamicum CG220, through kanamycin resistance forward screening to get the recombinant plasmid integrated into the chromosome colony, through sucrose lethal reverse screening, get the two homologous recombination positive colony. Carrying out PCR amplification identification on the positive colonies by taking P63 and P64 as primers to obtain883bp is a recombinant strain named as Corynebacterium glutamicum CG395(WT delta sdaAsera)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyA P_hom-acn)。

The recombinant strain extracts genomic DNA for sequencing, and the result proves that the promoter of acn gene in the corynebacterium glutamicum wild type ATCC13032 is successfully replaced by the weak promoter P_homCorynebacterium glutamicum CG395 (WT. DELTA. sdaAsera)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyA P_homAcn) was successfully constructed.

The recombinant plasmid pWYE1151 was electrotransformed into Corynebacterium glutamicum CG399 (WT. DELTA. sdaAserA)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyAΔpyc P_hom-acn) to obtain a recombinant strain of L-serine CG 399.

Example 7 construction of L-serine high-producing recombinant bacteria CG452 and CG453 that block the oxaloacetate anaplerosis pathway

The pyc gene codes pyruvate carboxylase (SEQ ID NO.22), and on the basis of the constructed engineering bacterium CG395, the engineering bacterium CG452 and the over-expression serA are constructed by knocking out the pyc gene and blocking the way of supplementing oxaloacetate by pyruvate^rAnd (5) transforming and combining the CB to obtain the engineering bacterium CG 453.

Primers were designed based on the pyc gene of Corynebacterium glutamicum ATCC13032 in Genbank and the sequences upstream and downstream thereof, respectively.

PCR amplification of the upstream homology arm of the 727bp pyc gene by using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P65 and P66 as primers; the downstream homology arm of the 644bp pyc gene was amplified using P67 and P68 as primers. And then using the purified PCR product as a template, using P65 and P68 as primers, and adopting an overlap extension PCR (SOE) technology to amplify to obtain a 1371bp PCR product which is a fragment (SEQ ID NO.15) of the upstream and downstream homology arms of the pyc gene.

Wherein, the 1 st to 727 th nucleotides from the 5 'end of the SEQ ID NO.15 are the upstream homologous arms of the pyc gene, and the 728 th and 1371 th nucleotides from the 5' end of the SEQ ID NO.15 are the downstream homologous arms of the pyc gene.

The 1371bp PCR product was double-digested with HindIII and EcoRI, and ligated with the homologous recombination vector pK18mobsacB (available from American type culture Collection ATCC, Cat. 87097) which had been similarly double-digested. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P65 and P68 as primers to obtain 1371bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out HindIII and EcoRI double enzyme digestion identification on the plasmids to obtain 1371bp as a positive clone.

The positive plasmid is sent for sequencing, and as a result, the plasmid is a recombinant plasmid obtained by inserting the nucleotide shown as SEQ ID NO.15 in the sequence table into a vector pK18mobsacB, and is named as pK18 mobsacB-delta pyc.

The sequences of the primers used above are as follows:

P65 CCCAAGCTTATCCGTTTGAAGACTGTTG(HindIII)

P66 CCTTGGTCTCCTCACTGCGTCCTAGTATCG

P67 GGACGCAGTGAGGAGACCAAGGCTCAAAG

P68 CCGGAATTCGCTCATACAACGCCAACG(EcoRI)

P69 CGATTACTGAAGCAGCACG

P70 CAATGAGCACCACCACCT

the homologous recombinant plasmid pK18 mobsacB-delta pyc with correct sequence determination is electrically transformed into Corynebacterium glutamicum CG395, a colony with the recombinant plasmid integrated on a chromosome is obtained by kanamycin resistance forward screening, and a positive colony with two times of homologous recombination is obtained by sucrose lethal reverse screening. Carrying out PCR amplification identification on the positive colonies by taking P69 and P70 as primers to obtain 683bp recombinant bacteria which are named as Corynebacterium glutamicum CG452 (WT-delta sdaAsera A)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyA P_hom-acnΔpyc)。

The recombinant strain extracts genomic DNA for sequencing, and the result proves that the pyc gene in the corynebacterium glutamicum wild type ATCC13032 is successfully deleted, and the recombinant strain CG452 (WT-delta sdaAsera A)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyAP_hom-acn Δ pyc) was successfully constructed.

The recombinant plasmid pWYE1151 was electrotransformed into Corynebacterium glutamicum CG452(WT- Δ sdaA Δ cysEserA)^rΔglyR P_homglyA) to obtain a recombinant strain CG453 of L-serine.

Example 8 construction of L-serine high-producing recombinant bacterium CG454 overexpressing efflux Transporter ThrE

the thrE gene encodes the threonine efflux transporter (nucleotide 332-1801 from the 5' end of SEQ ID NO.16) by contacting the thrE gene with serA^rAnd co-expressing CB to obtain the high-yield engineering bacterium CG 454.

First, construction of recombinant plasmid pWYE1153 containing thrE gene

The thrE gene (1991bp) was PCR-amplified using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P71 and P72 as primers. The PCR product was digested simultaneously with HindIII and XbaI, and ligated with the C.glutamicum-E.coli shuttle expression plasmid pWYE1151 which had been digested simultaneously. The ligation product is transformed into Escherichia coli DH5 alpha by a chemical transformation method, transformants are selected on LB plates containing chloramphenicol (20 mu g/mL), after the transformants are subcultured for three generations, the transformants are identified by colony PCR using P71 and P72 as primers, 1991bp of positive transformants are obtained, plasmids are extracted from the correctly identified transformants, and HindIII and XbaI double enzyme digestion identification is carried out on the plasmids, 1991bp of positive transformants are obtained, and the plasmid is named as recombinant plasmid pWYE1153 (see figure 4).

pWYE1153 was further sequenced and the plasmid was a vector obtained by inserting the thrE fragment (SEQ ID NO.16) into HindIII and XbaI of plasmid pWYE 1151.

The sequences of the primers used above are as follows:

P71 CCCAAGCTTGGGAAAAGAAAGCCCCTAAG(HindIII)

P72 GCTCTAGAGAAGTCCTTAGAATAGGTGGC(XbaI)

construction of two, L-serine high-yield recombinant bacterium CG454

The recombinant plasmid pWYE1153 was electrotransformed into Corynebacterium glutamicum CG452(WT- Δ sdaAsera A)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP P_hom-glyAΔpyc P_hom-acn) to obtain a recombinant strain CG454 of L-serine.

Example 9 construction of plasmid-free serine engineered bacteria CG466 and CG468

In this example, a strong promoter P was used on the basis of example 7 above_eftuReplacement serA^rThe promoters of the serB and serC genes to increase the metabolic flux of the homoserine synthesis pathway, thereby further constructing CG 466; then with P_sodThe strong promoter replaces the thrE gene promoter to enhance the expression of efflux transporter (ThrE, SEQ ID NO.16) and enhance the transport of serine to the extracellular space, thereby constructing CG 468.

Construction of engineering bacteria CG466

According to the serA, serB and serC genes of Corynebacterium glutamicum ATCC13032 in Genbank and the sequences and P upstream and downstream thereof_eftuThe promoter sequences were designed as primers, respectively.

Amplifying the upstream homology arm of the serA promoter by using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P73 and P74 as primers; p amplification with P75 and P76 as primers_eftuA promoter; the homology arms downstream of the serA promoter were amplified using P77 and P78 as primers. Then, the purified PCR product is used as a template, P73 and P78 are used as primers, and the overlapping extension PCR technology (SOE) is adopted for amplification to obtain a 1454bp PCR product which is a P product containing a replacement promoter_eftuAnd the replaced promoter P_serAA fragment of the upstream and downstream homology arms of (1) (SEQ ID NO. 23).

Wherein the 1 st to 617 th nucleotides from the 5' end of SEQ ID NO.23 are replaced promoter P_serAThe upstream homology arm of (1), nucleotide 618-817 from the 5' end of SEQ ID NO.23 is promoter P_eftuThe nucleotide 818-1454 from the 5' end of the SEQ ID NO.23 is the replaced promoter P_serADownstream homology arms of (a).

The 1454bp PCR product was digested simultaneously with Xba I and Sma I and ligated with the homologous recombination vector pK18mobsacB digested simultaneously. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P97 and P98 as primers to obtain 1666bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out Xba I and Sma I double enzyme digestion identification on the plasmids to obtain 1454bp as a positive transformant.

The positive plasmid is sent to be sequenced, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.23 in a sequence table into a vector pK18mobsacB and named as pK18mobsacB-P_eftu::P_serA。

The same method is adopted to construct homologous recombinant plasmid pK18mobsacB-P_eftu::P_serCReplacement of the promoter of the serC Gene by a Strong promoter P_eftu. The method comprises the following specific steps: amplifying the upstream homology arm of the serC gene promoter by taking P79 and P80 as primers; promoter P amplified by using P81 and P82 as primers_eftu(ii) a The homologous arms at the downstream of the serC gene promoter were amplified using P83 and P84 as primers. P79 and P84 are used as primers, the overlap extension PCR technology (SOE) is adopted for amplification, 1457bp PCR product is obtained, and the PCR product is P containing a replacement promoter_etfuAnd the replaced promoter P_serCA long fragment of upstream and downstream homology arms (SEQ ID NO.24), wherein the 1 st to 628 th nucleotides from the 5' end of the SEQ ID NO.24 is replaced promoter P_serCThe upstream homology arm of SEQ ID NO.24, from the 5' end, the 629-828 th nucleotide is the promoter P_eftuThe nucleotide 829-1457 from the 5' end of SEQ ID NO.24 is the replaced promoter P_serCDownstream homology arms of (a).

The 1457bp PCR product was digested simultaneously with Xba I and Sma I and ligated with the homologous recombination vector pK18mobsacB digested simultaneously. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P97 and P98 as primers to obtain 1669bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out Xba I and Sma I double enzyme digestion identification on the plasmids to obtain 1457bp as a positive transformant. The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.24 in a sequence table into a vector pK18mobsacB and is named as pK18mobsacB-P_eftu::P_serC。

The same method is adopted to construct homologous recombinant plasmid pK18mobsacB-P_eftu::P_serBReplacement of the promoter of the serB Gene by a Strong promoter P_eftu. The method comprises the following specific steps: amplifying the upstream homology arm of the serB gene promoter by taking P85 and P68 as primers; promoter P amplified by using P87 and P88 as primers_eftu(ii) a The homologous arms at the downstream of the serB gene promoter are amplified by taking P89 and P90 as primers. Using P85 and P90 as primers, adopting overlap extension PCR technology (SOE) to amplify to obtain 1431bp PCR product as P containing replacement promoter_etfuAnd the replaced promoter P_serBA long fragment of upstream and downstream homology arms (SEQ ID NO.25), wherein nucleotides 1 to 600 from the 5' end of SEQ ID NO.25 is a replaced promoter P_serBThe upstream homology arm of SEQ ID NO.25, nucleotide 601-800 from the 5' end is promoter P_eftuThe nucleotide 801-1431 from the 5' end of SEQ ID NO.25 is the replaced promoter P_serBDownstream homology arms of (a).

The PCR product of 1431bp is subjected to double digestion by Xba I and Sma I, and then is connected with a homologous recombination vector pK18mobsacB subjected to the same double digestion treatment. And transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by adopting P97 and P98 as primers to obtain 1643bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out double enzyme digestion identification on the plasmids by Xba I and Sma I to obtain 1431bp as positive. The positive plasmid is sent for sequencing, and as a result, the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as a sequence 25 in a sequence table into a vector pK18mobsacB, and is named as pK18mobsacB-P_eftu::P_serB。

The sequences of the primers used above are as follows:

P73:GCTCTAGATCGCTTGTTGGCAATGTG(Xba I)

P74:CAGGGTAACGGCCAGATTCATGCTGTGAGATT

P75:TCACAGCATGAATCTGGCCGTTACCCTGCGAATG

P76:CCATTCTGGCTCACTGTATGTCCTCCTGGAC

P77:AGGAGGACATACAGTGAGCCAGAATGGCCGTC

P78:TCCCCCGGGCAGTTTCCTTGGTCTTAG(Sma I)

P79:GCTCTAGACAGCCTTGTTGTTATCAG(Xba I)

P80:AGGGTAACGGCCAAAAACTGGCGACACCGAAC

P81:GTGTCGCCAGTTTTTGGCCGTTACCCTGCGAATG

P82:GGGAAGTCGGTCATTGTATGTCCTCCTGGAC

P83:CAGGAGGACATACAATGACCGACTTCCCCACC

P48:TCCCCCGGGCTCATCGCTGCAAGCCAC(Sma I)

P58:GCTCTAGATCCACTTGGCTGACTCCT(Xba I)

P68:CAGGGTAACGGCCAGCTTTTAGCGGCTGGAGTC

P78:AGCCGCTAAAAGCTGGCCGTTACCCTGCGAATG

P88:ATGAGTTCAGTCACTGTATGTCCTCCTGGAC

P89:AGGAGGACATACAGTGACTGAACTCATCCAG

P90TCCCCCGGGCACAATCGAAGCACACCAG(Sma I)

P97:ATGTGCTGCAAGGCGATTAA

P98:TATGCTTCCGGCTCGTATGT

P99:GCGCTAGATCTGTGTGCT

the homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_eftu::P_serAAnd (3) electrotransformation is carried out to serine recombinant bacteria CG452, bacterial colonies with recombinant plasmids integrated on chromosomes are obtained through kanamycin resistance forward screening, and positive bacterial colonies with two homologous recombination are obtained through sucrose reverse screening. Carrying out PCR amplification identification on the positive colonies by taking P99 and P78 as primers to obtain 744bp recombinant strain WT-delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn-P_eftu::P_serA。

The homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_eftu::P_serCElectrotransformation into the correctly identified recombinant strain WT-delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn P_eftu::P_serAThe colony of the recombinant plasmid integrated on the chromosome is obtained by kanamycin resistance forward screening, and the positive colony of the recombinant plasmid subjected to two times of homologous recombination is obtained by sucrose reverse screening. Carrying out PCR amplification identification on the positive colonies by taking P99 and P84 as primers to obtain 736bp recombinant strain WT-delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn-P_eftu::P_serA-P_eftu::P_serC。

The homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_eftu::P_serBElectrotransformation into the correctly identified recombinant strain WT-delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn P_eftu::P_serA P_eftu::P_serCThe colony of the recombinant plasmid integrated on the chromosome is obtained by kanamycin resistance forward screening, and the positive colony of the recombinant plasmid subjected to two times of homologous recombination is obtained by sucrose reverse screening. Carrying out PCR amplification identification on the positive colonies by taking P99 and P90 as primers to obtain 738bp recombinant strain WT delta sdaAsera^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn-P_eftu::P_serA-P_eftu::P_serC-P_eftu::P_serB。

The recombinant strain extracts genome DNA for sequencing, and the result proves that the promoters of serA, serB and serC genes in CG452 are successfully replaced by corynebacterium glutamicum endogenous strong promoter P respectively_eftuPlasmid-free serine recombinant bacterium CG466(WT- Δ sdaAserA)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn-P_eftu::P_serA-P_eftu::P_serC-P_eftu::P_serB) The construction was successful.

Second, construction of engineering bacterium CG468

The thrE gene from Corynebacterium glutamicum ATCC13032 in Genbank and its upstream and downstream sequences and P_sodThe promoter sequences were designed as primers, respectively.

The same method is adopted to construct homologous recombinant plasmid pK18mobsacB-P_sod::P_thrEReplacement of the promoter of the thrE gene by a strong promoter P_sod. The method comprises the following specific steps: amplifying an upstream homology arm of a thrE gene promoter by taking P91 and P92 as primers; promoter P amplified by using P93 and P94 as primers_sod(ii) a The downstream homology arm of the thrE gene promoter is amplified by taking P95 and P96 as primers. P91 and P96 are used as primers, and the overlapping extension PCR technology (SOE) is adopted for amplification to obtain a 1466bp PCR product which is a P product containing a replacement promoter_sodAnd the replaced promoter P_thrEA long fragment of upstream and downstream homology arms (SEQ ID NO.26), wherein the nucleotides 1 to 634 from the 5' end of the SEQ ID NO.26 is a replaced promoter P_thrEThe nucleotide 635-th and 834-th nucleotides from the 5' end of SEQ ID NO.26 are promoter P_sodThe nucleotide 835-1466 from the 5' end of the SEQ ID NO.26 is a replaced promoter P_thrEDownstream homology arms of (a).

The 1466bp PCR product is subjected to double digestion by Xba I and Sma I and then is connected with a homologous recombination vector pK18mobsacB subjected to the same double digestion treatment. And (3) transforming the ligation product to escherichia coli DH5 alpha by adopting a chemical transformation method, screening transformants on an LB plate containing kanamycin (50 mu g/mL), carrying out subculture on the transformants for three generations, identifying the transformants by adopting colony PCR (polymerase chain reaction) by taking P97 and P98 as primers to obtain 1678bp as a positive transformant, extracting plasmids from the correctly identified transformants, and carrying out double enzyme digestion identification on the plasmids by Xba I and Sma I to obtain 1466bp as positive. The positive plasmid is sent for sequencing, and the plasmid is a recombinant plasmid obtained by inserting nucleotide shown as SEQ ID NO.26 in a sequence table into a vector pK18mobsacB and is named as pK18mobsacB-P_sod::P_thrE。

The sequences of the primers used above are as follows:

P91:GCTCTAGAAGCGATCTAGTTCGCAAC(Xba I)

P92:ATAATTGGCAGCTACAGCGCAACGCACTTGT

P93:GTGCGTTGCGCTGTAGCTGCCAATTATTCCG

P94:GCAAAACTCAACATGGGTAAAAAATCCTTTCG

P95:GGATTTTTTACCCATGTTGAGTTTTGCGACC

P96:TCCCCCGGGGCGTGGCAATAAAACCAC(Sma I)

P100：GCACCAAGTACTTTTGCG

the homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_sod::P_thrEAnd (3) electrotransformation is carried out to the recombinant bacterium CG466 which is identified correctly, a bacterial colony of the recombinant plasmid integrated on the chromosome is obtained through kanamycin resistance forward screening, and a positive bacterial colony which generates two times of homologous recombination is obtained through sucrose reverse screening. Performing PCR amplification identification on the positive colonies by taking P100 and P96 as primers to obtain 729bp recombinant

WT-ΔsdaAserA^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn-P_eftu::P_serA

-P_eftu::P_serC-P_eftu::P_serB-P_sod::P_thrE。

The recombinant bacterium extracts genome DNA for sequencing, and the result proves that the promoter of thrE gene in CG466 is successfully replaced by the endogenous strong promoter P of corynebacterium glutamicum_sodPlasmid-free serine recombinant bacterium CG468(WT- Δ sdaAserA)^rΔcysEΔglyR::P₄₅-gcvTH::P₄₅-gcvP-P_hom-glyAΔpyc-P_hom-acn P_eftu::P_serA-P_eftu::P_serC-P_eftu::P_serB-P_sod::P_thrE) The construction was successful.

Example 10 application of L-serine engineering bacteria in the production of L-serine

Shaking flask fermentation of recombinant bacteria for high yield of L-serine

The fermentation medium adopted by the shake flask fermentation is as follows: glucose 40g/L, (NH)₄)₂SO₄ 20g/L，KH₂PO₄500mg/L，K₂HPO₄·3H₂O 500mg/L，MgSO₄·7H₂O 250mg/L，FeSO₄·7H₂O 10mg/L，MnSO₄·H₂O 10mg/L，ZnSO₄·7H₂O 1mg/L，CuSO₄ 200μg/L，NiCl₂·6H₂O20. mu.g/L, Cys 24mg/L, biotin 50. mu.g/L, pH 7.0-7.2, 2% CaCO₃And autoclaving at 121 deg.C for 20 min. Glucose was separately sterilized and autoclaved at 115 ℃ for 15 min. MgSO (MgSO)₄·7H₂O, and inorganic salt ions, and autoclaving at 121 deg.C for 20 min. The vitamins are sterilized by filtration through a sterile 0.22 μm filter membrane.

The seed culture medium is specifically as follows: glucose 20g/L, ammonium sulfate 5g/L, K₂HPO₄·3H₂O 1g/L，MgSO₄·7H₂O400 mg/L, biotin 50. mu.g/L, vitamin B₁1mg/L, yeast powder 10g/L and peptone 10 g/L.

1) Obtaining seed liquid

Respectively inoculating the engineering bacteria CG039, CG050, CG381, CG188, CG383, CG399, CG453 and CG454 prepared in the above embodiment and the SER-3 and SER-8 prepared in the comparative example into a seed culture medium, wherein the culture temperature of the seed liquid is 32 ℃, the rotating speed of a shaking table is 220r/min, and the culture time is 12h to obtain seed liquid, OD₆₀₀May be 15.

2) Fermenting the mixture

Inoculating the recombinant strain seed solution with the plasmid into a fermentation culture medium (the liquid loading amount of a 500mL baffle triangular flask is 30mL) containing 10 mu g/mL chloramphenicol according to the volume percentage content of 3%, culturing at 32 ℃ at 220r/min for 60h, and adding isopropyl-beta-D-thiogalactopyranoside (IPTG) with the final concentration of 0.1mmol/L for induced expression of the target gene when fermenting and culturing for 4 h. Intermittently adding strong ammonia water to control pH of the fermentation liquor to be 7.0-7.2, adding glucose mother liquor with concentration of 600g/L according to residual sugar condition, and controlling residual sugar of the fermentation liquor to be 5-10 g/L. The fermentation process of the plasmid-free recombinant strain seed liquid is similar, except that chloramphenicol and an inducer IPTG do not need to be added.

Collecting 12000 Xg fermentation product, centrifuging for 5min, and collecting supernatant.

3) And detecting the content of L-serine

A high-performance liquid phase method is adopted, and the specific method (the high-performance liquid phase method for deriving the 2, 4-dinitrofluorobenzene before the column) is as follows:50 μ L of the supernatant was placed in a 2mL centrifuge tube and 100 μ L NaHCO was added₃Heating the aqueous solution (500mmol/L, pH 9.0) and 100. mu.L of 1% 2, 4-dinitrofluorobenzene-acetonitrile solution (volume ratio) in a water bath at 60 deg.C in the dark for 60min, cooling to 25 deg.C, and adding 750. mu.L KH₂PO₄10mmol/L of water solution, pH 7.2 + -0.05, adjusting pH with NaOH water solution, standing for 15min, filtering, and sampling with sample amount of 15 μ L.

The column used was a C18 column (ZORBAX Eclipse XDB-C18, 4.6 x 150mm, Agilent, USA); column temperature: 40 ℃; ultraviolet detection wavelength: 360 nm; the mobile phase A is 40mmol/L KH₂PO₄Aqueous solution (pH 7.2. + -. 0.05, pH adjusted with 40g/L aqueous KOH), mobile phase B was 55% aqueous acetonitrile (vol.%), mobile phase flow rate was 1mL/min, elution process is shown in Table 1 below:

table 1 shows the elution procedure

Wild type strain c.glutamicum ATCC13032 was used as a control.

4) Fermentation results and analysis

The results are shown in Table 2.

Table 2 shows the maximum OD of L-serine engineering bacteria SER-3, SER-8, CG039, CG050, CG381, CG188, CG383, CG399, CG453 and CG454 in the shake flask fermentation experiment₆₀₀Specific growth rate, glucose consumption rate and L-serine production.

TABLE 2 Shake flask fermentation results

In the shake flask fermentation experiment, the wild type strain C.glutamcum ATCC13032 is fermented for 60 hours, and the accumulation of L-serine is not detected.

Compared with the engineering bacterium SER-3 without the cysE gene, the yield of the engineering bacterium CG039 with the cysE gene knockout is improved by 30 times. Further, a gcv system is over-expressed on a plasmid, and the serine yield of the engineering bacteria CG050 is improved by 5.6 times compared with CG039 which does not express the gcv system. In the overexpression of serA^rOn the basis of the CB gene, the yield of the engineering bacteria CG 381L-serine is improved by 15.6 times compared with SER-8 only by knocking out the transcriptional activator glyR of the serine hydroxymethyltransferase gene. On the basis, the expression of the glyA gene is further reduced through a weak promoter, and the L-serine yield of the engineering bacteria CG188 is improved by 22.2 times compared with SER-8. The L-serine yield of the engineering bacterium CG383 constructed by introducing the escherichia coli gcv system is improved by 31.4 times compared with SER-8.

Weakening the expression of the glyA gene can reduce the supply of intracellular one-carbon units, so that the specific growth rate and the glucose consumption rate of the engineering bacteria CG188 are reduced, and compared with the strain CG381 only knocking out glyR, the L-serine yield is improved by 1.4 times. The integration of the gcv system can provide one carbon unit for the engineering bacterium CG383, so that the specific growth rate and the glucose consumption rate are restored, and compared with the engineering bacterium CG381, the yield of the L-serine is improved by 2 times. By weakening the expression of aconitase coded by acn gene in tricarboxylic acid cycle, the specific growth rate of the constructed engineering bacteria CG399 is reduced, and the yield of L-serine is 1.89 g/L. By knocking out pyc gene and blocking the way of supplementing oxaloacetate by pyruvic acid, the L-serine yield of the constructed engineering bacterium CG453 is improved by 1 time compared with that of CG 399. By increasing the expression of threonine transporter ThrE, the L-serine yield of the constructed engineering bacteria CG454 is improved by 1.25 times and 1.1 times respectively compared with the engineering bacteria CG399 and CG 453.

Fermentation production of L-serine by using L-serine engineering bacteria CG383 and CG454 fermentation tank

The seed culture medium is specifically as follows: glucose 20g/L, ammonium sulfate 5g/L, K₂HPO₄·3H₂O 1g/L，MgSO₄·7H₂O0.4 g/L, biotin 50. mu.g/L, vitamin B₁1mg/L, yeast powder 10g/L and peptone 10 g/L.

The fermentation medium used for the fermentation is specifically as follows: grapeGlucose 40g/L, ammonium sulfate 20g/L, KH₂PO₄ 500mg/L，K₂HPO₄·3H₂O 500mg/L，MgSO₄·7H₂O 600mg/L，FeSO₄·7H₂O 10mg/L，MnSO₄·H₂O10 mg/L, vitamin B₁500 mu g/L, Cys 24mg/L and sodium citrate 0.4 g/L.

1) Obtaining seed liquid

Culturing engineering bacteria CG383 and CG454 in seed culture medium at 32 deg.C with shaking table rotation speed of 220r/min for 12 hr to obtain seed solution OD₆₀₀May be 15.

2) Fermenting the mixture

The seed solution was inoculated to a fermentation medium containing 10. mu.g/ml chloramphenicol at a final concentration of 10% by volume.

The fermenter used was a 7.5L fermenter (BioFlo115, NBS): a constant-speed programmable control pump is arranged in the feeding device, so that constant-speed feeding can be realized. 600g/L glucose is supplemented by a peristaltic pump in the fermentation process, and the concentration of the glucose in the fermentation system is controlled to be 5-10 g/L. Controlling the fermentation temperature to be maintained at 32 ℃ by a heating jacket and cooling water; air is introduced to provide dissolved oxygen, and the rotating speed and the dissolved oxygen signal are cascade-controlled to maintain the dissolved oxygen at 30%; adding strong ammonia water to regulate pH value and maintain it at about 6.9. The fermentation was continued for 60 h. When OD is reached₆₀₀When the concentration was 4 to 5, IPTG (final concentration of 0.1mmol/L) was added to induce expression of the gene carried by the recombinant plasmid.

Collecting 12000 Xg fermentation product, centrifuging for 5min, and collecting supernatant.

3) And detecting the content of L-serine

The content of L-serine in the supernatant was determined by the HPLC method according to the above-mentioned first 3), and as shown in FIGS. 5 and 6, it can be seen that the fermentation time was 50 hours, the L-serine yield of the engineered bacterium CG383 was 10g/L, and the production strength was 0.20 g/L/h; the L-serine yield of the engineering bacteria CG454 is 13g/L, and the production intensity is 0.22 g/L/h.

Finally, it should be noted that: it should be understood that the above examples are only for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the scope of the invention.

Sequence listing

<110> institute of microbiology of Chinese academy of sciences

<120> recombinant bacterium for producing L-serine and construction method thereof

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1045

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 1

acattttgag ccagcgctaa ggagaaccca gtgacagaaa ttgcagaaaa ccttcagcgc 60

ttgggtattg aattacctga tctaccagca ccgcagtatt cctacgtacc gttcaaccgc 120

caaggaaaca ccctctatgt atcggggcag atttcacgaa ccgcagcggg agacatcctc 180

gccggacgag ttggcgaaga cgcaacatta gaagaaggaa tccacgccgc agaggtagcc 240

accatcaatc tgctggccag aatccaccaa tccatcggtt tagacaatgt ggcccaaatt 300

ctgaaactga atgtgtgggt caatagctcc gatgacttta ttcagcagcc tcaagtggcc 360

gacggtgcat cccagctcct tgaggcagtg ttgggtgagg ccggaaaaca tgcacgcaca 420

gcactaccca caaatactct cccccaggga gcactagtgg aattggatgc tgtcgttgcg 480

gtcaccgagg ccgccgaagt ttaggacgcg tgggcgaaaa tttcagcaac cgtgggataa 540

cggaggtcat tcactcaata tataggtatg gcaagcctaa gtgaattgat tgagtgaatt 600

gaatgcatca cacccgatta caggggtatt gaaaatcttt ttaaagaagc ccttttaaga 660

atcctcagtg ggcttctctg gaccttcttc tgagctttca ggctttgcgt agcgttccct 720

ggcccgtttg agacgttctt cctcttctaa ttgggcagcc tcgtcggcgc gacgctgttt 780

gaagcgattc ttttcaatat tccacaagaa ttcttcatca tcgtcggggc ctttcactgc 840

acgaggtgcc tggccctgat tgatctccgc gttacgcttc catgtagatg gcttgaaggc 900

cttccacagc aagacgattg cgacgataac caaaataatc agcaaaagcc tacccacttg 960

aacctctcct taaatatttg cttcaacctc ccacaatacg gaactttgag gcattcttgg 1020

gtatcggtat gtattgagta gggtt 1045

<210> 2

<211> 1976

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 2

catcctcacc cgttccacca agtgatcgct accttttttc agtaccaacg acgcgcgaac 60

tcgggtggga agaatattct ccaccaagtt gggcaggttg atcgattgcc acagttctcg 120

agcgacggcg atggactctg gatcagccat gtcggcgtaa tgggagaagt gggcaccggg 180

gcgacggaat gcagtgtcgc ggagtttgag gaagcggtcg atgtaccatt tttcgatatc 240

ttcggtgcgg gcatctacgt agacgctgaa gtcgaaaagg tcactgacca tcaatgttgg 300

gccagtttgg aggacgttta agccttcgac gatcaaaatg tcgggttggc ggactgtggt 360

gaattcgcct ggaactcggt cgtacgcggt gtgggagtag acaggtgcgt tgacttcgag 420

ttttccggat tttacgtcgg tgacaaagcg gaggagtgca cgttggtcgt agctttcggg 480

gaatcctttt cgggacatta atccgcggcg gattagttcc gcgccgggat agaggaatcc 540

gtcggtggtg acgaggtcca cgcgggggtg ggaattccag cgctgaagca gaacttggag 600

gagtcgggcg gtggttgatt taccgacggc gacggatccc gcgacaccaa tgacaaacgg 660

cacagagata gagggggaag ttccgaggaa ggtttcggtg gctgcagtaa gttgctgtcg 720

ggccgctacc tggaggtgaa tcagacggga cagcggaagg tagacttctg ccacttcagc 780

gaggtcaatg ttttctccga tgcctcgaag ttcaatgact tctttttggg tcagcacctg 840

aggcattgag tttctcagct cgcgccattg tgcgcggtcg aaatcaaggt aggggctgaa 900

atctggtgtg cgtggggaag gtttcacccg ttgaaaacta aaaagctggg aaggtgaatc 960

gaatttcggg gctttaaagc aaaaatgaac agcttggtct atagtggcta ggtacccttt 1020

ttgttttgga cacatgtagg gtggccgaaa caaagtaaaa ggaggacaac catgaccgat 1080

gcccaccaag cggacgatgt ccgttaccag ccactgaacg agcttgatcc tgaggtggct 1140

gctgccatcg ctggggaact tgcccgtcaa cgcgatacat tagagatgat cgcgtctgag 1200

aacttcgttc cccgttctgt tttgcaggcg cagggttctg ttcttaccaa taagtatgcc 1260

gagggttacc ctggccgccg ttactacggt ggttgcgaac aagttgacat cattgaggat 1320

cttgcacgtg atcgtgcgaa ggctctcttc ggtgcagagt tcgccaatgt tcagcctcac 1380

tctggcgcac aggctaatgc tgctgtgctg atgactttgg ctgagccagg cgacaagatc 1440

atgggtctgt ctttggctca tggtggtcac ttgacccacg gaatgaagtt gaacttctcc 1500

ggaaagctgt acgaggttgt tgcgtacggt gttgatcctg agaccatgcg tgttgatatg 1560

gatcaggttc gtgagattgc tctgaaggag cagccaaagg taattatcgc tggctggtct 1620

gcataccctc gccaccttga tttcgaggct ttccagtcta ttgctgcgga agttggcgcg 1680

aagctgtggg tcgatatggc tcacttcgct ggtcttgttg ctgctggttt gcacccaagc 1740

ccagttcctt actctgatgt tgtttcttcc actgtccaca agactttggg tggacctcgt 1800

tccggcatca ttctggctaa gcaggagtac gcgaagaagc tgaactcttc cgtattccca 1860

ggtcagcagg gtggtccttt gatgcacgca gttgctgcga aggctacttc tttgaagatt 1920

gctggcactg agcagttccg tgaccgtcag gctcgcacgt tggagggtgc tcgcat 1976

<210> 3

<211> 1624

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 3

aaaggaggac aagatggcac aacagactcc tttgtacgaa caacacacgc tttgcggcgc 60

tcgcatggtg gatttccacg gctggatgat gccgctgcat tacggttcgc aaatcgacga 120

acatcatgcg gtacgtaccg atgccggaat gtttgatgtg tcacatatga ccatcgtcga 180

tcttcgcggc agccgcaccc gggagtttct gcgttatctg ctggcgaacg atgtggcgaa 240

gctcaccaaa agcggcaaag ccctttactc ggggatgttg aatgcctctg gcggtgtgat 300

agatgacctc atcgtctact actttactga agatttcttc cgcctcgttg ttaactccgc 360

cacccgcgaa aaagacctct cctggattac ccaacacgct gaacctttcg gcatcgaaat 420

taccgttcgt gatgaccttt ccatgattgc cgtgcaaggg ccgaatgcgc aggcaaaagc 480

tgccacactg tttaatgacg cccagcgtca ggcggtggaa gggatgaaac cgttctttgg 540

cgtgcaggcg ggcgatctgt ttattgccac cactggttat accggtgaag cgggctatga 600

aattgcgctg cccaatgaaa aagcggccga tttctggcgt gcgctggtgg aagcgggtgt 660

taagccatgt ggcttgggcg cgcgtgacac gctgcgtctg gaagcgggca tgaatcttta 720

tggtcaggag atggacgaaa ccatctctcc tttagccgcc aacatgggct ggaccatcgc 780

ctgggaaccg gcagatcgtg actttatcgg tcgtgaagcc ctggaagtgc agcgtgagca 840

tggtacagaa aaactggttg gtctggtgat gaccgaaaaa ggcgtgctgc gtaatgaact 900

gccggtacgc tttaccgatg cgcagggcaa ccagcatgaa ggcattatca ccagcggtac 960

tttctccccg acgctgggtt acagcattgc gctggcgcgc gtgccggaag gtattggcga 1020

aacggcgatt gtgcaaattc gcaaccgtga aatgccggtt aaagtgacaa aacctgtttt 1080

tgtgcgtaac ggcaaagccg tcgcgtgatt tacttttttg gagattgatt gatgagcaac 1140

gtaccagcag aactgaaata cagcaaagaa cacgaatggc tgcgtaaaga agccgacggc 1200

acttacaccg ttggtattac cgaacatgct caggagctgt taggcgatat ggtgtttgtt 1260

gacctgccgg aagtgggcgc aacggttagc gcgggcgatg actgcgcggt tgccgaatcg 1320

gtaaaagcgg cgtcagacat ttatgcgcca gtaagcggtg aaatcgtggc ggtaaacgac 1380

gcactgagcg attccccgga actggtgaac agcgaaccgt atgcaggcgg ctggatcttt 1440

aaaatcaaag ccagcgatga aagcgaactg gaatcactgc tggatgcgac cgcatacgaa 1500

gcattgttag aagacgagta acggctttat tcctcttctg cgggagagga tcagggtgag 1560

gaaaatttat gcctcaccct cactctcttc gtaaggagag aggttcacaa ttcactgcac 1620

gttt 1624

<210> 4

<211> 2896

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 4

aaaggaggaa ccatcgctca tgacacagac gttaagccag cttgaaaaca gcggcgcttt 60

tattgaacgc catatcggac cggacgccgc gcaacagcaa gaaatgctga atgccgttgg 120

tgcacaatcg ttaaacgcgc tgaccggcca gattgtgccg aaagatattc aacttgcgac 180

accaccgcag gttggcgcac cggcgaccga atacgccgca ctggcagaac tcaaggctat 240

tgccagtcgc aataaacgct tcacgtctta catcggcatg ggttacaccg ccgtgcagct 300

accgccggtt atcctgcgta acatgctgga aaatccgggc tggtataccg cgtacactcc 360

gtatcaacct gaagtctccc agggccgcct tgaagcactg ctcaacttcc agcaggtaac 420

gctggatttg actggactgg atatggcctc tgcttctctt ctggacgagg ccaccgctgc 480

cgccgaagca atggcgatgg cgaaacgcgt cagcaaactg aaaaatgcca accgcttctt 540

cgtggcttcc gatgtgcatc cgcaaacgct ggatgtggtc cgtactcgtg ccgaaacctt 600

tggttttgaa gtgattgtcg atgacgcgca aaaagtgctc gaccatcagg acgtcttcgg 660

cgtgctgtta cagcaggtag gcactaccgg tgaaattcac gactacactg cgcttattag 720

cgaactgaaa tcacgcaaaa ttgtggtcag cgttgccgcc gatattatgg cgctggtgct 780

gttaactgcg ccgggtaaac agggcgcgga tattgttttt ggttcggcgc aacgcttcgg 840

cgtgccgatg ggctacggtg gcccacacgc ggcattcttt gcggcgaaag atgaatacaa 900

acgctcaatg ccgggccgta ttatcggtgt atcgaaagat gcagctggca ataccgcgct 960

gcgcatggcg atgcagactc gcgagcaaca tatccgccgt gagaaagcga actccaacat 1020

ttgtacttcc caggtactgc tggcaaacat cgccagcctg tatgccgttt atcacggccc 1080

ggttggcctg aaacgtatcg ctaaccgcat tcaccgtctg accgatatcc tggcggcggg 1140

cctgcaacaa aaaggtctga aactgcgcca tgcgcactat ttcgacacct tgtgtgtgga 1200

agtggccgac aaagcgggcg tactgacgcg tgccgaagcg gctgaaatca acctgcgtag 1260

cgatattctg aacgcggttg ggatcaccct tgatgaaaca accacgcgtg aaaacgtaat 1320

gcagcttttc aacgtgctgc tgggcgataa ccacggcctg gacatcgaca cgctggacaa 1380

agacgtggct cacgacagcc gctctatcca gcctgcgatg ctgcgcgacg acgaaatcct 1440

cacccatccg gtgtttaatc gctaccacag cgaaaccgaa atgatgcgct atatgcactc 1500

gctggagcgt aaagatctgg cgctgaatca ggcgatgatc ccgctgggtt cctgcaccat 1560

gaaactgaac gccgccgccg agatgatccc aatcacctgg ccggaatttg ccgaactgca 1620

cccgttctgc ccgccggagc aggccgaagg ttatcagcag atgattgcgc agctggctga 1680

ctggctggtg aaactgaccg gttacgacgc cgtttgtatg cagccgaact ctggcgcaca 1740

gggcgaatac gcgggcctgc tggcgattcg tcattatcat gaaagccgca acgaagggca 1800

tcgcgatatc tgcctgatcc cggcttctgc gcacggaact aaccccgctt ctgcacatat 1860

ggcaggaatg caggtggtgg ttgtggcgtg tgataaaaac ggcaacatcg atctgactga 1920

tctgcgcgcg aaagcggaac aggcgggcga taacctctcc tgtatcatgg tgacttatcc 1980

ttctacccac ggcgtgtatg aagaaacgat ccgtgaagtg tgtgaagtcg tgcatcagtt 2040

cggcggtcag gtttaccttg atggcgcgaa catgaacgcc caggttggca tcacctcgcc 2100

gggctttatt ggtgcggacg tttcacacct taacctacat aaaactttct gcattccgca 2160

cggcggtggt ggtccgggta tgggaccgat cggcgtgaaa gcgcatttgg caccgtttgt 2220

accgggtcat agcgtggtgc aaatcgaagg catgttaacc cgtcagggcg cggtttctgc 2280

ggcaccgttc ggtagcgcct ctatcctgcc aatcagctgg atgtacatcc gcatgatggg 2340

cgcagaaggg ctgaaaaaag caagccaggt ggcaatcctc aacgccaact atattgccag 2400

ccgcctgcag gatgccttcc cggtgctgta taccggtcgc gacggtcgcg tggcgcacga 2460

atgtattctc gatattcgcc cgctgaaaga agaaaccggc atcagcgagc tggatattgc 2520

caagcgcctg atcgactacg gtttccacgc gccgacgatg tcgttcccgg tggcgggtac 2580

gctgatggtt gaaccgactg aatctgaaag caaagtggaa ctggatcgct ttatcgacgc 2640

gatgctggct atccgcgcag aaattgacca ggtgaaagcc ggtgtctggc cgctggaaga 2700

taacccgctg gtgaacgcgc cgcacattca gagcgaactg gtcgccgagt gggcgcatcc 2760

gtacagccgt gaagttgcgg tattcccggc aggtgtggca gacaaatact ggccgacagt 2820

gaaacgtctg gatgatgttt acggcgaccg taacctgttc tgctcctgcg taccgattag 2880

cgaataccag taattc 2896

<210> 5

<211> 1182

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 5

atcaacgcag aaacccgatg cattcagctc gacgccggtg ttgcagtaaa gaaggacggc 60

gtggtgctgg gtacctcaga tatggcgagg tccctgcctc gaaccgccgc tggccaagaa 120

gcctatgagt acttcttcaa ggtggttcgt gaaggcatca tcgggcagct gcgcccgggc 180

gtgatctgcg ctgacgtgca cgaagcaacc cttgattacc taagcccgca gctacctcgc 240

atgattgaca tcggaatgct gggtgccgac accgatttca acaccatcta ccgcaagcgc 300

aatgttggcc acctcatggg caagcaggaa tcctttgcca atgagcttcg ccctggatac 360

aagcacattc ttcaccacgg ctcctatggt gccgcggaga tcccttggcg ctacaacggt 420

gtagccattg gtaccgagga tctgtggtac atcggcgcag acaagaccta cattttgagc 480

cagcgctaag gagaacccag tgacagaaat tgcagaaaac cttcagcgct tgggtattga 540

attacctgat ctaccagcac cgcagtattc ctacgtaccg ttcaaccgcc aaggaaacac 600

cctctatgta tcggggcaga tttcacgaac cgcagcggga gacatcctcg ccggacgagt 660

tggcgaagac gcaacattag aagaaggaat ccacgccgca gaggtagcca ccatcaatct 720

gctggccaga atccaccaat ccatcggttt agacaatgtg gcccaaattc tgaaactgaa 780

tgtgtgggtc aatagctccg atgactttat tcagcagcct caagtggccg acggtgcatc 840

ccagctcctt gaggcagtgt tgggtgaggc cggaaaacat gcacgcacag cactacccac 900

aaatactctc ccccagggag cactagtgga attggatgct gtcgttgcgg tcaccgaggc 960

cgccgaagtt taggacgcgt gggcgaaaat ttcagcaacc gtatcgtgtt tttctgtgat 1020

cctcattcgc cgtggcagcg tgggtcgaat gagaatacga atggattggt cagggatttt 1080

ttcccgaagg gcactaattt tgctaaagta agtgacgaag aagttcagcg ggcacaggat 1140

ctgctgaatt accggccgcg gaaaatgcat ggttttaaaa gc 1182

<210> 6

<211> 649

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 6

gtcggggcct ttcactgcac gaggtgcctg gccctgattg atctccgcgt tacgcttcca 60

tgtagatggc ttgaaggcct tccacagcaa gacgattgcg acgataacca aaataatcag 120

caaaagccta cccacttgaa cctctcctta aatatttgct tcaacctccc acaatacgga 180

actttgaggc attcttgggt atcggtatgt attgagtagg gttgaatatg tgagtgagtc 240

caataccccc aatctccaga cacaccaagc gccggaatta aacccggaac tacaaaaagc 300

tgcccggaaa aacgtgctga tttacggtct ggcacgtttg cttctgttcg tcgtgctgac 360

cttgattatt catagcctgg ctctgctgat tagtgcgcct gtgccactcg ttatgtctgc 420

gatgctggct ctgattgtgg cgttcccatt gtccatgctg gtgttcagca aactgcgcat 480

gaatgccacc caggctgttt cccagtggga tgcacagcgc aaggcccaca aggaatgggt 540

tcgaagcgag ctggcggacc gctaaaaaat tcccctcgtt ctttgcggaa gcgagaggaa 600

aggggagggg agcgtcgaaa agcgttttag ctaaacgcta atgccaggc 649

<210> 7

<211> 721

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> gene

<222> (1)..(544)

<223> Escherichia coli coligccvTH partial sequence

<400> 7

tgtgcgtaac ggcaaagccg tcgcgtgatt tacttttttg gagattgatt gatgagcaac 60

gtaccagcag aactgaaata cagcaaagaa cacgaatggc tgcgtaaaga agccgacggc 120

acttacaccg ttggtattac cgaacatgct caggagctgt taggcgatat ggtgtttgtt 180

gacctgccgg aagtgggcgc aacggttagc gcgggcgatg actgcgcggt tgccgaatcg 240

gtaaaagcgg cgtcagacat ttatgcgcca gtaagcggtg aaatcgtggc ggtaaacgac 300

gcactgagcg attccccgga actggtgaac agcgaaccgt atgcaggcgg ctggatcttt 360

aaaatcaaag ccagcgatga aagcgaactg gaatcactgc tggatgcgac cgcatacgaa 420

gcattgttag aagacgagta acggctttat tcctcttctg cgggagagga tcagggtgag 480

gaaaatttat gcctcaccct cactctcttc gtaaggagag aggttcacaa ttcactgcac 540

gtttgtgttt ttctgtgatc ctcattcgcc gtggcagcgt gggtcgaatg agaatacgaa 600

tggattggtc agggattttt tcccgaaggg cactaatttt gctaaagtaa gtgacgaaga 660

agttcagcgg gcacaggatc tgctgaatta ccggccgcgg aaaatgcatg gttttaaaag 720

c 721

<210> 8

<211> 920

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 8

atcggtatcg gaccatcatc ctcacatacc gtcggcccca tgagagccgc cctcacgtat 60

atctctgaat ttcccagctc gcatgtcgat atcacgttgc acggatccct tgccgccacc 120

ggtaaaggcc actgcactga ccgggcggta ttactgggtc tggtgggatg ggaaccaacg 180

atagttccca ttgatgctgc accctcaccc ggcgcgccga ttcctgcgaa aggttctgtg 240

aacgggccaa agggaacggt gtcgtattcc ctgacgtttg atcctcatcc tcttccagaa 300

caccccaatg ccgttacctt taaaggatca accacaagga cttatttgtc ggtgggtggt 360

gggttcatta tgacgttgga ggatttccgg aagctggacg atatcggatc aggtgtgtca 420

accattcatc cagaggcagc gggatttttt gacaggtttt ggggcggagc aggcgcggac 480

gtttttgtat accgcgggtg cggtgggcat catcattaag gaaaatgcct cgatctctgg 540

cgcggaggtg gggtgtcagg gtgaggttgg ttcagcgtcc gcgatggcgg ctgccgggtt 600

gtgtgcagtc ttaggtggtt ctccgcaaca ggtggaaaac gccgcggaga ttgcgttgga 660

gcacaatttg ggattgacgt gcgatccggt gggcgggtta gtgcagattc cgtgtattga 720

acgcaacgct attgctgcca tgaagtccat caatgcggca aggcttgccc ggattggtga 780

tggcaacaat cgcgtgagtt tggatgatgt ggtggtcacg atggctgcca ccggccggga 840

catgctgacc aaatataagg aaacgtccct tggtggtttg gcaaccacct tgggcttccc 900

ggtgtcgatg acggagtgtt 920

<210> 9

<211> 1534

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 9

gcctgttgta gacggacatt cctagttttt ccaggagtaa cttgtgagcc agaatggccg 60

tccggtagtc ctcatcgccg ataagcttgc gcagtccact gttgacgcgc ttggagatgc 120

agtagaagtc cgttgggttg acggacctaa ccgcccagaa ctgcttgatg cagttaagga 180

agcggacgca ctgctcgtgc gttctgctac cactgtcgat gctgaagtca tcgccgctgc 240

ccctaacttg aagatcgtcg gtcgtgccgg cgtgggcttg gacaacgttg acatccctgc 300

tgccactgaa gctggcgtca tggttgctaa cgcaccgacc tctaatattc actccgcttg 360

tgagcacgca atttctttgc tgctgtctac tgctcgccag atccctgctg ctgatgcgac 420

gctgcgtgag ggcgagtgga agcggtcttc tttcaacggt gtggaaattt tcggaaaaac 480

tgtcggtatc gtcggttttg gccacattgg tcagttgttt gctcagcgtc ttgctgcgtt 540

tgagaccacc attgttgctt acgatcctta cgctaaccct gctcgtgcgg ctcagctgaa 600

cgttgagttg gttgagttgg atgagctgat gagccgttct gactttgtca ccattcacct 660

tcctaagacc aaggaaactg ctggcatgtt tgatgcgcag ctccttgcta agtccaagaa 720

gggccagatc atcatcaacg ctgctcgtgg tggccttgtt gatgagcagg ctttggctga 780

tgcgattgag tccggtcaca ttcgtggcgc tggtttcgat gtgtactcca ccgagccttg 840

cactgattct cctttgttca agttgcctca ggttgttgtg actcctcact tgggtgcttc 900

tactgaagag gctcaggatc gtgcgggtac tgacgttgct gattctgtgc tcaaggcgct 960

ggctggcgag ttcgtggcgg atgctgtgaa cgtttccggt ggtcgcgtgg gcgaagaggt 1020

tgctgtgtgg atggatctgg cttaaggcgg ttttcgctct tttaatacag ttttaaaggt 1080

agatttggga gagaagattt cccttaagaa aggttcttaa caaccatgcc gcctgcgacg 1140

ctgttcaatg ttttgacttc agctggactt gaccctcacc agtcaggtga tgccattgtt 1200

gtcgagtctg cccatttcac attgacgttc acgtgggatg agtggctgcg agctcaagcg 1260

acgtgggtgg gggagttgag tgcgtcggat tatgtgcgtt ctattgtggc gattaactct 1320

gcccatgatg cacgggcaac gccgaagatg atgttggatg ccccgactgg tctgacaacg 1380

gtgcttaagg cggataaggg tcagttgcag gcgtttgccg tggaggcgct gccgattggc 1440

gatggcctca gcgaggctca gttggcgggg tttgtggctg ccgcgtttga tggcgccatc 1500

gacctcactc gtgagtttca tgcactttac ccgg 1534

<210> 10

<211> 593

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 10

agcgactgtt aaccactcaa gctctttgct tgggtggttt tttcatgtct caaggtcggg 60

tcgggtgcga ttcgggtcgg ttttgagtgt ctttgagtcc ttttaagtcc ttctttgccc 120

gtgaataatt ctctggatag tttccacgtg cagttaagtc acgctgttag acttgcctgc 180

atgctctcga caataaaaat gatccgtgaa gatctcgcaa acgctcgtga acacgatcca 240

gcagcccgag gcgatttaga aaatcttagg tcccatcacc atcggcgaag gctccgcaat 300

tggcgccaat gcagttgtca ccaaagacgt gccggcagaa cacatcgcag tcggaattcc 360

tgcggtagca cgcccacgtg gcaagacaga gaagatcaag ctcgtcgatc cggactatta 420

catttaagaa cagttagcgc cctacctgaa gttcaggcag ggcgcttttt tgggaagctc 480

cagagtgcgt ttgttagcca cgcactaggg acctttaacc gtctaaaacc gcccctgtgc 540

gcttctcagc actacccgtg agaaccaccc ccctgtgcca gctagttctt tag 593

<210> 11

<211> 1144

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 11

aaaggaggaa gacatgaccg acttccccac cctgccctct gagttcatcc ctggcgacgg 60

ccgtttcggc tgcggacctt ccaaggttcg accagaacag attcaggcta ttgtcgacgg 120

atccgcatcc gtcatcggta cctcacaccg tcagccggca gtaaaaaacg tcgtgggttc 180

aatccgcgag ggactctccg acctcttctc ccttccagaa ggctacgaga tcatcctttc 240

cctaggtggt gcgaccgcat tctgggatgc agcaaccttc ggactcattg aaaagaagtc 300

cggtcacctt tctttcggtg agttctcctc caagttcgca aaggcttcta agcttgctcc 360

ttggctcgac gagccagaga tcgtcaccgc agaaaccggt gactctccgg ccccacaggc 420

attcgaaggc gccgatgtta ttgcatgggc acacaacgaa acctccactg gcgccatggt 480

tccagttctt cgccccgaag gctctgaagg ctccctggtt gccattgacg caacctccgg 540

cgctggtgga ctgccagtag acatcaagaa ctccgatgtt tactacttct ccccacagaa 600

gtgcttcgca tccgacggtg gcctgtggct tgcagcgatg agcccagcag ctctcgagcg 660

catcgagaag atcaacgctt ccgatcgctt catccctgag ttcctcaacc tgcagaccgc 720

agtggataac tccctgaaga accagaccta caacacccca gctgttgcta ccttgctgat 780

gctggacaac caggtcaagt ggatgaactc caacggcggc ctggatggaa tggttgctcg 840

caccacagca agctcctccg ccctgtacaa ctgggctgag gctcgcgagg aggcatcccc 900

atacgtggca gatgcagcta agcgctccct cgttgtcggc accatcgact tcgatgactc 960

catcgacgca gcagtgatcg ctaagatact gcgcgcaaac ggcatcctgg acaccgagcc 1020

ttaccgcaag ctgggacgca accagctgcg catcggtatg ttcccagcga tcgattccac 1080

cgatgtggaa aagctcaccg gagcaatcga cttcatcctc gatggcggtt ttgcaaggaa 1140

gtaa 1144

<210> 12

<211> 1332

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 12

aaaggaggag ttgccatgac tgaactcatc cagaatgaat cccaagaaat cgctgagctg 60

gaagccggcc agcaggttgc attgcgtgaa ggttatcttc ctgcggtgat cacagtgagc 120

ggtaaagacc gcccaggtgt gactgccgcg ttctttaggg tcttgtccgc taatcaggtt 180

caggtcttgg acgttgagca gtcaatgttc cgtggctttt tgaacttggc ggcgtttgtg 240

ggtatcgcac ctgagcgtgt cgagaccgtc accacaggcc tgactgacac cctcaaggtg 300

catggacagt ccgtggtggt ggagctgcag gaaactgtgc agtcgtcccg tcctcgttct 360

tcccatgttg ttgtggtgtt gggtgatccg gttgatgcgt tggatatttc ccgcattggt 420

cagaccctgg cggattacga tgccaacatt gacaccattc gtggtatttc ggattaccct 480

gtgaccggcc tggagctgaa ggtgactgtg ccggatgtca gccctggtgg tggtgaagcg 540

atgcgtaagg cgcttgctgc tcttacctct gagctgaatg tggatattgc gattgagcgt 600

tctggtttgc tgcgtcgttc taagcgtctg gtgtgcttcg attgtgattc cacgttgatc 660

actggtgagg tcattgagat gctggcggct cacgcgggca aggaagctga agttgcggca 720

gttactgagc gtgcgatgcg cggtgagctc gatttcgagg agtctctgcg tgagcgtgtg 780

aaggcgttgg ctggtttgga tgcgtcggtg atcgatgagg tcgctgccgc tattgagctg 840

acccctggtg cgcgcaccac gatccgtacg ctgaaccgca tgggttacca gaccgctgtt 900

gtttccggtg gtttcatcca ggtgttggaa ggtttggctg aggagttgga gttggattat 960

gtccgcgcca acactttgga aatcgttgat ggcaagctga ccggcaacgt caccggaaag 1020

atcgttgacc gcgctgcgaa ggctgagttc ctccgtgagt tcgctgcgga ttctggcctg 1080

aagatgtacc agactgtcgc tgtcggtgat ggcgctaatg acatcgatat gctctccgct 1140

gcgggtctgg gtgttgcttt caacgcgaag cctgcgctga aggagattgc ggatacttcc 1200

gtgaaccacc cattcctcga cgaggttttg cacatcatgg gcatttcccg cgacgagatc 1260

gatctggcgg atcaggaaga cggcactttc caccgcgttc cattgaccaa tgcctaaaga 1320

ttcgcttctc ga 1332

<210> 13

<211> 1016

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 13

aaaggaggaa acttgtgagc cagaatggcc gtccggtagt cctcatcgcc gataagcttg 60

cgcagtccac tgttgacgcg cttggagatg cagtagaagt ccgttgggtt gacggaccta 120

accgcccaga actgcttgat gcagttaagg aagcggacgc actgctcgtg cgttctgcta 180

ccactgtcga tgctgaagtc atcgccgctg cccctaactt gaagatcgtc ggtcgtgccg 240

gcgtgggctt ggacaacgtt gacatccctg ctgccactga agctggcgtc atggttgcta 300

acgcaccgac ctctaatatt cactccgctt gtgagcacgc aatttctttg ctgctgtcta 360

ctgctcgcca gatccctgct gctgatgcga cgctgcgtga gggcgagtgg aagcggtctt 420

ctttcaacgg tgtggaaatt ttcggaaaaa ctgtcggtat cgtcggtttt ggccacattg 480

gtcagttgtt tgctcagcgt cttgctgcgt ttgagaccac cattgttgct tacgatcctt 540

acgctaaccc tgctcgtgcg gctcagctga acgttgagtt ggttgagttg gatgagctga 600

tgagccgttc tgactttgtc accattcacc ttcctaagac caaggaaact gctggcatgt 660

ttgatgcgca gctccttgct aagtccaaga agggccagat catcatcaac gctgctcgtg 720

gtggccttgt tgatgagcag gctttggctg atgcgattga gtccggtcac attcgtggcg 780

ctggtttcga tgtgtactcc accgagcctt gcactgattc tcctttgttc aagttgcctc 840

aggttgttgt gactcctcac ttgggtgctt ctactgaaga ggctcaggat cgtgcgggta 900

ctgacgttgc tgattctgtg ctcaaggcgc tggctggcga gttcgtggcg gatgctgtga 960

acgtttccgg tggtcgcgtg ggcgaagagg ttgctgtgtg gatggatctg gcttaa 1016

<210> 14

<211> 1302

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 14

gccaaagcaa ccaaccccca aatcagcaat tgaccccaat caatattccc caccgtcgat 60

tccgttacat cctgtaccaa aagctccgtt cccagcacgt aatcagtggt cccaagcaaa 120

tcatgctgcc ctgactcaag cgccgccctc gaatgaacat cactcaccac cgcagccgac 180

attggagccc gcaccacaac ggtgtccaga tccgtttgaa tcaacagctc ctgcgcaata 240

tccctcaggt tggaagtcat cactggagtt tcatcaagaa tcacgacccc taaagatcca 300

aaatctgatt cctttgcatc tgtcacaaca ttaataaggt ctttttccaa agtcggaaac 360

tggttgcctg tgtgctcccc cattgccacg gcatcatcac caagctccga agcgagctgc 420

ttgagatcaa tattttctgg aatcatctaa aaaccttcat tagtgtcggg ctcacgaaag 480

agcgggaacc gactttactc aataagcaat gggggtgagt aagggggtga tagaaagtca 540

catcacgcac gtacccattt cgagcaaatc cgaccgttga aaactaaaaa gctgggaagg 600

tgaatcgaat ttcggggctt taaagcaaaa atgaacagct tggtctatag tggctaggta 660

ccctttttgt tttggacaca tgtagggtgg ccgaaacaaa gtagccgaag cagacgccgt 720

cgcgaaatct caccctaaaa aagttagaat tggagctcac tgtgactgaa agcaagaact 780

ccttcaatgc taagagcacc cttgaagttg gcgacaagtc ctatgactac ttcgccctct 840

ctgcagtgcc tggcatggag aagctgccgt actccctcaa ggttctcgga gagaaccttc 900

ttcgtaccga agacggcgca aacatcacca acgagcacat tgaggctatc gccaactggg 960

atgcatcttc cgatccaagc atcgaaatcc agttcacccc agcccgtgtt ctcatgcagg 1020

acttcaccgg tgtcccttgt gtagttgacc tcgcaaccat gcgtgaggca gttgctgcac 1080

tcggtggcga ccctaacgac gtcaacccac tgaacccagc cgagatggtc attgaccact 1140

ccgtcatcgt ggaggctttc ggccgcccag atgcactggc taagaacgtt gagatcgagt 1200

acgagcgcaa cgaggagcgt taccagttcc tgcgttgggg ttccgagtcc ttctccaact 1260

tccgcgttgt tcctccagga accggtatcg tccaccaggt ca 1302

<210> 15

<211> 1371

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 15

atccgtttga agactgttgc caccgcagtg tttacccgcc cagagatcgc agcagtaggt 60

atcacccatg cacaagttga ttccggcgaa gtgtctgctc gcgtgattgt gcttcctttg 120

gctactaacc cacgcgccaa gatgcgttcc ctgcgccacg gttttgtgaa gctgttctgc 180

cgccgtaact ctggcctgat catcggtggt gtcgtggtgg caccgaccgc gtctgagctg 240

atcctaccga tcgctgtggc agtgaccaac cgtctgacag ttgctgatct ggctgatacc 300

ttcgcggtgt acccatcatt gtcaggttcg attactgaag cagcacgtca gctggttcaa 360

catgatgatc taggctaatt tttctgagtc ttagattttg agaaaaccca ggattgcttt 420

gtgcactcct gggttttcac tttgttaagc agttttgggg aaaagtgcaa agtttgcaaa 480

gtttagaaat attttaagag gtaagatgtc tgcaggtgga agcgtttaaa tgcgttaaac 540

ttggccaaat gtggcaacct ttgcaaggtg aaaaactggg gcggggttag atcctggggg 600

gtttatttca ttcactttgg cttgaagtcg tgcaggtcag gggagtgttg cccgaaaaca 660

ttgagaggaa aacaaaaacc gatgtttgat tgggggaatc gggggttacg atactaggac 720

gcagtgagga gaccaaggct caaagggaat ccatgccgtc ttggtttaat actgcacccg 780

tctaatgaaa atcattacta ttaggtgtca tgatggacca tgcacacgat tcctgctcac 840

caactctgcg ccgtgatttg gaggtcactg gccagctcca acctgagaaa gctgtcgatt 900

tagcagcgcc gcacgaaggg aaggttgcca atataacgaa ggtgacctcc tcaaatatgg 960

agcacaccat cacgcaggcc tcaaaagcta aggaggtggt ggtgctcatt ggtcactccc 1020

tgctgcccac atttcaggat ttggaaaaag acattctgca ctttcaggca ggtaataaag 1080

ggcgattttc tgtagcgatt gttgatcctg atcgcagtgc agatgtggtt gccagattta 1140

ggccaaaaca gattccggtg gcatacgtgg tgaaagatgg cgccagcatt gcggagttca 1200

actcgctcaa caaggagccg gttgcacaat ggcttgatca ttttgtgtcg cgggaaacga 1260

tccccaatga aaaagagggg gacgtcgata agcaaataga cccgcgcctg tggcgggcag 1320

cggaattggt gaacgccggt gattttcgcg cggcgttggc gttgtatgag c 1371

<210> 16

<211> 1991

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 16

gggaaaagaa agcccctaag ccccgtgtta ttaaatggag actttttgga gacctcaagc 60

caaaaagggg cattttcatt aagaaaatac ccctttgacc tggtgttatt gagctggaga 120

agagacttga actctcaacc tacgcattac aagtgcgttg cgctgccaat tgcgccactc 180

cagcaccgca gatgctgatg atcaacaact acgaatacgt atcttagcgt atgtgtacat 240

cacaatggaa ttcggggcta gagtatctgg tgaaccgtgc ataaacgacc tgtgattgga 300

ctctttttcc ttgcaaaatg ttttccagcg gatgttgagt tttgcgaccc ttcgtggccg 360

catttcaaca gttgacgctg caaaagccgc acctccgcca tcgccactag ccccgattga 420

tctcactgac catagtcaag tggccggtgt gatgaatttg gctgcgagaa ttggcgatat 480

tttgctttct tcaggtacgt caaatagtga caccaaggta caagttcgag cagtgacctc 540

tgcgtacggt ttgtactaca cgcacgtgga tatcacgttg aatacgatca ccatcttcac 600

caacatcggt gtggagagga agatgccggt caacgtgttt catgttgtag gcaagttgga 660

caccaacttc tccaaactgt ctgaggttga ccgtttgatc cgttccattc aggctggtgc 720

gaccccgcct gaggttgccg agaaaatcct ggacgagttg gagcaatccc ctgcgtctta 780

tggtttccct gttgcgttgc ttggctgggc aatgatgggt ggtgctgttg ctgtgctgtt 840

gggtggtgga tggcaggttt ccctaattgc ttttattacc gcgttcacga tcattgccac 900

gacgtcattt ttgggaaaga agggtttgcc tactttcttc caaaatgttg ttggtggttt 960

tattgccacg ctgcctgcat cgattgctta ttctttggcg ttgcaatttg gtcttgagat 1020

caaaccgagc cagatcatcg catctggaat tgttgtgctg ttggcaggtt tgacactcgt 1080

gcaatctctg caggacggca tcacgggcgc tccggtgaca gcaagtgcac gatttttcga 1140

aacactcctg tttaccggcg gcattgttgc tggcgtgggt ttgggcattc agctttctga 1200

aatcttgcat gtcatgttgc ctgccatgga gtccgctgca gcacctaatt attcgtctac 1260

attcgcccgc attatcgctg gtggcgtcac cgcagcggcc ttcgcagtgg gttgttacgc 1320

ggagtggtcc tcggtgatta ttgcggggct tactgcgctg atgggttctg cgttttatta 1380

cctcttcgtt gtttatttag gccccgtctc tgccgctgcg attgctgcaa cagcagttgg 1440

tttcactggt ggtttgcttg cccgtcgatt cttgattcca ccgttgattg tggcgattgc 1500

cggcatcaca ccaatgcttc caggtctagc aatttaccgc ggaatgtacg ccaccctgaa 1560

tgatcaaaca ctcatgggtt tcaccaacat tgcggttgct ttagccactg cttcatcact 1620

tgccgctggc gtggttttgg gtgagtggat tgcccgcagg ctacgtcgtc caccacgctt 1680

caacccatac cgtgcattta ccaaggcgaa tgagttctcc ttccaggagg aagctgagca 1740

gaatcagcgc cggcagagaa aacgtccaaa gactaatcag agattcggta ataaaaggta 1800

aaaatcaacc tgcttaggcg tctttcgctt aaatagcgta gaatatcggg tcgatcgctt 1860

ttaaacactc aggaggatcc ttgccggcca aaatcacgga cactcgtccc accccagaat 1920

cccttcacgc tgttgaagag gaaaccgcag ccggtgcccg caggattgtt gccacctatt 1980

ctaaggactt c 1991

<210> 17

<211> 1350

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 17

atggctatca gtgttgttga tctatttagc atcggtatcg gaccatcatc ctcacatacc 60

gtcggcccca tgagagccgc cctcacgtat atctctgaat ttcccagctc gcatgtcgat 120

atcacgttgc acggatccct tgccgccacc ggtaaaggcc actgcactga ccgggcggta 180

ttactgggtc tggtgggatg ggaaccaacg atagttccca ttgatgctgc accctcaccc 240

ggcgcgccga ttcctgcgaa aggttctgtg aacgggccaa agggaacggt gtcgtattcc 300

ctgacgtttg atcctcatcc tcttccagaa caccccaatg ccgttacctt taaaggatca 360

accacaagga cttatttgtc ggtgggtggt gggttcatta tgacgttgga ggatttccgg 420

aagctggacg atatcggatc aggtgtgtca accattcatc cagaggcaga ggtgccttgt 480

ccttttcaga agagttccca attactcgca tatggtcgcg attttgcgga ggtcatgaag 540

gataatgagc gcttaatcca cggggatctt ggcacagtgg atgcccattt ggatcgagtg 600

tggcagatta tgcaggagtg cgtggcacaa ggcatcgcaa cgccggggat tttaccgggt 660

gggttgaatg tgcaacgtcg ggcgccgcag gtacacgcgc tgattagcaa cggggatacg 720

tgtgagctgg gtgctgatct tgatgctgtg gagtgggtga atctgtacgc cttggcggtg 780

aatgaagaaa acgccgctgg tggtcgtgtg gttactgctc cgactaatgg tgctgcgggg 840

attattccgg cggtgatgca ctatgcgcgg gattttttga caggttttgg ggcggagcag 900

gcgcggacgt ttttgtatac cgcgggtgcg gtgggcatca tcattaagga aaatgcctcg 960

atctctggcg cggaggtggg gtgtcagggt gaggttggtt cagcgtccgc gatggcggct 1020

gccgggttgt gtgcagtctt aggtggttct ccgcaacagg tggaaaacgc cgcggagatt 1080

gcgttggagc acaatttggg attgacgtgc gatccggtgg gcgggttagt gcagattccg 1140

tgtattgaac gcaacgctat tgctgccatg aagtccatca atgcggcaag gcttgcccgg 1200

attggtgatg gcaacaatcg cgtgagtttg gatgatgtgg tggtcacgat ggctgccacc 1260

ggccgggaca tgctgaccaa atataaggaa acgtcccttg gtggtttggc aaccaccttg 1320

ggcttcccgg tgtcgatgac ggagtgttag 1350

<210> 18

<211> 1593

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 18

gtgagccaga atggccgtcc ggtagtcctc atcgccgata agcttgcgca gtccactgtt 60

gacgcgcttg gagatgcagt agaagtccgt tgggttgacg gacctaaccg cccagaactg 120

cttgatgcag ttaaggaagc ggacgcactg ctcgtgcgtt ctgctaccac tgtcgatgct 180

gaagtcatcg ccgctgcccc taacttgaag atcgtcggtc gtgccggcgt gggcttggac 240

aacgttgaca tccctgctgc cactgaagct ggcgtcatgg ttgctaacgc accgacctct 300

aatattcact ccgcttgtga gcacgcaatt tctttgctgc tgtctactgc tcgccagatc 360

cctgctgctg atgcgacgct gcgtgagggc gagtggaagc ggtcttcttt caacggtgtg 420

gaaattttcg gaaaaactgt cggtatcgtc ggttttggcc acattggtca gttgtttgct 480

cagcgtcttg ctgcgtttga gaccaccatt gttgcttacg atccttacgc taaccctgct 540

cgtgcggctc agctgaacgt tgagttggtt gagttggatg agctgatgag ccgttctgac 600

tttgtcacca ttcaccttcc taagaccaag gaaactgctg gcatgtttga tgcgcagctc 660

cttgctaagt ccaagaaggg ccagatcatc atcaacgctg ctcgtggtgg ccttgttgat 720

gagcaggctt tggctgatgc gattgagtcc ggtcacattc gtggcgctgg tttcgatgtg 780

tactccaccg agccttgcac tgattctcct ttgttcaagt tgcctcaggt tgttgtgact 840

cctcacttgg gtgcttctac tgaagaggct caggatcgtg cgggtactga cgttgctgat 900

tctgtgctca aggcgctggc tggcgagttc gtggcggatg ctgtgaacgt ttccggtggt 960

cgcgtgggcg aagaggttgc tgtgtggatg gatctggctc gcaagcttgg tcttcttgct 1020

ggcaagcttg tcgacgccgc cccagtctcc attgaggttg aggctcgagg cgagctttct 1080

tccgagcagg tcgatgcact tggtttgtcc gctgttcgtg gtttgttctc cggaattatc 1140

gaagagtccg ttactttcgt caacgctcct cgcattgctg aagagcgtgg cctggacatc 1200

tccgtgaaga ccaactctga gtctgttact caccgttccg tcctgcaggt caaggtcatt 1260

actggcagcg gcgcgagcgc aactgttgtt ggtgccctga ctggtcttga gcgcgttgag 1320

aagatcaccc gcatcaatgg ccgtggcctg gatctgcgcg cagagggtct gaacctcttc 1380

ctgcagtaca ctgacgctcc tggtgcactg ggtaccgttg gtaccaagct gggtgctgct 1440

ggcatcaaca tcgaggctgc tgcgttgact caggctgaga agggtgacgg cgctgtcctg 1500

atcctgcgtg ttgagtccgc tgtctctgaa gagctggaag ctgaaatcaa cgctgagttg 1560

ggtgctactt ccttccaggt tgatcttgac taa 1593

<210> 19

<211> 549

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 19

atgatccgtg aagatctcgc aaacgctcgt gaacacgatc cagcagcccg aggcgattta 60

gaaaacgcag tggtttactc cggactccac gccatctggg cacatcgagt tgccaacagc 120

tggtggaaat ccggtttccg cggccccgcc cgcgtattag cccaattcac ccgattcctc 180

accggcattg aaattcaccc cggtgccacc attggtcgtc gcttttttat tgaccacgga 240

atgggaatcg tcatcggcga aaccgctgaa atcggcgaag gcgtcatgct ctaccacggc 300

gtcaccctcg gcggacaggt tctcacccaa accaagcgcc accccacgct ctgcgacaac 360

gtgacagtcg gcgcgggcgc aaaaatctta ggtcccatca ccatcggcga aggctccgca 420

attggcgcca atgcagttgt caccaaagac gtgccggcag aacacatcgc agtcggaatt 480

cctgcggtag cacgcccacg tggcaagaca gagaagatca agctcgtcga tccggactat 540

tacatttaa 549

<210> 20

<211> 1305

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 20

atgaccgatg cccaccaagc ggacgatgtc cgttaccagc cactgaacga gcttgatcct 60

gaggtggctg ctgccatcgc tggggaactt gcccgtcaac gcgatacatt agagatgatc 120

gcgtctgaga acttcgttcc ccgttctgtt ttgcaggcgc agggttctgt tcttaccaat 180

aagtatgccg agggttaccc tggccgccgt tactacggtg gttgcgaaca agttgacatc 240

attgaggatc ttgcacgtga tcgtgcgaag gctctcttcg gtgcagagtt cgccaatgtt 300

cagcctcact ctggcgcaca ggctaatgct gctgtgctga tgactttggc tgagccaggc 360

gacaagatca tgggtctgtc tttggctcat ggtggtcact tgacccacgg aatgaagttg 420

aacttctccg gaaagctgta cgaggttgtt gcgtacggtg ttgatcctga gaccatgcgt 480

gttgatatgg atcaggttcg tgagattgct ctgaaggagc agccaaaggt aattatcgct 540

ggctggtctg cataccctcg ccaccttgat ttcgaggctt tccagtctat tgctgcggaa 600

gttggcgcga agctgtgggt cgatatggct cacttcgctg gtcttgttgc tgctggtttg 660

cacccaagcc cagttcctta ctctgatgtt gtttcttcca ctgtccacaa gactttgggt 720

ggacctcgtt ccggcatcat tctggctaag caggagtacg cgaagaagct gaactcttcc 780

gtattcccag gtcagcaggg tggtcctttg atgcacgcag ttgctgcgaa ggctacttct 840

ttgaagattg ctggcactga gcagttccgt gaccgtcagg ctcgcacgtt ggagggtgct 900

cgcattcttg ctgagcgtct gactgcttct gatgcgaagg ccgctggcgt ggatgtcttg 960

accggtggca ctgatgtgca cttggttttg gctgatctgc gtaactccca gatggatggc 1020

cagcaggcgg aagatctgct gcacgaggtt ggtatcactg tgaaccgtaa cgcggttcct 1080

ttcgatcctc gtccaccaat ggttacttct ggtctgcgta ttggtactcc tgcgctggct 1140

acccgtggtt tcgatattcc tgcattcact gaggttgcag acatcattgg tactgctttg 1200

gctaatggta agtccgcaga cattgagtct ctgcgtggcc gtgtagcaaa gcttgctgca 1260

gattacccac tgtatgaggg cttggaagac tggaccatcg tctaa 1305

<210> 21

<211> 2832

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 21

ttggagctca ctgtgactga aagcaagaac tccttcaatg ctaagagcac ccttgaagtt 60

ggcgacaagt cctatgacta cttcgccctc tctgcagtgc ctggcatgga gaagctgccg 120

tactccctca aggttctcgg agagaacctt cttcgtaccg aagacggcgc aaacatcacc 180

aacgagcaca ttgaggctat cgccaactgg gatgcatctt ccgatccaag catcgaaatc 240

cagttcaccc cagcccgtgt tctcatgcag gacttcaccg gtgtcccttg tgtagttgac 300

ctcgcaacca tgcgtgaggc agttgctgca ctcggtggcg accctaacga cgtcaaccca 360

ctgaacccag ccgagatggt cattgaccac tccgtcatcg tggaggcttt cggccgccca 420

gatgcactgg ctaagaacgt tgagatcgag tacgagcgca acgaggagcg ttaccagttc 480

ctgcgttggg gttccgagtc cttctccaac ttccgcgttg ttcctccagg aaccggtatc 540

gtccaccagg tcaacattga gtacttggct cgcgtcgtct tcgacaacga gggccttgca 600

tacccagata cctgcatcgg taccgactcc cacaccacca tggaaaacgg cctgggcatc 660

ctgggctggg gcgttggtgg cattgaggct gaagcagcaa tgctcggcca gccagtgtcc 720

atgctgatcc ctcgcgttgt tggcttcaag ttgaccggcg agatcccagt aggcgttacc 780

gcaactgacg ttgtgctgac catcaccgaa atgctgcgcg accacggcgt cgtccagaag 840

ttcgttgagt tctacggctc cggtgttaag gctgttccac tggctaaccg tgcaaccatc 900

ggcaacatgt ccccagagtt cggctccacc tgtgcgatgt tcccaatcga cgaggagacc 960

accaagtacc tgcgcctcac cggccgccca gaagagcagg ttgcactggt cgaggcttac 1020

gccaaggcgc agggcatgtg gctcgacgag gacaccgttg aagctgagta ctccgagtac 1080

ctcgagctgg acctgtccac cgttgttcct tccatcgctg gccctaagcg cccacaggac 1140

cgcatccttc tctccgaggc aaaggagcag ttccgtaagg atctgccaac ctacaccgac 1200

gacgctgttt ccgtagacac ctccatccct gcaacccgca tggttaacga aggtggcgga 1260

cagcctgaag gcggcgtcga agctgacaac tacaacgctt cctgggctgg ctccggcgag 1320

tccttggcta ctggcgcaga aggacgtcct tccaagccag tcaccgttgc atccccacag 1380

ggtggcgagt acaccatcga ccacggcatg gttgcaattg catccatcac ctcttgcacc 1440

aacacctcta acccatccgt gatgatcggc gctggcctga tcgcacgtaa ggcagcagaa 1500

aagggcctca agtccaagcc ttgggttaag accatctgtg caccaggttc ccaggttgtc 1560

gacggctact accagcgcgc agacctctgg aaggaccttg aggccatggg cttctacctc 1620

tccggcttcg gctgcaccac ctgtattggt aactccggcc cactgccaga ggaaatctcc 1680

gctgcgatca acgagcacga cctgaccgca accgcagttt tgtccggtaa ccgtaacttc 1740

gagggacgta tctcccctga cgttaagatg aactacctgg catccccaat catggtcatt 1800

gcttacgcaa tcgctggcac catggacttc gacttcgaga acgaagctct tggacaggac 1860

caggacggca acgacgtctt cctgaaggac atctggcctt ccaccgagga aatcgaagac 1920

accatccagc aggcaatctc ccgtgagctt tacgaagctg actacgcaga tgtcttcaag 1980

ggtgacaagc agtggcagga actcgatgtt cctaccggtg acaccttcga gtgggacgag 2040

aactccacct acatccgcaa ggcaccttac ttcgacggca tgcctgtcga gccagtggca 2100

gtcaccgaca tccagggcgc acgcgttctg gctaagctcg gcgactctgt caccaccgac 2160

cacatctccc ctgcttcctc cattaagcca ggtacccctg cagctcagta cttggatgag 2220

cacggtgtgg aacgccacga ctacaactcc ctgggttcca ggcgtggtaa ccacgaggtc 2280

atgatgcgcg gcaccttcgc caacatccgc ctccagaacc agctggttga catcgcaggt 2340

ggctacaccc gcgacttcac ccaggagggt gctccacagg cgttcatcta cgacgcttcc 2400

gtcaactaca aggctgctgg cattccgctg gtcgtcttgg gcggcaagga gtacggcacc 2460

ggttcttccc gtgactgggc agctaagggc actaacctgc tcggaattcg cgcagttatc 2520

accgagtcct tcgagcgtat tcaccgctcc aacctcatcg gtatgggcgt tgtcccactg 2580

cagttccctg caggcgaatc ccacgagtcc ctgggccttg acggcaccga gaccttcgac 2640

atcaccggac tgaccgcact caacgagggc gagactccta agactgtcaa ggtcaccgca 2700

accaaggaga acggcgacgt cgtcgagttc gacgcagttg tccgcatcga caccccaggt 2760

gaggctgact actaccgcca cggcggcatc ctgcagtacg tgctgcgtca gatggctgct 2820

tcttctaagt aa 2832

<210> 22

<211> 3423

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 22

gtgtcgactc acacatcttc aacgcttcca gcattcaaaa agatcttggt agcaaaccgc 60

ggcgaaatcg cggtccgtgc tttccgtgca gcactcgaaa ccggtgcagc cacggtagct 120

atttaccccc gtgaagatcg gggatcattc caccgctctt ttgcttctga agctgtccgc 180

attggtaccg aaggctcacc agtcaaggcg tacctggaca tcgatgaaat tatcggtgca 240

gctaaaaaag ttaaagcaga tgccatttac ccgggatacg gcttcctgtc tgaaaatgcc 300

cagcttgccc gcgagtgtgc ggaaaacggc attactttta ttggcccaac cccagaggtt 360

cttgatctca ccggtgataa gtctcgcgcg gtaaccgccg cgaagaaggc tggtctgcca 420

gttttggcgg aatccacccc gagcaaaaac atcgatgaga tcgttaaaag cgctgaaggc 480

cagacttacc ccatctttgt gaaggcagtt gccggtggtg gcggacgcgg tatgcgtttt 540

gttgcttcac ctgatgagct tcgcaaatta gcaacagaag catctcgtga agctgaagcg 600

gctttcggcg atggcgcggt atatgtcgaa cgtgctgtga ttaaccctca gcatattgaa 660

gtgcagatcc ttggcgatca cactggagaa gttgtacacc tttatgaacg tgactgctca 720

ctgcagcgtc gtcaccaaaa agttgtcgaa attgcgccag cacagcattt ggatccagaa 780

ctgcgtgatc gcatttgtgc ggatgcagta aagttctgcc gctccattgg ttaccagggc 840

gcgggaaccg tggaattctt ggtcgatgaa aagggcaacc acgtcttcat cgaaatgaac 900

ccacgtatcc aggttgagca caccgtgact gaagaagtca ccgaggtgga cctggtgaag 960

gcgcagatgc gcttggctgc tggtgcaacc ttgaaggaat tgggtctgac ccaagataag 1020

atcaagaccc acggtgcagc actgcagtgc cgcatcacca cggaagatcc aaacaacggc 1080

ttccgcccag ataccggaac tatcaccgcg taccgctcac caggcggagc tggcgttcgt 1140

cttgacggtg cagctcagct cggtggcgaa atcaccgcac actttgactc catgctggtg 1200

aaaatgacct gccgtggttc cgactttgaa actgctgttg ctcgtgcaca gcgcgcgttg 1260

gctgagttca ccgtgtctgg tgttgcaacc aacattggtt tcttgcgtgc gttgctgcgg 1320

gaagaggact tcacttccaa gcgcatcgcc accggattca ttgccgatca cccgcacctc 1380

cttcaggctc cacctgctga tgatgagcag ggacgcatcc tggattactt ggcagatgtc 1440

accgtgaaca agcctcatgg tgtgcgtcca aaggatgttg cagctcctat cgataagctg 1500

cctaacatca aggatctgcc actgccacgc ggttcccgtg accgcctgaa gcagcttggc 1560

ccagccgcgt ttgctcgtga tctccgtgag caggacgcac tggcagttac tgataccacc 1620

ttccgcgatg cacaccagtc tttgcttgcg acccgagtcc gctcattcgc actgaagcct 1680

gcggcagagg ccgtcgcaaa gctgactcct gagcttttgt ccgtggaggc ctggggcggc 1740

gcgacctacg atgtggcgat gcgtttcctc tttgaggatc cgtgggacag gctcgacgag 1800

ctgcgcgagg cgatgccgaa tgtaaacatt cagatgctgc ttcgcggccg caacaccgtg 1860

ggatacaccc cgtacccaga ctccgtctgc cgcgcgtttg ttaaggaagc tgccagctcc 1920

ggcgtggaca tcttccgcat cttcgacgcg cttaacgacg tctcccagat gcgtccagca 1980

atcgacgcag tcctggagac caacaccgcg gtagccgagg tggctatggc ttattctggt 2040

gatctctctg atccaaatga aaagctctac accctggatt actacctaaa gatggcagag 2100

gagatcgtca agtctggcgc tcacatcttg gccattaagg atatggctgg tctgcttcgc 2160

ccagctgcgg taaccaagct ggtcaccgca ctgcgccgtg aattcgatct gccagtgcac 2220

gtgcacaccc acgacactgc gggtggccag ctggcaacct actttgctgc agctcaagct 2280

ggtgcagatg ctgttgacgg tgcttccgca ccactgtctg gcaccacctc ccagccatcc 2340

ctgtctgcca ttgttgctgc attcgcgcac acccgtcgcg ataccggttt gagcctcgag 2400

gctgtttctg acctcgagcc gtactgggaa gcagtgcgcg gactgtacct gccatttgag 2460

tctggaaccc caggcccaac cggtcgcgtc taccgccacg aaatcccagg cggacagttg 2520

tccaacctgc gtgcacaggc caccgcactg ggccttgcgg atcgtttcga actcatcgaa 2580

gacaactacg cagccgttaa tgagatgctg ggacgcccaa ccaaggtcac cccatcctcc 2640

aaggttgttg gcgacctcgc actccacctc gttggtgcgg gtgtggatcc agcagacttt 2700

gctgccgatc cacaaaagta cgacatccca gactctgtca tcgcgttcct gcgcggcgag 2760

cttggtaacc ctccaggtgg ctggccagag ccactgcgca cccgcgcact ggaaggccgc 2820

tccgaaggca aggcacctct gacggaagtt cctgaggaag agcaggcgca cctcgacgct 2880

gatgattcca aggaacgtcg caatagcctc aaccgcctgc tgttcccgaa gccaaccgaa 2940

gagttcctcg agcaccgtcg ccgcttcggc aacacctctg cgctggatga tcgtgaattc 3000

ttctacggcc tggtcgaagg ccgcgagact ttgatccgcc tgccagatgt gcgcacccca 3060

ctgcttgttc gcctggatgc gatctctgag ccagacgata agggtatgcg caatgttgtg 3120

gccaacgtca acggccagat ccgcccaatg cgtgtgcgtg accgctccgt tgagtctgtc 3180

accgcaaccg cagaaaaggc agattcctcc aacaagggcc atgttgctgc accattcgct 3240

ggtgttgtca ccgtgactgt tgctgaaggt gatgaggtca aggctggaga tgcagtcgca 3300

atcatcgagg ctatgaagat ggaagcaaca atcactgctt ctgttgacgg caaaatcgat 3360

cgcgttgtgg ttcctgctgc aacgaaggtg gaaggtggcg acttgatcgt cgtcgtttcc 3420

taa 3423

<210> 23

<211> 1454

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 23

tcgcttgttg gcaatgtgag cggtgagtta gctttcgacc aaaccacact gcccacgaat 60

cctagaaatg ggatccgtgg gcattcgtgt ctggtttaac ggccttgaaa ccggacagga 120

ttgcccaaag tagtcgaatt tccagttcgt gggcatgtgt gtttggtcag gtttagtcgg 180

gtcgaaaaat gaactcggaa tcggtaaaaa gtgacctcac agaatcgctt ctaagggccg 240

ttcaaagtgt tgcctataca aacacatgtt ctgactgccc gacctcttaa aatggcgtta 300

aatggcgcga aatggaaaac gcctcgtggc ctggatggag cgttagtacg agaccagtac 360

gagaccagac acacgtgaca aaaaatcctg aaaagtggaa tcattgtcac gcctgtctgg 420

tttagctctg gttcgggacg ggcgtggaat ggaggcagtg caccgagacc ttgacccgcg 480

gcccgacaag ccaaaagtcc ccaaaacaaa cccaccccgc cggagacgtg aataaaattc 540

gcagctcatt ccatcagcgt aaacgcagct ttttgcatgg tgagacacct ttgggggtaa 600

atctcacagc atgaatctgg ccgttaccct gcgaatgtcc acagggtagc tggtagtttg 660

aaaatcaacg ccgttgccct taggattcag taactggcac attttgtaat gcgctagatc 720

tgtgtgctca gtcttccagg ctgcttatca cagtgaaagc aaaaccaatt cgtggctgcg 780

aaagtcgtag ccaccacgaa gtccaggagg acatacagtg agccagaatg gccgtccggt 840

agtcctcatc gccgataagc ttgcgcagtc cactgttgac gcgcttggag atgcagtaga 900

agtccgttgg gttgacggac ctaaccgccc agaactgctt gatgcagtta aggaagcgga 960

cgcactgctc gtgcgttctg ctaccactgt cgatgctgaa gtcatcgccg ctgcccctaa 1020

cttgaagatc gtcggtcgtg ccggcgtggg cttggacaac gttgacatcc ctgctgccac 1080

tgaagctggc gtcatggttg ctaacgcacc gacctctaat attcactccg cttgtgagca 1140

cgcaatttct ttgctgctgt ctactgctcg ccagatccct gctgctgatg cgacgctgcg 1200

tgagggcgag tggaagcggt cttctttcaa cggtgtggaa attttcggaa aaactgtcgg 1260

tatcgtcggt tttggccaca ttggtcagtt gtttgctcag cgtcttgctg cgtttgagac 1320

caccattgtt gcttacgatc cttacgctaa ccctgctcgt gcggctcagc tgaacgttga 1380

gttggttgag ttggatgagc tgatgagccg ttctgacttt gtcaccattc accttcctaa 1440

gaccaaggaa actg 1454

<210> 24

<211> 1457

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 24

cagccttgtt gttatcagta gccacgatat ccctttcaaa catatttgtt cggaaaaaaa 60

ctcttccgga ttacggaagt agtcccgttt attcttacca actgggatgc gccaagcgca 120

tgtcagtttt tgttactcga cacatttctt tcccaatctg gtccggttaa cacgctatac 180

cgataaatgc ggtttagcca tatccgaagt gagagccaat tcccccacaa tcacgttggt 240

tacatcattc ccgaccaccc acagccaccg taatcagtag ccacggtcac gccaatagaa 300

ctcagatcaa ttgtgccgat gtgctgctat ttagttctgc accctcaagg ccagcattca 360

accccgctag agggtgaaaa tgctggcctt taaggcatta aaaatcccac aataagtgga 420

ctggtgcaca gtttagcaaa gtttgtgatg cacgcgacaa ggatgggtgc cgagtagctt 480

tccccatgca attcgccacc ctataacgca acctcagggg atattaacaa cctagaaatt 540

gaaaactttg caaaactttg agctaccccc aaattggtgg ctggtcaact aatccccgcg 600

ttttcaatag ttcggtgtcg ccagtttttg gccgttaccc tgcgaatgtc cacagggtag 660

ctggtagttt gaaaatcaac gccgttgccc ttaggattca gtaactggca cattttgtaa 720

tgcgctagat ctgtgtgctc agtcttccag gctgcttatc acagtgaaag caaaaccaat 780

tcgtggctgc gaaagtcgta gccaccacga agtccaggag gacatacaat gaccgacttc 840

cccaccctgc cctctgagtt catccctggc gacggccgtt tcggctgcgg accttccaag 900

gttcgaccag aacagattca ggctattgtc gacggatccg catccgtcat cggtacctca 960

caccgtcagc cggcagtaaa aaacgtcgtg ggttcaatcc gcgagggact ctccgacctc 1020

ttctcccttc cagaaggcta cgagatcatc ctttccctag gtggtgcgac cgcattctgg 1080

gatgcagcaa ccttcggact cattgaaaag aagtccggtc acctttcttt cggtgagttc 1140

tcctccaagt tcgcaaaggc ttctaagctt gctccttggc tcgacgagcc agagatcgtc 1200

accgcagaaa ccggtgactc tccggcccca caggcattcg aaggcgccga tgttattgca 1260

tgggcacaca acgaaacctc cactggcgcc atggttccag ttcttcgccc cgaaggctct 1320

gaaggctccc tggttgccat tgacgcaacc tccggcgctg gtggactgcc agtagacatc 1380

aagaactccg atgtttacta cttctcccca cagaagtgct tcgcatccga cggtggcctg 1440

tggcttgcag cgatgag 1457

<210> 25

<211> 1431

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 25

tccacttggc tgactcctac ttcctgatcg cgcacttcca ctacaccctc ttcggtaccg 60

tggtgttcgc atcgtgtgca ggcgtttact tctggttccc gaagatgact ggccgcatga 120

tggacgagcg tcttggcaag atccacttct ggttgacctt cgtcggtttc cacggaacct 180

tcctcatcca gcactgggtg ggcaacatgg gtatgccacg tcgttacgct gactacctgg 240

attctgatgg tttcaccatc tacaaccaga tctccaccgt gttctccttc ctgcttggcc 300

tgtctgtcat tccattcatc tggaacgtct tcaagtcctg gcgctacggt gagctcgtta 360

ccgttgatga tccttggggt tacggcaact ccctggagtg ggcaacctcc tgccctcctc 420

ctcgccacaa cttcgcatcc ttgcctcgta tccgctccga gcgccctgcg ttcgagctgc 480

actacccgca catgattgaa cgcatgcgcg cagaggcaca cactggacat cacgatgata 540

ttaatgctcc agaattgggt accgccccag cccttgcatc tgactccagc cgctaaaagc 600

tggccgttac cctgcgaatg tccacagggt agctggtagt ttgaaaatca acgccgttgc 660

ccttaggatt cagtaactgg cacattttgt aatgcgctag atctgtgtgc tcagtcttcc 720

aggctgctta tcacagtgaa agcaaaacca attcgtggct gcgaaagtcg tagccaccac 780

gaagtccagg aggacataca gtgactgaac tcatccagaa tgaatcccaa gaaatcgctg 840

agctggaagc cggccagcag gttgcattgc gtgaaggtta tcttcctgcg gtgatcacag 900

tgagcggtaa agaccgccca ggtgtgactg ccgcgttctt tagggtcttg tccgctaatc 960

aggttcaggt cttggacgtt gagcagtcaa tgttccgtgg ctttttgaac ttggcggcgt 1020

ttgtgggtat cgcacctgag cgtgtcgaga ccgtcaccac aggcctgact gacaccctca 1080

aggtgcatgg acagtccgtg gtggtggagc tgcaggaaac tgtgcagtcg tcccgtcctc 1140

gttcttccca tgttgttgtg gtgttgggtg atccggttga tgcgttggat atttcccgca 1200

ttggtcagac cctggcggat tacgatgcca acattgacac cattcgtggt atttcggatt 1260

accctgtgac cggcctggag ctgaaggtga ctgtgccgga tgtcagccct ggtggtggtg 1320

aagcgatgcg taaggcgctt gctgctctta cctctgagct gaatgtggat attgcgattg 1380

agcgttctgg tttgctgcgt cgttctaagc gtctggtgtg cttcgattgt g 1431

<210> 26

<211> 1466

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 26

agcgatctag ttcgcaacca gcgccgaacc ctcgacatga atcaagagca tctagctaaa 60

gccatagaca aaacccgatt ctgggtaatc gacctcgaaa aaggaatatc ccggagaacc 120

ggtgaaccat tcaccgtcga tccaatgatg tgtatgaagc ttgcagaggc tctcgacctt 180

gatccagtag aggttttaag tgcagcgaaa gttcccgaat ctgaatggcc aaatttttcg 240

aagatcatct cccaaagtga ctatgtgaag catgtagaca taacaagact gaccgtccgc 300

cagcaagatc tagtcatcaa tctggtcaac gaatttaagg agcttaattt gaacacgcca 360

tatgaaaagt gactaatttc aacccaaacg ggagcctaag tgaaatgaaa taatcccctc 420

accaactggc gacattcaaa caccgtttca tttccaaaca tcgagccaag ggaaaagaaa 480

gcccctaagc cccgtgttat taaatggaga ctttttggag acctcaagcc aaaaaggggc 540

attttcatta agaaaatacc cctttgacct ggtgttattg agctggagaa gagacttgaa 600

ctctcaacct acgcattaca agtgcgttgc gctgtagctg ccaattattc cgggcttgtg 660

acccgctacc cgataaatag gtcggctgaa aaatttcgtt gcaatatcaa caaaaaggcc 720

tatcattggg aggtgtcgca ccaagtactt ttgcgaagcg ccatctgacg gattttcaaa 780

agatgtatat gctcggtgcg gaaacctacg aaaggatttt ttacccatgt tgagttttgc 840

gacccttcgt ggccgcattt caacagttga cgctgcaaaa gccgcacctc cgccatcgcc 900

actagccccg attgatctca ctgaccatag tcaagtggcc ggtgtgatga atttggctgc 960

gagaattggc gatattttgc tttcttcagg tacgtcaaat agtgacacca aggtacaagt 1020

tcgagcagtg acctctgcgt acggtttgta ctacacgcac gtggatatca cgttgaatac 1080

gatcaccatc ttcaccaaca tcggtgtgga gaggaagatg ccggtcaacg tgtttcatgt 1140

tgtaggcaag ttggacacca acttctccaa actgtctgag gttgaccgtt tgatccgttc 1200

cattcaggct ggtgcgaccc cgcctgaggt tgccgagaaa atcctggacg agttggagca 1260

atcccctgcg tcttatggtt tccctgttgc gttgcttggc tgggcaatga tgggtggtgc 1320

tgttgctgtg ctgttgggtg gtggatggca ggtttcccta attgctttta ttaccgcgtt 1380

cacgatcatt gccacgacgt catttttggg aaagaagggt ttgcctactt tcttccaaaa 1440

tgttgttggt ggttttattg ccacgc 1466

Claims (18)

1. A recombinant bacterium for producing L-serine, which has an improved expression of the glycine cleavage system GCV compared with the original bacterium, and is expressed by P_homPromoter regulated reduced expression of serine hydroxymethyltransferase GlyA and aconitase Acn with knock-out pyruvate carboxylase Pyc, said P_homThe nucleotide sequence of the promoter is shown as the 928-position 1057 nucleotide from the 5' end of SEQ ID NO.2, and the starting bacterium is Corynebacterium glutamicum ATCC 13032;

the expression with the improved glycine cleavage system GCV is that the recombinant strain has one or more copies of a GCV gene for coding a glycine cleavage system and the expression of the GCV gene is mediated by a regulatory element with high transcription or high expression activity, the GCV gene is a gcvT gene for coding aminomethyltransferase, a gcvH gene for coding a carrier protein and a gcvP gene for coding glycine dehydrogenase, the nucleotide sequences of the gcvT gene and the gcvH gene are shown as SEQ ID NO.3, and the nucleotide sequence of the gcvP gene is shown as SEQ ID NO. 4.

2. The recombinant bacterium according to claim 1, wherein the recombinant bacterium has a decreased expression of serine O-acetyltransferase CysE as compared to the starting bacterium.

3. The recombinant bacterium of claim 2, wherein the inactivation of the cysE gene encoding the serine O-acetyltransferase and/or the expression of the cysE gene is mediated by regulatory elements with low transcriptional or expression activity.

4. The recombinant bacterium according to claim 3, wherein the inactivation is a knock-out of the cysE gene in the recombinant bacterium, and the regulatory element with low transcription or low expression activity is P_homPromoter, P_homThe nucleotide sequence of the promoter is shown as the 928-1057 nucleotide from the 5' end of SEQ ID NO. 2.

5. The recombinant bacterium according to claim 1,

the regulatory element with high transcription or high expression activity is P₄₅Promoter, P₄₅The nucleotide sequence of the promoter is shown as 1005-1182 th nucleotide from 5' end in SEQ ID NO. 5.

6. The recombinant bacterium of claim 1, wherein the recombinant bacterium has reduced expression of aconitase Acn and serine hydroxymethyltransferase GlyA, knocked-out pyruvate carboxylase Pyc, serine dehydratase SdaA, and transcription factor glyR genes as compared to the starting bacterium.

7. The recombinant bacterium according to claim 1, wherein the recombinant bacterium has an increased 3-phosphoglycerate as compared with the starting bacteriumDehydrogenase serA^rThe phosphoserine transaminase serC, the phosphoserine phosphatase serB and/or the threonine efflux transporter ThrE, wherein serA^rserA released from feedback inhibition by serine.

8. The recombinant bacterium of claim 7, wherein the recombinant bacterium has one or more codes serA^rserA of^rGene, serC gene encoding serC, a copy of serB gene encoding serB and/or thrE gene encoding ThrE, and/or serA^rThe expression of the gene, serC gene, serB gene and/or thrE gene is mediated by regulatory elements with high transcription or high expression activity, and the serA gene^rThe nucleotide sequence of the gene is shown as SEQ ID NO.13, the nucleotide sequence of the serC gene is shown as SEQ ID NO.11, the nucleotide sequence of the serB gene is shown as SEQ ID NO.12, and the nucleotide sequence of the thrE gene is shown as the 332-th 1801-th nucleotide from the 5' end of the SEQ ID NO. 16.

9. The recombinant bacterium according to claim 8, wherein the regulatory element with high transcription or expression activity is P_eftuPromoter and/or P_sodThe promoter of said P_eftuThe nucleotide sequence of the promoter is shown as SEQ ID NO.23 from 629-828 th nucleotide at the 5' end, and the P is_sodThe nucleotide sequence of the promoter is shown as the 635-th and 826-th nucleotides from the 5' end of SEQ ID NO. 26.

10. A method for constructing a recombinant bacterium according to any one of claims 1 to 9, comprising the steps of:

the expression of a glycine cleavage system GCV in the outbreak of corynebacterium glutamicum ATCC13032 is improved, pyruvate carboxylase Pyc is knocked out, and the expression of aconitase Acn is reduced.

11. The method for constructing a recombinant bacterium according to claim 10, wherein the improvement of GCV expression in the outbreak is achieved by:

introducing GCV-encoding GCV gene into the strain,

increasing the copy number of the gcv gene in the starter bacterium, and/or

The regulatory element of the gcv gene in the outbreak is replaced by a regulatory element with high transcription or high expression activity.

12. The method for constructing a recombinant bacterium according to claim 11, wherein the gcv gene is one or more selected from the group consisting of a gcvT gene encoding aminomethyltransferase, a gcvH gene encoding a carrier protein, and a gcvP gene encoding glycine dehydrogenase, and the regulatory element having high transcription or high expression activity is a P45 promoter.

13. The construction method according to claim 10, characterized by comprising the steps of:

reducing the expression of serine hydroxymethyl transferase GlyA, serine O-acetyltransferase CysE and aconitase Acn in the outbreak, and knocking out pyruvate carboxylase Pyc, serine dehydratase SdaA and transcription factor glyR genes.

14. The method of constructing according to claim 13, wherein the reduction of the expression of GlyA, CysE and Acn is achieved by:

the regulatory elements of the cysE gene coding for CysE, the Acn gene coding for Acn and the glyA gene in the outbreak are replaced by regulatory elements with low transcription or low expression activity,

the regulatory element with low transcription or low expression activity is P_homPromoter, P_homThe nucleotide sequence of the promoter is shown as the 928-1057 nucleotide from the 5' end of SEQ ID NO. 2.

15. The construction method according to claim 13, wherein the nucleotide sequences of the upstream and downstream homologous arm fragments of the outgoing microorganism glyR gene are shown as SEQ ID No.1, the nucleotide sequences of the upstream and downstream homologous arm fragments of the sdaA gene are shown as SEQ ID No.8, the nucleotide sequences of the upstream and downstream homologous arm fragments of the cysE gene are shown as SEQ ID No.10, and the nucleotide sequences of the upstream and downstream homologous arm fragments of the pyc gene are shown as SEQ ID No. 15.

16. The construction method according to any one of claims 10 to 15, characterized by comprising the steps of:

3-phosphoglycerate dehydrogenase serA for increasing said growth bacteria^rThe phosphoserine transaminase serC, the phosphoserine phosphatase serB and/or the threonine efflux transporter ThrE, wherein serA^rserA released from feedback inhibition by serine.

17. The method of construction according to claim 16, wherein the improvement is achieved by:

introduction of the code serA into the outbreak^rserA of^rA gene, a serC gene encoding serC, a serB gene encoding serB and/or a thrE gene encoding ThrE,

increasing serA in said outgrowth^rCopy number of the gene, serC gene, serB gene and/or thrE gene, and/or

serA in the strain will grow^rThe regulatory elements of the gene, serC gene, serB gene and/or thrE gene are replaced with regulatory elements with high transcription or high expression activity.

18. The method according to claim 17, wherein the regulatory element with high transcription or expression activity is P_eftuPromoter and/or P_sodA promoter,

the serA^rThe nucleotide sequence of the gene is shown as SEQ ID NO.13, the nucleotide sequence of the serC gene is shown as SEQ ID NO.11, the nucleotide sequence of the serB gene is shown as SEQ ID NO.12, the nucleotide sequence of the thrE gene is shown as the 332-th 1801-th nucleotide from the 5' end of SEQ ID NO.16, and the P gene_eftuThe nucleotide sequence of the promoter is shown as the 629-828 th nucleotide from the 5' end of SEQ ID NO.23P_sodThe nucleotide sequence of the promoter is shown as the 635-th and 826-th nucleotides from the 5' end of SEQ ID NO. 26.

Images