WO2021048353A1

WO2021048353A1 - Coryneform bacteria with a heterologous threonine transporter and their use in the production of l-threonine

Info

Publication number: WO2021048353A1
Application number: PCT/EP2020/075471
Authority: WO
Inventors: Caroline Gerth; Mechthild Rieping; Tobias BLATTERT; Steffen Schaffer
Original assignee: Evonik Operations Gmbh
Priority date: 2019-09-11
Filing date: 2020-09-11
Publication date: 2021-03-18

Abstract

The present invention provides a recombinant bacterium of the genus Corynebacterium comprising a L-threonine exporter gene rhtC from E. coli and wherein in said bacterium the native L-threonine transporter gene thrE is deleted and a method for preparing L-threonine using such recombinant bacterium.

Description

Coryneform bacteria with a heterologous threonine transporter and their use in the production of L- threonine

L-threonine is used in animal nutrition, in human medicine and in the pharmaceutical industry. L- threonine can be produced by fermentation not only of strains of Escherichia coli ( E . coli ), but also by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum (C. glutamicum). Because of the great importance of L-threonine, attempts are constantly being made to improve the production processes. Production improvements may relate to fermentation technology measures such as for example stirring and provision of oxygen, or to the composition of the nutrient medium such as for example the sugar concentration during fermentation, or the working-up to the product form by for example ion exchange chromatography, or the intrinsic production properties of the microorganism itself.

Recombinant DNA technology methods usually are used for the strain improvement of L-threonine producing strains of Corynebacterium effecting an enhancement of the activities of individual enzymes of the threonine biosynthesis. Enhanced enzyme activities in Corynebacterium strains, can be achieved, for example, by mutation of the corresponding endogenous gene. Enzyme activities can also be enhanced by increasing the expression of the corresponding gene, for example, by increasing the gene copy number and/or by enhancing gene regulatory factors. The enhancement of such regulatory factors which positively influence gene expression can, for example, be achieved by modifying the promoter sequence upstream of the structural gene in order to increase the effectiveness of the promoter or by completely replacing the promoter with a strong promoter.

However, for further increasing L-threonine production and to provide for higher extracellular L- threonine concentrations, the increase of activity and/or the modification of L-threonine exporters also need to be considered. Among others, ThrE has been identified as L-threonine transporter in C. glutamicum catalyzing the export of L-threonine into the culture medium, whereas in E. coli RhtC has this function (Diesveld et al., J Mol Biotechnol 2009, 16: 198-207). It could be shown that increased L-threonine export can be achieved in C. glutamicum by thrE overexpression (Eggeling and Sahm, Arch Microbiol (2003) 180: 155-160; US 6,410,705 B1), whereas overexpression of the rhtC gene in E. coli results in an increased export and increased accumulation of L-threonine in the culture medium (EP 1 013 765 A1). On the other hand, the overexpression of a heterologous thrE gene from C. glutamicum in Enterobacteriaceae, e.g. E. coli, leads to an increased production of extracellular L-threonine by the so transformed L-threonine producing Enterobacteriaceae cells (WO 01/92545 A1) and, vice versa, the heterologous expression of the E. coli rhtC gene in C. glutamicum increases the L-threonine excretion rate of C. glutamicum (Diesveld et al., J Mol Biotechnol 2009, 16: 198-207). In both cases, the native, homologous L-threonine transporter remained unchanged. The object of the present invention is to provide a Corynebacterium strain with further improved L- threonine transporter activities and its use in a method for the fermentative production of L- threonine.

Therefore, the present invention provides a recombinant bacterium of the genus Corynebacterium comprising a L-threonine exporter gene rhtC coding for a L-threonine exporter RhtC from E. coli and wherein in said bacterium the native L-threonine transporter gene thrE coding for the native L- threonine exporter ThrE of Corynebacterium is deleted. The native L-threonine exporter ThrE from C. glutamicum comprises the amino acid sequence according to SEQ ID NO: 4. The nucleotide sequence of the native thrE gene from C. glutamicum comprises the sequence according to SEQ ID NO: 3. The L-threonine exporter RhtC from E. coli comprises the amino acid sequence according to SEQ ID NO: 2. The nucleotide sequence of the rhtC gene from E. coli comprises the sequence according to SEQ ID NO: 1 .

All the microorganisms known as glutamic acid-producing coryneform bacteria belonging to the genus Corynebacterium or Brevibacterium can be used as a starting strain in which the modifications mentioned before can be introduced. The following strains are exemplary of those particularly suitable: C. glutamicum ATCC31833, C. glutamicum ATCC13032, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium herculis ATCC13868, Corynebacterium lilium ATCC15990, Brevibacterium divaricatum ATCC14020, Brevibacterium flavum ATCC14067, Brevibacterium immariophilum ATCC14068, Brevibacterium lactofermentum ATCC13869 and Brevibacterium thiogenitalis ATCC19240.

The bacterium according to the present invention may further comprise at least one copy of a lysC gene coding for a feedback resistant aspartokinase.

A feedback resistant aspartokinase means an aspartokinase variant which is less sensitive or desensitized with respect to inhibition of its activity by L-lysine and/or L-threonine. This feedback resistance of a particular aspartokinase variant can be determined by measuring its activity in the presence of mixtures of L-lysine and L-threonine, e.g. 10 mM each, or mixtures of the L-lysine analogue S-(2-aminoethyl)-L-cysteine and L-threonine, e.g. 50 mM S-(2-aminoethyl)-L-cysteine and 10 mM L-threonine, in comparison to the wild form of the enzyme, which is contained in wild strains like for example ATCC13032, ATCC14067 and ATCC31833.

The EC number for aspartokinase is EC 2.7.2.4. Descriptions of polynucleotides of C. glutamicum encoding a feedback resistant aspartokinase polypeptide variant are for example given in US5688671 , US6844176 and US6893848. A summarizing list can be found inter alia in W02009141330 A1 (US2009311758 A1).

SEQ ID NO: 5 shows the nucleotide sequence of the coding sequence of the aspartokinase gene of the C. glutamicum wildtype strains ATCC13032 or ATCC31833 and SEQ ID NO: 6 the amino acid sequence of the encoded polypeptide. It is known in the art (see US6893848) that exchange of the amino acid threonine (Thr) at position 311 of SEQ ID NO: 6 for isoleucine (lie) imparts the enzyme a feedback resistance to inhibition by mixtures of L-lysine and L-threonine.

Accordingly, it is preferred that the amino acid sequence of said feedback resistant aspartokinase polypeptide comprises the amino acid sequence of SEQ ID NO: 6 containing lie at position 311 instead of Thr. Said amino exchange can be achieved by exchanging the nucleobase cytosine (c) at position 932 of SEQ ID NO: 5 to give thymine (t). The acc codon for threonine is thus altered to the ate codon for isoleucine.

It is further known in the art that exchange of the gtg start codon of the coding sequence for the aspartokinase polypeptide for atg enhances expression of the polypeptide (e.g. WO201300827 A1 , page 50, lines 23-31 ; US20090325244 A1 ; EP2796555 A2). Accordingly, it is preferred that the sequence coding for a feedback resistant aspartokinase polypeptide begins with an atg start codon.

The feedback resistant aspartokinase comprises the amino acid sequence according to SEQ ID NO: 8.

At least one copy of the lysC gene coding for a feedback resistant aspartokinase (SEQ ID NO: 7) in the bacterium of the present invention may be functionally linked to a strong promoter.

The bacterium according to the present invention may further comprise at least one copy of a hom gene coding for a feedback resistant homoserine dehydrogenase.

SEQ ID NO: 9 shows the nucleotide sequence of the coding sequence of the homoserine dehydrogenase gene of the C. glutamicum wildtype strain ATCC31833 and SEQ ID NO: 10 the amino acid sequence of the encoded polypeptide. The exchange of the amino acid glycine (Gly) at position 378 of SEQ ID NO: 10 for glutamic acid (Glu) imparts the enzyme a feedback resistance to inhibition by L-threonine.

The feedback resistant homoserine dehydrogenase comprises the amino acid sequence according to SEQ ID NO: 12.

The hom gene coding for a feedback resistant homoserine dehydrogenase (SEQ ID NO: 11) in the bacterium of the present invention may be functionally linked to a strong promoter.

It can be advantageous for the production of L-threonine to overexpress not only the lysC or hom genes but also one or more further enzymes of the particular biosynthetic pathway, the glycolysis, the anaplerosis, the citric acid cycle or the pentose phosphate cycle, and optionally regulatory proteins. The bacterium according to the present invention optionally further comprises an overexpressed pyc gene coding for a pyruvate carboxylase. SEQ ID NO: 77 shows the nucleotide sequence of the coding sequence of the pyruvate carboxylase gene of the C. glutamicum wildtype strain ATCC13032 and SEQ ID NO: 78 the amino acid sequence of the encoded polypeptide.

Advantageously, the overexpressed pyc gene in the bacterium according to the present invention is an allele coding for a pyruvate carboxylase in which the amino acid proline (Pro) in position 458 of the amino acid sequence according to SEQ ID NO: 78 is replaced by the amino acid serine (Ser) as shown in the amino acid sequence according to SEQ ID NO: 80. The nucleotide sequence of the allele of the pyc gene is shown in SEQ ID NO: 79. This allele of the pyruvate carboxylase polypeptide is feedback resistant with respect to aspartic acid. The pyc gene in the bacterium according to the present invention is overexpressed by increasing the copy number of the gene in comparison with the copy number in the wild type strain and/or by functionally linking the gene to a strong promoter.

Preferably, the pyc gene in the bacterium according to the present invention is functionally linked to a promoter according to SEQ ID NO: 82 or according to SEQ ID NO: 83.

The exchange of the gtg start codon of the coding sequence for the pyruvate carboxylase polypeptide for atg enhances expression of the polypeptide. Therefore, the sequence coding for a feedback resistant pyruvate carboxylase polypeptide may optionally begin with an atg start codon.

The bacterium according to the present invention is preferably of the species Corynebacterium glutamicum.

A promoter is understood to mean a polynucleotide (deoxyribose polynucleotide, or a deoxyribonucleic acid (DNA)) which, in functional linkage to a polynucleotide to be transcribed, defines the initiation point and the frequency of initiation of transcription of said polynucleotide, making it possible to influence the strength of expression of the controlled polynucleotide.

Transcription is understood to mean the process by means of which a complementary ribonucleic acid molecule (RNA) is prepared starting from a DNA template. Involved in said process are proteins such as RNA polymerase, so-called sigma factors and transcriptional regulatory proteins. The synthesized RNA (messenger RNA, mRNA) then serves as template in the process of translation, which then leads to the polypeptide or protein. From a chemical point of view, a gene is a polynucleotide. A polynucleotide encoding a protein/polypeptide is used here synonymously in relation to the term gene. Therefore, the two terms gene and coding region are used synonymously.

A “functional linkage” is understood in this connection to mean the sequential arrangement of a promoter with a gene, which leads to a transcription of the gene.

Overexpression or enhanced expression is generally understood to mean an increase in the intracellular concentration or activity of a ribonucleic acid, of a protein (polypeptide) or of an enzyme in comparison with the starting strain (parent strain) or wild-type strain, if the latter is the starting strain.

Overexpression or enhanced expression can be achieved by increase of the copy number of the respective gene or by functional linkage of the respective gene with a strong promoter.

A starting strain (parent strain) is understood to mean the strain on which the measure leading to overexpression is carried out.

Promoters for Corynebacterium, in particular, Corynebacterium glutamicum, are well known in the art (Patek et al., Microbial Biotechnology 6, 103 - 117, 2013). Strong promoters or methods of producing such promoters for overexpression are known from the literature (e.g. S. Lisser and H. Margalit, Nucleic Acid Research, 1993, Vol. 21 , No. 7, 1507-1516; B. J. Eikmanns et al., Gene, 102 (1991) 93-98). For instance, native promoters may be optimized to become strong promoters by altering the promoter sequence in the direction of known consensus sequences with respect to increasing the expression of the genes functionally linked to these promoters (M. Patek et al., Microbiology (1996), 142, 1297-1309; M. Patek et al., Microbial Biotechnology 6 (2013), 103-117).

Examples for strong promotors are e.g. the promoter according to SEQ ID NO: 82, the promoter according to SEQ ID NO: 83, the promoter “PG3N3” according to SEQ ID NO: 40 and the tac promoter (Ptac) according to SEQ ID NO: 39.

In addition to the replacement of the homologous threonine transporter thrE by the heterologous transporter rhtC, it is also advantageous to replace the homologous genes glyA (NCgl0954, cg1133), coding for a serine hydroxymethyltransferase, and serA (NCgl1235, cg1451), coding for a D-3-phosphoglycerate dehydrogenase, by heterologous gene variants, preferably the heterologous genes glyA (b2551) and serA (b2912) from Escherichia coli.

Furthermore, the present invention provides a method for the fermentative production L-threonine, comprising the steps of cultivating the bacterium of the genus Corynebacterium according to the present invention in a suitable medium under suitable conditions and accumulating L-threonine in the medium to form an L-threonine containing fermentation broth. The method further comprises a purification step in order to obtain L-threonine.

The culture medium to be used must satisfy the demands of the particular strains in a suitable manner. The American Society for Bacteriology Manual "Manual of Methods for General Bacteriology" (Washington D.C., USA, 1981) contains descriptions of media for culturing a variety of microorganisms.

A culture medium usually contains inter alia one or more carbon source(s), nitrogen source(s) and phosphorus source(s).

Sugar and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and, where appropriate, cellulose, oils and fats, such as soybean oil, sunflower oil, peanut oil and coconut fat, fatty acids, such as palmitic acid, stearic acid and linoleic acid, alcohols, such as glycerol and ethanol, and organic acids, such as acetic acid, may be used as the carbon source. These substances may be used individually or as a mixture.

Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, may be used as the nitrogen source. The nitrogen sources may be used individually or as a mixture.

Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or the corresponding sodium-containing salts, may be used as the phosphorus source.

In addition, the culture medium must contain salts of metals, such as magnesium sulfate or iron sulfate, which are required for growth. Finally, essential growth promoters, such as amino acids and vitamins, may be used in addition to the abovementioned substances. Suitable precursors can also be added to the culture medium. Said ingredients may be added to the culture in the form of a one-off mixture or suitably fed in during the culture.

The fermentation is generally carried out at a pH of from 5.5 to 9.0, in particular of from 6.0 to 8.0. Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water, or acidic compounds, such as phosphoric acid or sulfuric acid, are used in a suitable manner for controlling the pH of the culture. Antifoam agents, such as fatty acid polyglycol esters, can be used for controlling foaming. Suitable selectively acting substances, for example antibiotics, can be added to the medium in order to maintain the stability of plasmids. Oxygen or oxygen-containing gas mixtures, such as air, are passed into the culture in order to maintain aerobic conditions. The temperature of the culture is normally from 25°C to 45°C and preferably from 30°C to 40°C. The action of the microorganisms results in the L amino acid being concentrated or accumulated in the fermentation or culture broth. The culture is continued until a maximum of the desired L-amino acid has been formed. This objective is normally reached within 10 to 160 hours. Longer culturing times are possible in continuous processes. A fermentation broth or culture broth means a fermentation medium in which a microorganism has been cultured for a certain time and at a certain temperature.

After the fermentation has been completed, the fermentation broth obtained accordingly comprises the biomass (cell mass) of the microorganism, produced due to propagation of the cells of said microorganism, the L-threonine produced in the course of the fermentation, the organic by-products produced in the course of the fermentation, and the components of the fermentation medium/fermentation media used and the starting materials such as, for example, vitamins such as thiamine or salts such as magnesium sulfate, which have not been consumed by said fermentation. The culture broth or fermentation broth produced may subsequently be collected, and L-threonine may be recovered or isolated.

In one process variant, the fermentation broth is concentrated, where appropriate, and the L- threonine is subsequently purified or isolated in a pure or virtually pure form. Ion exchange chromatography, crystallization, extraction processes and treatment with activated carbon are typical methods for purifying L amino acids.

Experimental Part A) MATERIALS and METHODS The molecular biology kits, primers and chemicals used and some details of the methods applied are briefly described herewith.

1 . Chemicals a. Kanamycin solution from Streptomyces kanamyceticus was purchased from Sigma Aldrich (St. Louis, USA, Cat. no. K0254). b. If not stated otherwise, all other chemicals were purchased analytically pure from Merck (Darmstadt, Germany), Sigma Aldrich (St. Louis, USA) or Carl-Roth (Karlsruhe, Germany). 2. Cultivation

If not stated otherwise, all cultivation / incubation procedures were performed as described in the following: a. LB broth (MILLER) from Merck (Darmstadt, Germany; Cat. no. 110285) was used to cultivate E. coli strains in liquid medium. The liquid cultures (10 ml liquid medium per 100 ml Erlenmeyer flask with 3 baffles) were incubated in the Infors HT Multitron standard incubator shaker from Infors GmbH (Bottmingen, Switzerland) at 37°C and 200 rpm. b. LB agar (MILLER) from Merck (Darmstadt, Germany Cat. no. 110283) was used for cultivation of E. coli strains on agar plates. The agar plates were incubated at 37°C in an INCU- Line® mini incubator from VWR (Radnor, USA). a. Brain heart infusion broth (BHI) from Merck (Darmstadt, Germany; Cat. no. 110493) was used to cultivate C. glutamicum strains in liquid medium. The liquid cultures (10 ml liquid medium per 100 ml Erlenmeyer flask with 3 baffles) were incubated in the Infors HT Multitron standard incubator shaker from Infors GmbH (Bottmingen, Switzerland) at 33°C and 200 rpm. b. Brain heart agar (BHI-agar) from Merck (Darmstadt, Germany; Cat. no. 113825) was used for cultivation of C. glutamicum strains on agar plates. The agar plates were incubated at 33°C in an incubator from Heraeus Instruments with Kelvitron® temperature controller (Hanau, Germany). 3. Determining optical density a. The optical density of bacterial suspensions in shake flask cultures was determined at 600 nm (OD600) using the BioPhotometer from Eppendorf AG (Hamburg, Germany). b. The optical density of bacterial suspensions produced in the Wouter Duetz (WDS) micro fermentation system (24-Well Plates) was determined at 660 nm (OD660) with the GENios™ plate reader from Tecan Group AG (Mannedorf, Switzerland). 4. Centrifugation a. Benchtop centrifuge for reaction tubes with a volume up to 2 ml Bacterial suspensions with a maximum volume of 2 ml were caused to sediment using 1 ml or 2 ml reaction tubes (e.g. Eppendorf Tubes® 381 OX) using an Eppendorf 5417 R centrifuge (5 min. at 13.000 rpm). b. Benchtop centrifuge for tubes with a volume up to 50 ml

Bacterial suspensions with a maximum volume of 50 ml were caused to sediment using 15 ml or 50 ml centrifuge tubes (e.g. FalconTM 50 ml Conical Centrifuge Tubes) using an Eppendorf 5810 R centrifuge for 10 min. at 4.000 rpm.

5. DNA isolation a. Plasmid DNA was isolated from E. coli cells using the QIAprep Spin Miniprep Kit from

Qiagen (Hilden, Germany, Cat. No. 27106). b. Total DNA from C. glutamicum was isolated using the method of Eikmanns et al. (Microbiology 140, 1817-1828, 1994). 6. Polymerase chain reaction (PCR)

PCR with a proof reading (high fidelity) polymerase was used to amplify a desired segment of DNA before Gibson Assembly or Sanger sequencing.

Non-proof reading polymerase Kits were used for determining the presence or absence of a desired DNA fragment directly from E. coli or C. glutamicum colonies. a. The Phusion® High-Fidelity DNA Polymerase Kit (Phusion Kit) from New England BioLabs Inc. (Ipswich, USA, Cat. No. M0530) was used for template-correct amplification of selected DNA regions according to the instructions of the manufacturer (see table 1).

Table 1 : Thermocycling conditions for PCR with Phusion® High-Fidelity DNA Polymerase Kit from NEB Inc.

b. Taq PCR Core Kit (Taq Kit) from Qiagen (Hilden, Germany; Cat. No.201203) was used to amplify a desired segment of DNA in order to confirm its presence. The kit was used according to the instructions of the manufacturer (see table 2).

Table 2: Thermocycling conditions for PCR with Taq PCR Core Kit (Taq Kit) from Qiagen.

c. SapphireAmp® Fast PCR Master Mix (Sapphire Mix) from Takara Bio Inc (Takara Bio Europe S.A.S.; Saint-Germain-en-Laye, France; Cat. No. RR350A/B) was used as an alternative to confirm the presence of a desired segment of DNA in cells taken from E. coli or C. glutamicum colonies according to the instructions of the manufacturer (see table 3). Table 3: Thermocycling conditions for PCR with SapphireAmp® Fast PCR Master Mix (Sapphire Mix) from Takara Bio Inc.

d. Primer

The oligonucleotides used were synthesized by Eurofins Genomics GmbH (Ebersberg, Germany) using the phosphoramidite method described by McBride and Caruthers (Tetrahedron Lett. 24, 245-248, 1983). e. Template

As PCR template either a suitably diluted solution of isolated plasmid DNA or of isolated total DNA from a C. glutamicum liquid culture or the total DNA contained in a colony was used (colony PCR). For said colony PCR the template was prepared by taking cell material with a toothpick from a colony on an agar plate and placing the cell material directly into the PCR reaction tube. The cell material was heated for 10 sec. with 800 W in a microwave oven type Mikrowave & Grill from SEVERIN Elektrogerate GmbH (Sundern, Germany) and then the PCR reagents were added to the template in the PCR reaction tube. f. PCR Cycler

PCR experiments were carried out in PCR cyclers type Mastercycler or Mastercycler nexus gradient from Eppendorf AG (Hamburg, Germany).

7. Restriction enzyme digestion of DNA

The FastDigest restriction endonucleases (FD) and the associated buffer from ThermoFisher Scientific (Waltham, USA, Cat. No. FD0684) were used for restriction digestion of the plasmid DNA. The reactions were carried out according to the instructions of the manufacturer’s manual. 8. Determining the size of DNA fragments

The size of DNA fragments was determined by automatic capillary electrophoresis using the QIAxcel from Qiagen (Hilden, Germany).

9. Purification of PCR amplificates and restriction DNA fragments

PCR amplificates and restriction DNA fragments were cleaned up using the QIAquick PCR Purification Kit from Qiagen (Hilden, Germany; Cat. No. 28106), according to the manufacturer’s instructions.

10. Determining DNA concentration

DNA concentration was measured using the NanoDrop Spectrophotometer ND-1000 from PEQLAB Biotechnologie GmbH, since 2015 VWR brand (Erlangen, Germany).

11. NEBuilder HiFi DNA Assembly

Expression vectors and vectors allowing integration of the desired mutation into the chromosome were made using the method of Gibson et al. (Science 319, 1215 — 20, 2008). The NEBuilder HiFi DNA Assembly (New England Biolabs GmbH, Frankfurt, DE) was used for this purpose. The reaction mix, containing the restricted vector and at least one DNA insert, was incubated at 50°C for 60 min.. 0.5 pi of the Assembly mixture was used for a transformation experiment. 12. Chemical transformation of E. coli a. Chemically competent E. coli 10B/NEB5-alpha (#C3019) cells were purchased from New England Biolabs GmbH and transformed according to the manufacturer's protocol (E2621). These cells were used as transformation hosts for reaction mixtures obtained by NEBuilder HiFi DNA Assembly (New England Biolabs GmbH, Frankfurt, DE). The transformation batches were cultivated overnight for approximately 18 h at 37°C and the transformants containing plasmids selected on LB agar supplemented with 50 mg/I kanamycin. 13. Chemical transformation of C. glutamicum

Chemically competent C. glutamicum cells are made and transformed using a modified electroporation method from van der Rest et al. (Appl Microbiol Biotechnol (1999) 52: 541-545). 14. Determining nucleotide sequences Nucleotide sequences of DNA molecules were determined by Eurofins Genomics GmbH (Ebersberg, Germany) by cycle sequencing, using the dideoxy chain termination method of Sanger et al. (Proceedings of the National Academy of Sciences USA 74, 5463 - 5467, 1977), on Applied Biosystems® (Carlsbad, CA, USA) 3730x1 DNA Analyzers. Clonemanager Professional 9 software from Scientific & Educational Software (Denver, USA) was used to visualise and evaluate the sequences.

15. Glycerol stocks of E.coli and C. glutamicum strains For long time storage of E.coli and C. glutamicum strains glycerol stocks were prepared. Selected E. coli clones were cultivated in 10 ml LB medium supplemented with 2 g/l glucose. Selected C. glutamicum clones were cultivated in two fold concentrated BHI medium supplemented with 2 g/l glucose. Cultures of plasmid containing E. coli strains were supplemented with 50 mg/I kanamycin. Cultures of plasmid containing C. glutamicum strains were supplemented with 25 mg/I kanamycin. The medium was contained in 100 ml Erlenmeyer flasks with 3 baffles. It was inoculated with a loop of cells taken from a colony. The culture was then incubated for about 18 h at 37°C and 200 rpm in the case of E. coli and 33°C and 200 rpm in the case of C. glutamicum. After said incubation period 1 .2 ml 85 % (v/v) sterile glycerol were added to the culture. The obtained glycerol containing cell suspension was then aliquoted in 2 ml portions and stored at -80°C.

16. Cultivation system according to Wouter Duetz

The milliliter-scale cultivation system according to Duetz (Trends Microbiol. 2007; 15(10):469-75) was used to investigate the performance of the C. glutamicum strains constructed. For this purpose, 24-deepwell microplates (24 well WDS plates) from EnzyScreen BV (Heemstede, Netherlands; Cat. no. CR1424), filled with 2.5 mL medium were used.

Precultures of the strains were done in 10 ml two fold concentrated BHI medium. The medium was contained in a 100 ml Erlenmeyer flask with 3 baffles. It was inoculated with 100 pi of a glycerol stock culture and the culture incubated for 24 h at 33°C and 200 rpm.

After said incubation period the optical densities OD600 of the precultures were determined.

The main cultures were done by inoculating the 2.5 ml medium containing wells of the 24 Well WDS-Plate with an aliquot of the preculture to give an optical density OD600 of 0.1 . As medium for the main culture CGXII medium described by Keilhauer et al. (J. Bacteriol. 1993 Sep; 175(17): 5595-5603) was used. For convenience the composition of the CGXII medium is shown in table 4.

Table 4: Composition of Keilhauer’s CGXII medium.

These main cultures were incubated for approximately 45 h at 33 °C and 300 rpm in an Infors HT Multitron standard incubator shaker from Infors GmbH (Bottmingen, Switzerland) until complete consumption of glucose.

The glucose concentration in the suspension was analyzed with the blood glucose-meter OneTouch Vita® from LifeScan (Johnson & Johnson Medical GmbH, Neuss, Germany).

After cultivation the culture suspensions were transferred to a deep well microplate. A part of the culture suspension was suitably diluted to measure the OD600. Another part of the culture was centrifuged and the concentration of L-amino acids, in particular L-threonine, and residual glucose were analyzed in the supernatant.

17. Amino acid analyzer

The concentration of L-amino acids, in particular L-threonine, in the culture supernatants was determined by ion exchange chromatography using a SYKAM S433 amino acid analyzer from SYKAM Vertriebs GmbH (Fiirstenfeldbruck, Germany). As solid phase a column with spherical, polystyrene-based cation exchanger (Peek LCA N04/Na, dimension 150 x 4.6 mm) from SYKAM was used. Depending on the L-amino acid the separation takes place in an isocratic run using a mixture of buffers A and B for elution or by gradient elution using said buffers. As buffer A an aqueous solution containing in 20 I 263 g trisodium citrate, 120 g citric acid, 1100 ml methanol, 100 ml 37 % HCI and 2 ml octanoic acid (final pH 3.5) was used. As buffer B an aqueous solution containing in 20 I 392 g trisodium citrate, 100 g boric acid and 2 ml octanoic acid (final pH 10.2) was used. The free amino acids were colored with ninhydrin through post-column derivatization and detected photometrically at 570 nm.

B) EXPERIMENTAL RESULTS

Example 1 Construction of plasmid pK18mobsacB_homG378E

Plasmid pK18mobsacB_homG378E was constructed to enable incorporation of the mutation causing the amino acid exchange G378E into the nucleotide sequence of the hom coding sequence of strain ATCC 31833. The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_homG378E the NEBuilder HiFi DNA Assembly method was used.

For this purpose three polynucleotides or DNA molecules resp. were made: One polynucleotide called homG378E_UP comprised the 5’-end of the hom coding sequence including the mutation leading to the amino acid exchange of G at position 378 to E (G378E). The second polynucleotide called homG378E_DOWN comprised the 3’-end of the hom coding sequence including the mutation leading to the amino acid exchange of G at position 378 to E (G378E). The third polynucleotide was plasmid pK18mobsacB linearized by treatment with restriction endonuclease BamHI.

Polynucleotide homG378E_UP was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides OTBCT67 and OTBCT15 as primers (table 5). The primers are also shown in SEQ ID NO:13 and SEQ ID NO:14 of the sequence listing. Polynucleotide homG378E_DOWN was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides OTBCT67 and OTBCT15 as primers (table 5). The primers are also shown in SEQ ID NO:15 and SEQ ID NO:16 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1 . step 4) of 30 sec..

Table 5: List of primers used and size of amplificate during Phusion Kit PCR.

The nucleotide sequence of the amplificate homG378E_UP is shown in SEQ ID NO:17. The nucleotide sequence of the amplificate homG378E_DOWN is shown in SEQ ID NO:18 The joined sequence of polynucleotide homG378E_UP and polynucleotide homG378E_DOWN (SEQ ID NO:19) contain a sequence of 830 bps length upstream and a sequence of 757 bps downstream from the mutation (see position 831 of SEQ ID NO:17 or position 14 of SEQ ID NO:18) causing the amino acid exchange from G to E.

At its 5’-end and 3’-end it is equipped with a nucleotide sequence each overlapping with the corresponding sequence of pK18mobsacB cut with BamHI.

Said overlapping sequences are required for the NEBuilder HiFi DNA Assembly technique.

Plasmid pK18mobsacB was linearized with the restriction endonuclease BamHI. The digestion mixture was subsequently controlled by agarose gel electrophoresis, purified and the DNA concentration quantified.

To assemble the plasmid pK18mobsacB_homG378E, the three polynucleotides i.e. the vector pK18mobsacB cut with BamHI and the amplificates homG378E_UP and homG378E_DOWN were mixed with the NEBuilder HiFi DNA Assembly Kit ingredients. The assembly mixture thus obtained was used to transform chemically competent E. coli DH10B.

Plasmid was isolated from twenty-two kanamycin resistant transformants using the Qiagen Miniprep Kit and Plasmid identity was confirmed via restriction digest and agarose gel electrophoresis.

Plasmid DNA from three transformants thus characterized as containing the desired mutation was isolated and the polynucleotide homG378E created within the plasmid during the assembly analyzed by Sanger sequencing. For sequence analysis the primers P77F, p77F2 and p77R (table 6), were used. They are also shown under SEQ ID NO:20 and SEQ ID NO:21 and SEQ ID NO:22 of the sequence listing.

Table 6: List of primers used for Sanger sequencing.

The analysis of the nucleotide sequences thus obtained showed that the polynucleotide homG378E contained in the plasmid of the three transformants analyzed had the nucleotide sequence presented in SEQ ID NO:19. One of said transformants was called DH10B/ pK18mobsacB_homG378E and saved as a glycerol stock for further experiments.

Example 2

Construction of strain ATCC 31833_homG378E The plasmid pK18mobsacB_homG378E obtained in example 1 was used to incorporate the mutation (see position 831 of SEQ ID NO:19) leading to the amino acid exchange G378E into the chromosome of the strain ATCC 31833 by transformation. Strain ATCC 31833 is a Corynebacterium glutamicum wildtype strain described by ABE ET AL. (US5605818). Strain ATCC 31833 is available at the ATCC (American Type Culture Collection; USA). One of the transformant clones thus characterized was called ATCC 31833_homG378E. A glycerol stock culture of the transformant clone was prepared and used as starting material for further investigations.

The nucleotide sequence of the chromosomal region of strain ATCC 31833_homG378E containing the mutated nucleotide sequence was analyzed by Sanger sequencing. For this purpose, a PCR amplificate was produced spanning the site of mutation. A colony PCR was done using the primers OTBCT93 and OTBCT94 (see table 7) and the NEB Phusion Kit with an elongation time of 45 sec. (table 1 . step 4). The amplificate obtained was then sequenced using the primers OTBCT93 and OTBCT94. The nucleotide sequences of the primers used in this context are also shown in SEQ ID NO:23 and 24. Table 7: List of primers used for colony PCR.

The nucleotide sequence obtained is shown in SEQ ID NO:25. The result showed that strain ATCC 31833_homG378E contained the desired mutation, or the desired mutated nucleotide sequence resp., in its chromosome.

Thus the hom gene of strain ATCC 31833 was mutated with the effect that the amino acid G at position 378 of the amino acid sequence of the encoded Hom polypeptide was replaced by E.

Example 3

Construction of plasmid pK18mobsacB_lysCT3111

Plasmid pK18mobsacB_lysCT3111 was constructed to enable incorporation of the mutation causing the amino acid exchange T3111 into the nucleotide sequence of the lysC coding sequence of strain ATCC 31833. “lysC T3111” (abbreviation already used in US 7,338,790) is a variant of the aspartokinase gene encoding a feed-back resistant aspartokinase polypeptide. Said feed-back resistant aspartokinase polypeptide has the amino acid L-threonine (Thr) at position 311 of the amino acid sequence replaced by L-isoleucine (lie). The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_lysCT3111 the NEBuilder HiFi DNA Assembly method was used.

For this purpose three polynucleotides or DNA molecules resp. were made: One polynucleotide called lysCT3111JJP comprised the 5’-end of the lysC coding sequence including the mutation leading to the amino acid exchange of T at position 311 to I (T3111). The second polynucleotide called lysCT311 l_DOWN comprised the 3’-end of the lysC coding sequence including the mutation leading to the amino acid exchange of T at position 311 to I (T311 I). The third polynucleotide was plasmid pK18mobsacB linearized by treatment with restriction endonuclease BamHI.

Polynucleotide lysCT3111JJP was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides OTBCT63 and OTBCT64 as primers (table 8). The primers are also shown in SEQ ID NO:26 and SEQ ID NO:27 of the sequence listing. Polynucleotide lysCT311 l_DOWN was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides OTBCT65 and 0TBCT66 as primers (table 8). The primers are also shown in SEQ ID NO:28 and SEQ ID NO:29 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1. step 4) of 45 sec.. Table 8: List of primers used and size of amplificate during Phusion Kit PCR.

The nucleotide sequence of the amplificate lysCT3111JJP is shown in SEQ ID NO:30. The nucleotide sequence of the amplificate lysCT311 l_DOWN is shown in SEQ ID NO:31 The joined sequence of polynucleotide lysCT311 l_UP and polynucleotide lysCT311 l_DOWN (SEQ ID NO:32) contain a sequence of 814 bps length upstream and a sequence of 334 bps downstream from the mutation (see position 840 of SEQ ID NO:30 or position 11 of SEQ ID NO:31) causing the amino acid exchange from T to I.

To assemble the plasmid pK18mobsacB_lysCT3111, the three polynucleotides i.e. the vector pK18mobsacB cut with BamHI and the amplificates lysCT3111JJP and lysCT311 l_DOWN were mixed with the NEBuilder HiFi DNA Assembly Kit ingredients. The assembly mixture thus obtained was used to transform chemically competent E. coli DH10B

Plasmid DNA from three transformants thus characterized as containing the desired mutation was isolated and the polynucleotide lysCT3111 created within the plasmid during the assembly analyzed by Sanger sequencing. For sequence analysis the primers P76F, p76F2 and p76R (table 91. were used. They are also shown under SEQ ID NO:33 and SEQ ID NO:34 and SEQ ID NO:35 of the sequence listing.

Table 9: List of primers used for Sanger sequencing.

The analysis of the nucleotide sequences thus obtained showed that the polynucleotide lysCT3111 contained in the plasmid of the three transformants analyzed had the nucleotide sequence presented in SEQ ID NO:32. One of said transformants was called DH10B/ pK18mobsacB_lysCT3111 and saved as a glycerol stock for further experiments.

Example 4

Construction of strain ATCC 31833_homG378E_lysCT3111

The plasmid pK18mobsacB_lysCT3111 obtained in example 3 was used to incorporate the mutation (see position 840 of SEQ ID NO:30) leading to the amino acid exchange T3111 into the chromosome of the strain ATCC 31833_homG378E by transformation

The nucleotide sequence of the chromosomal region of strain ATCC 31833_homG378E_lysCT3111 containing the mutated nucleotide sequence was analyzed by Sanger sequencing.

For this purpose a PCR amplificate was produced spanning the site of mutation. A colony PCR was done using the primers OTBCT95 and OTBCT96 (see table 10) and the NEB Phusion Kit with an elongation time of 45 sec. (table 1 . step 4). The amplificate obtained was then sequenced using the primers OTBCT95 and OTBCT96 (see table 10). The nucleotide sequences of the primers used in this context are also shown in SEQ ID NO:36 and 37. Table 10: List of primers used for colony PCR.

The nucleotide sequence obtained is shown in SEQ ID NO:38. The result showed that strain ATCC 31833_homG378E_lysCT3111 contained the desired mutation, or the desired mutated nucleotide sequence resp., in its chromosome. Thus the lysC gene of strain ATCC 31833_homG378E was mutated with the effect that the amino acid T at position 311 of the amino acid sequence of the encoded LysC polypeptide was replaced by I. Example 5

Construction of plasmid pK18mobsacB_APIysC::Pg3N3 for promoter exchange

Plasmid pK18mobsacB_APIysC::Pg3N3 was constructed to enable incorporation of the promoter mutations into the nucleotide sequence of the lysC promoter sequence of strain ATCC 31833. The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_APIysC::Pg3N3 the NEBuilder HiFi DNA Assembly method was used.

For this purpose first three polynucleotides or DNA molecules resp. were made: One polynucleotide called UP_PlysC comprised the 5’-region upstream of the lysC promoter sequence. The second polynucleotide called DS_PlysC comprised the 3’-end of the lysC promoter sequence. The third polynucleotide was plasmid pK18mobsacB linearized by treatment with restriction endonuclease BamHI.

Polynucleotide UP_PlysC was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides OTB-CT79 and 0TB-CT8O as primers (table

11). The primers are also shown in SEQ ID NO:41 and SEQ ID NO:42 of the sequence listing. Polynucleotide DS_PlysC was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides 0TB-CT8I and OTB-CT82 as primers (table 11). The primers are also shown in SEQ ID NO:43 and SEQ ID NO:44 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1 . step 4) of 30 sec.

Table 11 : List of primers used and size of amplificate during Phusion Kit PCR.

The nucleotide sequence of the amplificate UP_PlysC is shown in SEQ ID NO:45. The nucleotide sequence of the amplificate DS_PlysC is shown in SEQ ID NO:46

The joined sequence of polynucleotide UP_PlysC and polynucleotide DS_PlysC is at his 5’-end and 3’-end equipped with a nucleotide sequence each overlapping with the corresponding sequence of pK18mobsacB cut with BamHI.

Said overlapping sequences are required for the NEBuilder HiFi DNA Assembly technique. Plasmid pK18mobsacB was linearized with the restriction endonuclease BamHI. The digestion mixture was subsequently controlled by agarose gel electrophoresis, purified and the DNA concentration quantified.

To assemble the plasmid pK18mobsacB_PlysC, the three polynucleotides i.e. the vector pK18mobsacB cut with BamHI and the amplificates UP_PlysC and DS_PlysC were mixed with the NEBuilder HiFi DNA Assembly Kit ingredients. The assembly mixture thus obtained was used to transform chemically competent E. coli DH10B.

Plasmid DNA from one transformant thus characterized as containing the desired PlysC surrounding was isolated and linearized with the restriction endonuclease AsiSI.

In parallel, a DNA fragment containing the mutated promoter region Pg3N3 was synthesized by PCR using oligonucleotides OTBCT149 and oTBCT150n as primers (table 12). The primers are also shown in SEQ ID NO:47 and SEQ ID NO:48 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1 . step 4) of 30 sec. The sequence of this Pg3N3 insert is shown in SEQ ID NO:49.

Table 12: List of primers used and size of amplificate during Phusion Kit PCR.

To assemble the plasmid pK18mobsacB_APIysC::Pg3N3, the two polynucleotides i.e. the vector pK18mobsacB_APIysC cut with AsiSI and the amplificate Pg3N3 were ligated. The ligation mixture thus obtained was used to transform chemically competent E. coli DH10B.

Plasmid DNA from three transformants thus characterized as containing the desired promoter mutation was isolated and the polynucleotide APIysC::Pg3N3 created within the plasmid during the assembly analyzed by Sanger sequencing.

The analysis of the nucleotide sequences thus obtained showed that the polynucleotide Pg3N3 contained in the plasmid of the three transformants analyzed had the nucleotide sequence presented in SEQ ID NO:49. One of said transformants was called DH10B/ pK18mobsacB_APIysC::Pg3N3 and saved as a glycerol stock for further experiments. Example 6

Construction of strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3 The plasmid pK18mobsacB_APIysC::Pg3N3 obtained in example 5 was used to incorporate the lysC promoter mutation into the chromosome of the strain ATCC 31833_homG378E_lysCT3111 by transformation

The nucleotide sequence of the chromosomal region of strain ATCC

31833_homG378E_lysCT311 l_APIysC::Pg3N3 containing the mutated nucleotide sequence was analyzed by Sanger sequencing after agarose gel electrophoresis.

For this purpose a PCR amplificate was produced spanning the site of mutation. A colony PCR was done using the primers oTB-CT-105 and oTB-CT-64 (see table 13) and the NEB Phusion Kit with an elongation time of 45 sec. (table 1 . step 4). The amplificate obtained was then sequenced using the primers oTB-CT-105 and oTB-CT-64 (see table 131. The nucleotide sequences of the primers used in this context are also shown in SEQ ID NO:50 and 51 . Table 13: List of primers used for colony PCR.

The agarose gel electrophoresis result showed that strain ATCC

31833_homG378E_lysCT311 l_APIysC::Pg3N3 contained the desired promoter mutation, or the desired mutated nucleotide sequence resp., in its chromosome. Thus the lysC gene promoter of strain ATCC 31833_homG378E_lysCT3111 was mutated with the effect that the promoter of the lysC gene was replaced by the strong promotor variant Pg3N3.

Example 7

Construction of plasmid pK18mobsacB_AxylB1 ::[rhtC_Ec] Plasmid pK18mobsacB_AxylB1 ::[rhtC_Ec] was constructed to enable incorporation of the E. coli threonine exporter gene rhtC into the nucleotide sequence of the xylB coding sequence of strain ATCC 31833.

The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_AxylB1 ::[rhtC_Ec] the NEBuilder HiFi DNA Assembly method was used. For this purpose first three polynucleotides or DNA molecules resp. were made: One polynucleotide called xylB_up comprised the 5’-region upstream of the xylB gene sequence. The second polynucleotide called xylB_ds comprised the 3’-end of the xylB gene sequence. The third polynucleotide was plasmid pK18mobsacB linearized by treatment with restriction endonucleases Asel and Pful.

Polynucleotide xylB_up was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides LF443 and LF444 as primers (table 14). The primers are also shown in SEQ ID NO:52 and SEQ ID NO:53 of the sequence listing. Polynucleotide xylB_ds was synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template and oligonucleotides LF445 and LF446 as primers (table 14). The primers are also shown in SEQ ID NO:54 and SEQ ID NO:55 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1 . step 4) of 90 sec.

Table 14: List of primers used and size of amplificate during Phusion Kit PCR.

The nucleotide sequence of the amplificate xylB_up is shown in SEQ ID NO:56. The nucleotide sequence of the amplificate xylB_ds is shown in SEQ ID NO:57.

The joined sequence of polynucleotide xylB_up and polynucleotide xylB_ds is at his 5’-end and 3’- end equipped with a nucleotide sequence each overlapping with the corresponding sequence of pK18mobsacB cut with Asel and Pful.

Said overlapping sequences are required for the NEBuilder HiFi DNA Assembly technique. Plasmid pK18mobsacB was linearized with the restriction endonuclease Asel and Pful. The digestion mixture was subsequently controlled by agarose gel electrophoresis, purified and the DNA concentration quantified. To assemble the plasmid pK18mobsacB_AxylB1 , the three polynucleotides i.e. the vector pK18mobsacB cut with Asel and Pful and the amplificates xylB_up and xylB_ds were mixed with the NEBuilder HiFi DNA Assembly Kit ingredients. The assembly mixture thus obtained was used to transform chemically competent E. coli DH10B. Plasmid was isolated from twenty-two kanamycin resistant transformants using the Qiagen Miniprep Kit and Plasmid identity was confirmed via restriction digest and agarose gel electrophoresis.

Plasmid DNA from one transformant thus characterized as containing the desired AxylBI surrounding was isolated and linearized with the restriction endonuclease Ascl.

In parallel, a DNA fragment containing the rhtC gene from Escherichia coli was synthesized by PCR using oligonucleotides OTBCT340 and OTBCT341 as primers (table 15). The primers are also shown in SEQ ID NO:58 and SEQ ID NO:59 of the sequence listing. For PCR the Phusion Kit was used with an elongation step (see table 1 . step 4) of 30 sec. The sequence of this rhtC insert is shown in SEQ ID NO:60.

Table 15: List of primers used and size of amplificate during Phusion Kit PCR.

To assemble the plasmid pK18mobsacB_ AxylB1 ::[rhtC_Ec], the two polynucleotides i.e. the vector pK18mobsacB_ AxylBI cut with Ascl and the amplificate rhtC were ligated. The ligation mixture thus obtained was used to transform chemically competent E. coli DH10B.

Plasmid was isolated from twenty-two kanamycin resistant transformants using the Qiagen Miniprep Kit and Plasmid identity was confirmed via restriction digest and agarose gel electrophoresis. Plasmid DNA from three transformants thus characterized as containing the desired heterologous rhtC gene was isolated and the polynucleotide AxylBI ::[rhtC_Ec] created within the plasmid during the assembly analyzed by Sanger sequencing.

The analysis of the nucleotide sequences thus obtained showed that the polynucleotide AxylBI ::[rhtC_Ec] contained in the plasmid of the three transformants analyzed had the nucleotide sequence presented in SEQ ID NO:60. One of said transformants was called DH10B/ plasmid pK18mobsacB_ AxylBI ::[rhtC_Ec] and saved as a glycerol stock for further experiments.

Example 8 Construction of strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]

The plasmid pK18mobsacB_AxylB1 ::[rhtC_Ec] obtained in example 7 was used to enable incorporation of the E. coli threonine exporter gene rhtC into the nucleotide sequence of the xylB coding sequence of strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3 by transformation The nucleotide sequence of the chromosomal region of strain ATCC

31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec] containing the rhtC nucleotide sequence was analyzed by Sanger sequencing after agarose gel electrophoresis.

For this purpose PCR amplificates were produced spanning the site of integration. A colony PCR was done using the primers LF484 and LF485 (see table 16). a second colony PCR was done using the primers LF484 and oTBCT 132 (see table 16) and the NEB Phusion Kit with an elongation time of 45 sec. (table 1 . step 4). The nucleotide sequences of the primers used in this context are also shown in SEQ ID NO:61 , 62 and 63. The primer combination LF484/LF485 leads in the wildtype strain to a ca 3 kb PCR product and no product in a desired strain with rhtC insert, primer combination LF484/oTBCT132 leads in the wildtype strain to no product and a ca 3,1 kb product in a desired strain with rhtC insert.

Table 16: List of primers used for colony PCR.

The agarose gel electrophoresis result showed that strain ATCC

31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec] contained the desired integration of the rhtC gene at the gene locus of xylB in its chromosome.

Thus the xylB gene location of strain ATCC 31833_homG378E_lysCT3111_ APIysC::Pg3N3 was mutated with the effect that the heterologous rhtC gene from Escherichia coli was integrated.

Strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec] is named CT-CG- 183.

Example 9 Construction of plasmid pK18mobsacB_DthrE_Cg Plasmid pK18mobsacB_DthrE_Cg was constructed to enable incorporation of a deletion, comprising the thrE coding sequence and the adjoining stop codon into the chromosome of a desired C. glutamicum strain. The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_DthrE_Cg the NEBuilder HiFi DNA Assembly method was used.

For this purpose three polynucleotides or DNA molecules resp. were generated: One polynucleotide called thrE_up comprising the upstream sequence (5’-flanking sequence) and a second polynucleotide called thrE_down comprising the downstream sequence (3’-flanking sequence) of the coding sequence of thrE. The third polynucleotide was plasmid pK18mobsacB linearized by treatment with restriction endonucleases EcoRI, Hindlll The polynucleotides thrE_up and thrE_down were fused during the NEBuilder HiFi DNA Assembly process to give the polynucleotide DthrE, comprising the nucleotide sequence of SEQ ID NO:70, contained in pK18mobsacB_DthrE.

Polynucleotides thrE_up and thrE_down were synthesized by PCR using total DNA isolated from a C. glutamicum ATCC31833 culture as template. For PCR the Phusion Kit was used with an elongation step (see table 1 , step 4) of 15 sec.. For amplification of the upstream sequence (polynucleotide thrE_up) the primers 1f-DthrE and 1r-DthrE and for amplification of the downstream sequence (polynucleotide thrE_down) the primers 2f-DthrE and 2r-DthrE were used (table 17). The primers are also shown in SEQ ID NO:64 to SEQ ID NO:67 of the sequence listing.

Table 17: List of primers used and size of amplificates during Phusion Kit PCR.

The nucleotide sequence of the amplificate thrE_up is shown in SEQ ID NO:68. The nucleotide sequence of the amplificate thrE_down is shown in SEQ ID NO:69.

Amplificate thrE_up contains a sequence of 983 nucleotides of the upstream region of the thrE coding sequence of ATCC31833. At its 5’-end it is equipped with a sequence overlapping with a sequence of pK18mobsacB cut with EcoRV/Hindlll. At its 3’-end it is equipped with a sequence overlapping with a sequence of the amplificate thrE_down. Said sequence at the 3’-end contains the recognition site for the restriction endonuclease AsiSI.

Amplificate thrE_down contains a sequence of 1032 nucleotides of the downstream region of the thrE coding sequence of ATCC31833. At its 5’-end it is equipped with a sequence overlapping with a sequence of the amplificate thrE_up. Said sequence at the 5’-end contains the recognition site for the restriction endonuclease AsiSI. At its 3’-end it is equipped with a sequence overlapping with a sequence of pK18mobsacB cut with EcoRV/Hindlll. Said overlapping sequences are required for the NEBuilder HiFi DNA Assembly technique.

Plasmid pK18mobsacB was cut with the restriction endonuclease EcoRV/Hindlll. The digestion mixture was controlled by agarose gel electrophoresis, the 5664 bp fragment was purified and the DNA concentration quantified.

To assemble the plasmid pK18mobsacB_DthrE the three polynucleotides i.e. the 5664 bp fragment of the vector pK18mobsacB cut with EcoRV/Hindlll, the amplificate thrE_up and the amplificate thrE_down were mixed using the NEBuilder HiFi DNA Assembly Kit. The assembly mixture thus obtained was used to transform chemically competent E. coli DH10B cells.

Plasmid was isolated from fifty kanamycin resistant transformants using the Qiagen Miniprep Kit and Plasmid identity was confirmed via restriction digest and agarose gel electrophoresis.

Fifty kanamycin resistant transformants were analyzed by restriction control. One of the transformants thus characterized containing a plasmid of the desired size was called DH10B/pK18mobsacB_DthrE and saved as a glycerol stock.

DNA of the plasmid pK18mobsacB_DthrE was isolated from said transformant and the polynucleotide DthrE created within pK18mobsacB during the NEBuilder HiFi DNA Assembly was analyzed by Sanger sequencing using the primers pVW_1.p, thrE_for and M13For shown in table 18. Said primers are also shown under SEQ ID NO:71 and SEQ ID NO:73 of the sequence listing.

Table 18: List of primers used for Sanger sequencing.

The analysis of the nucleotide sequence thus obtained showed that the polynucleotide DthrE contained in pK18mobsacB_DthrE had the nucleotide sequence presented in SEQ ID NO:70. Example 10

Construction of strain ATCC

31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]_AthrE::AsiSI

The pK18mobsacB_DthrE plasmid was used to incorporate the deletion of the complete thrE coding sequence and the adjoining stop codon accompanied by the insertion of the recognition site for the restriction enzyme AsiSI into the chromosome of the L-threonine producer ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]

Said deletion of the complete thrE coding sequence and the adjoining stop codon accompanied by the insertion of the recognition site for the restriction enzyme AsiSI is abbreviated as AthrE::AsiSI or deltathrE::AsiSI when appropriate.

Chemically competent cells of E. coli strain S17-1 were transformed with plasmid DNA of pK18mobsacB_DthrE obtained in example 9. The modified conjugation method from Schafer et al. (Journal of Bacteriology 172, 1663 - 1666, 1990) as described in materials and methods was used for conjugal transfer into the strain DM1933 and for selection of transconjugant clones by virtue of their saccharose resistance and kanamycin sensitivity phenotype. Transconjugant clones were analyzed by colony PCR using the primers oTBCTI O and oTBCT11 listed in table 19. followed by size determination of the amplificates by agarose gel electrophoresis. The primers are also shown in SEQ ID NO:74 and SEQ ID NO:75 of the sequence listing. For PCR the Sapphire Mix (see table 3) was used.

Table 19: List of primers used for colony PCR and size of amplificate during Sapphire Mix PCR.

One of the modified clones thus characterized was called ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]_AthrE::AsiSI. A glycerol stock culture of the transconjugant clone was prepared and used as starting material for further investigations.

The nucleotide sequence of the chromosomal region of strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]_AthrE::AsiSI containing the mutated nucleotide sequence, i.e. lack (deletion) of the thrE coding sequence and the adjoining stop codon accompanied by insertion of the recognition site for the restriction endonuclease AsiSI, was analyzed by Sanger sequencing. For this purpose a PCR amplificate was produced spanning the site of mutation. A colony PCR was done using the primers oTBCTIO and oTBCT11 (see table 20) and the Phusion Kit with an elongation time of 65 sec. (step 4 oftable 1). The amplificate obtained was then sequenced using the primers oTBCTI O, oTBCT11 and thrE_for (see table 20). The nucleotide sequences of the primers used in this context are also shown in SEQ ID NO: 74, 75 and 73.

Table 20: List of primers used for colony PCR and Sanger sequencing.

The nucleotide sequence obtained is shown in SEQ ID NO:76. The result showed that strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]_AthrE::AsiSI contained the desired mutation, or the desired mutated nucleotide sequence resp., in its chromosome. Thus the thrE gene of strain ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec was replaced by the AthrE::AsiSI mutation. ATCC 31833_homG378E_lysCT311 l_APIysC::Pg3N3_AxylB1 ::[rhtC_Ec]_AthrE::AsiSI is named CT-CG-184.

Example 11

L-threonine production by strain CT-CG-183 and CT-CG-184

Table 21 : Description of strain CT-CG-183 and CT-CG-184 description genotype name

Strains CT-CG-183 (reference) and CT-CG-184 (table 21) were analyzed for their ability to produce L-threonine from glucose by batch cultivation using the cultivation system according to Wouter Duetz. As medium CGXII containing 20 g/l glucose as carbon source was used. The cultures were incubated for 45 h until complete consumption of glucose as confirmed by glucose analysis using blood glucose-meter and the concentrations of L-threonine and optical density OD660 were determined. The result of the experiment is presented in table 22.

Table 22: L-threonine production by strain CT-CG-183 and CT-CG-184

The experiment shows that L-threonine production was increased in strain CT-CG-184 compared to the parent strain.

Example 12

L-threonine production by strain CT-CG-181 and CT-CG-185

Table 23: Description of strain CT-CG-181 and CT-CG-185 name description genotype

Further developed strains CT-CG-185 and CT-CG-181 (table 231 as reference were analyzed for their ability to produce L-threonine from glucose by batch cultivation using the cultivation system according to Wouter Duetz.

As medium CGXII containing 20 g/l glucose as carbon source was used. The cultures were incubated for 45 h until complete consumption of glucose as confirmed by glucose analysis using blood glucose-meter and the concentrations of L-threonine and optical density OD660 were determined. The result of the experiment is presented in table 24. Table 24: L-threonine production by strain CT-CG-181 and CT-CG-185

The experiment shows that L-threonine production was increased in strain CT-CG-185 compared to the parent strain CT-CG-181 .

Example 13

L-threonine production in DASGIP system by strains CT-CG-178, CT-CG-184 and CT-CG-185 in comparison to their references

Table 25: Description of strain CT-CG-176 and CT-CG-178 name description genotype

Further developed strains CT-CG-178 and CT-CG-176 (table 25) as reference as well as described strains CT-CG-183 and CT-CG-184 (table 211 and CT-CG-181 and CT-CG-185 (table 231 were analyzed for their ability to produce L-threonine from glucose by cultivation using the cultivation system according to DASGIP.

The fermentation is performed in 1 L reactors in a DasGip parallel reactor system equipped with overhead stirrers carrying one Rushton impeller blade. The blade is located at the bottom end of the stirrer bar. PH and pO_å are measured online for process monitoring. OTR/CTR measurements serve as estimates for metabolic activity and cell fitness. As fermentation medium A1-1504 (table 26) is used.

Conditions for growth and production

• Start volume: 300 mL A1-1504 Media (media + glucose + thiamine)

• Start-OD: 0.1

• pH 7.0 controlled using 2.5 M H2SO4 and 12.5% Ammonia

• 500 g/L glucose feed solution at 5 g/Lh (referring to initial volume of 300 mL)

• DO: 30% - cascade stirrer (min. 400 rpm) and airflow 6 s/Lh(min. 0.33 wm)

• Addition of antifoam Struktol J647 triggered by level probe

• Temperature: 34°C

• Duration of fermentation: up to 90 h

Table 26: medium A1 -1504, 2% glucose

Add after vessel has been autoclaved

Prepare fresh and filter sterilize, add to vessel after vessel has been autoclaved

The concentrations of L-threonine and the cell dry weight were determined. The results of the experiment are shown in table 27.

Table 27: L-threonine production by strains CT-CG-178, CT-CG-184 and CT-CG-185 in comparison to their references.

As shown in table 27. the strain CT-CG-178 accumulated L-threonine in a larger amount than the strain CT-CG-176, in which the thrE was not deleted. The same applies to the strains CT-CG-184 and CT-CG-185 respectively previously shown in comparison to their respective reference strains CT-CG-183 and CT-CG-181 respectively.

Example 14

Design of exchange vectors pK18_Ppyc_K01 and pK18_Ppyc_K02

In the following, the increase in L-threonine production due to the positive influence of the increase in expression strength (not shown here; for the strains CT-CG-184_Ppyc_K01 and CT-CG- 184_Ppyc_K02 compared to the initial strain (CT-CG-184) a relative increase in expression of the pyc gene by the factor 12.2 and 11 .7 respectively could be measured) of the pyc gene in C. glutamicum strains are demonstrated using one of the Ppyc promoters of the invention (table 28). As the starting strain the C. glutamicum production strain from example 10 was selected.

Table 28: Shown are the nucleotide sequences of the pyc promoter Ppyc_K01 and that of the pyc promoter Ppyc_K02 according to the present invention, as well as the corresponding wild type sequence of the reference (ATCC31833 corresponds to ATCC13032; Numbering according to the gene bank entry with the Accession-Number NC_003450.3) in the range 705 111 - 705 210, i.e. the 100 nucleotides before the translation start of pyc (705 211). The nucleotide exchanges are highlighted compared to the wild-type reference genome.

Region Nucleotide-Sequence

705148 - 705184 TACTAGGACGCAGTGACTGCTATCACCCTTGGCGGTC Ppyc_K01 , TGGTAGGACGCAGTGACTGCTATCACCCTTGGCGGTC

705148 - 705184 Ppyc_K02, TGGTAGGACGCAACAGCTGCTACTGTCCTTGGCGGTC

705148 - 705184 wildtyp-reference,

705185 - 705210 TCTTGTTGAAAGGAATAATTACTCTA Ppyc_K01 , TCTTGTTGAAAGGAATAATTACTCTA

705185 - 705210 Ppyc_K02, TCTTGTTGAAAGGAATAATTACTCTA

705185 - 705210

The native promoter Ppyc of the initial strain was replaced with the Ppyc_K01 and the Ppyc_K02 promoter respectively previous to the pyc gene at the native gene location. First, a DNA construct containing an 396 bp (396 base pairs) comprising intergenic range upstream of the pyc gene, which contains the mutated promoter Ppyc_K01 or Ppyc_K02, flanked by a 427 bp range (3^'region of the IpdA gene encoding the dihydrolipamide dehydrogenase) and a 690 bp range (5^' region of the gene pyc coding the pyruvate carboxylase) is synthesized. For later subcloning of the entire fragment, flanking restriction sites for the restriction endonucleases Xbal and Hindlll were added. This DNA construct enables an efficient homologous recombination to install the mutant promoter instead of the wild-typical promoter. The DNA sequence containing the Ppyc_K01 is shown as an example in SEQ ID NO:87. The total length of 1525 bp DNA constructs was digested with the restriction enzymes Xbal and Hindlll and subsequently cloned into the mobilizable vector pK18mobsacB described by Schafer et al. (Genes, 145, 69-73 (1994).) The vector construct pK18_Ppyc_K01 or pK18_Ppyc_K02 thus obtained was checked by sequencing.

The new vectors pK18_Ppyc_K01 and pK18_Ppyc_K02 were stored in stockagar culture (E. coli K12/pK18_Ppyc_K01 and K02 respectively).

Example 15

Construction of C.glutamicum strains CT-CG-184PpycK01 and CT-CG-184PpycK02 The mutations Ppyc_K01 and Ppyc_K02 should now be introduced into the strain Corynebacterium glutamicum CT-CG-184 (example 10).

The vectors pK18_Ppyc_K01 and pK18_Ppyc_K02 were introduced into cells of Corynebacterium glutamicum CT-CG-184 using a modified electroporation method from van der Rest et al. (Appl Microbiol Biotechnol (1999) 52: 541-545). The vectors pK18_Ppyc_K01 or pK18_Ppyc_K02 cannot replicate independently in CT-CG-184 and are only preserved in the cell if it is integrated into the chromosome as a result of a recombination event. The selection of electroporants, i.e. clones with integrated vector pK18_Ppyc_K01 or_K02, was made by flattening the electroporation approach to EM8-agar (table 29). which had been supplemented with 25 mg/I kanamycin and 50 mg/I nalidixic acid. Kanamycin-resistant electroporants were subsequently brought on BHI agar plates (brain heart broth; Merck, Darmstadt, Germany) supplemented with kanamycin (25 mg/I) and nalidixinic acid (50 mg/I) and incubated for 24 hours at 33°C. For the selection of mutants in which the excision of the vector (either with the native (wild- typical) Ppyc or with the mutant Ppyc_K01 or _K02 promoter) had taken place as a result of a second recombination event, the clones were unselectively cultivated in BHI liquid medium at 33 °C, then cultured to BHI-Agar supplemented with 10% sucrose and nalidixic acid (50 mg/I) and incubated for 48 hours at 33°C.

Table 29: Components of EM8

All components - except sterile filtered ones - have been H20 solved, adjusted to pH 6.8 with NaOH, refilled to 80% of the total volume and autoclaved. After autoclaving the sterile substrate- and vitamin solutions as well as the separately autoclaved CaC03 were added and replenished to the final volume.

The vectors pK18_Ppyc_K01 and _K02 (as well as the initial vector pK18mobsacB) contain a copy of the sacB gene encoding for the levane sucrase from Bacillus subtilis in addition to the kanamycin resistance gene. The by sucrose inducible expression of the sacB gene leads to the formation of levane sucrase, which catalyzes the synthesis of the for C. glutamicum toxic product levane from sucrose. Therefore, only clones grow on BHI-Agar supplemented with sucrose in which either - undesirable - the previously integrated (e.g. the sacB gene carrying) vector pK18_Ppyc_K01 or pK18_Ppyc_ K02 with the mutated promoter region Ppyc_K01 or_K02 completely or - as desired - the vector (e.g. the sacB gene carrying) was excitated together with the native (wild- typical) promoter region Ppyc as a result of the second recombination event. Depending on the location of the second recombination event in relation to the mutation location, the excision of the introduced vector either incorporates the mutation or the original (native) promoter variant remains in the chromosome of the host.

Subsequently, among the clones in which the second recombination event had taken place, a clone was searched for in which the desired replacement, i.e. the installation of the promoter Ppyc_K01 or Ppyc_K02 respectively in the upstream area of the pyc gene, had taken place.

For this purpose, 200 clones have been studied for the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" and 48 colonies each, which had the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin", for the integration of the promoter Ppyc_K01 or Ppyc_K02 respectively into the upstream range of the pyc-gene using the polymerase chain reaction (PCR).

For this purpose, the primers shown in table 30 were manufactured and used:

Table 30: Primer for Control PCR

The primers pycUP_3.p (SeqlDNo 88) and pyc_seq (SeqlDNo 89) allow the amplification of a 727 bp large DNA fragment containing the upstream area of the pyc gene (i.e. the promoter area and the 5^' region of the pyc gene). The PCR reactions were performed with the Taq PCR Core Kit from Qiagen (Hilden, Germany), containing the Taq DNA polymerase from Thermus aquaticus, in a master cycler of the company Eppendorf (Hamburg, Germany), the conditions in the reaction approach have been used according to the manufacturer. The PCR approach was first subjected to an introductory denaturing at 95°C for 5 minutes. This was followed 30 times by a denaturing step at 95°C for 30 seconds, a step to bind the Primer to the DNA at 50°C for 30 seconds and the extension step to extend the primer at 72°C for 40 sec. After the final extension step for 4 min at 72°C, the amplified products have been tested by capillary electrophoresis in the Qiaxcel (Qiagen; Hilden, Germany).

Subsequently, the PCR products of some mutants were tested using the primer pycUP_3.p. In this way, mutants were identified, which had the promoter Ppyc_K01 or_K02 respectively integrated into the chromosome.

For the production of glycerol stocks, the strains were incubated in BHI liquid medium (Merck, Darmstadt, Germany) for 16 hours at 33°C and then, mixed in aliquots with 10% glycerin, frozen at -80°C. From the stocks, a PCR and a sequencing were carried out again for control as described above.

Example 16

Cultivation of C.glutamicum strains CT-CG-184PpycK01 and CT-CG-184PpycK02 and production of L-threonine

Starting from glycerol-stock cultures, a preculture (10 ml medium in 100 ml Erlenmeyer flask with baffles) was inoculated with 50 pi. The medium for the preculture was the medium CGXII + CSL (table 311. Table 31 : CGXII + CSL- medium:

For the production of the CGXII + CSL medium, all components - except those separately autoclaved or sterile filtered - (table 3T) were dissolved in dest. H20, set to pH 7.0 with NaOH and refilled to 80% with dest. H20 and autoclaved. After that, the sterile substrate- and vitamin solutions were added and filled to the final weight with dest. H20.

The C. glutamicum strains CT-CG-184PpycK01 and CT-CG-184PpycK02 and the starting strain CT-CG-184 were cultivated in a nutrient medium suitable for the production of threonine and the threonine content in the culture was determined.

Based on the glycerol stocks, a preculture was inoculated (10 ml medium in the 100 ml Erlenmeyer flask). The medium for the preculture was the medium CGXII (table 4). The preculture was cultured 24 hours at 33°C and 200 rpm in the Infors-Shaker (Infers HT Multitron Standard, Infers AG; Bottmingen, Switzerland). A main culture was inoculated by this preculture, so that the initial OD (660 nm) of the main culture was 0.1 OD. The main culture also uses the medium CGXII.

All components - except sterile filtered ones - (table 4) were H20 dissolved, set to pH 7.0 with NaOH, refilled to 80% of the total volume and autoclaved. After autoclaving, the sterile substrate- and vitamin solutions were added and filled to the final weight. The cultivation of the test organisms took place in the Infors-lncubation Shaker (Infors AG, Bottmingen Schweiz) in volumes of 10 ml, which were contained in 100 ml baffled Erlenmeyer flasks. The temperature was 33°C, the revolution was 200 rpm. After 45 hours, the optical density (OD) at a measuring wavelength of 660 nm was determined with the Tecan GENios (Tecan Group Ltd., Mannedorf, Switzerland). The amount of threonine formed was measured with an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection. Table 32 shows the result of the experiment.

Table 32: Production of L-threonine

All values are mean values of 3 independent experiments with the mentioned strains.

The result shows the positive effect on the formation of the desired product (L-Threonine) by using the promoter variants Ppyc_K01 or Ppyc_K02 in the strains CT-CG-184PpycK01 or CT-CG- 184PpycK02 in relation to the initial strain CT-CG-184.

Claims

1 . A recombinant bacterium of the genus Corynebacterium comprising a L-threonine exporter gene rhtC coding for a L-threonine exporter RhtC from E. coli, wherein in said bacterium the native L-threonine transporter gene thrE coding for the native L-threonine exporter ThrE of Corynebacterium is deleted.

2. The bacterium of claim 1 , wherein the L-threonine exporter RhtC comprises the amino acid sequence according to SEQ ID NO: 2.

3. The bacterium as claimed in claims 1 or 2, comprising at least one copy of a lysC gene coding for a feedback resistant aspartokinase.

4. The bacterium of claim 3, wherein the feedback resistant aspartokinase comprises the amino acid sequence according to SEQ ID NO: 6 containing lie at position 311 instead of Thr.

5. The bacterium of claim 4, wherein the feedback resistant aspartokinase comprises the amino acid sequence according to SEQ ID NO: 8.

6. The bacterium as claimed in any of claims 3 to 5, wherein at least one copy of the lysC gene is functionally linked to a strong promoter.

7. The bacterium as claimed in any of the preceding claims comprising at least one copy of a hom gene coding for a feedback resistant homoserine dehydrogenase.

8. The bacterium of claim 7, wherein the feedback resistant homoserine dehydrogenase comprises the amino acid sequence according to SEQ ID NO: 10 containing Glu at position 378 instead of Gly.

9. The bacterium of claim 8, wherein the feedback resistant homoserine dehydrogenase comprises the amino acid sequence according to SEQ ID NO: 12.

10. The bacterium as claimed in any of claims 7 to 9, wherein the hom gene is functionally linked to a strong promoter.

11 . The bacterium as claimed in any of the preceding claims, wherein the bacterium further comprises an overexpressed pyc gene coding for a pyruvate carboxylase.

12. The bacterium of claim 11 , wherein the pyruvate carboxylase comprises the amino acid sequence according to SEQ ID NO: 78 containing Ser at position 458 instead of Pro.

13. The bacterium of claims 11 or 12, wherein the pyc gene is overexpressed by an increased copy number of the pyc gene in comparison with the copy number in the wildtype strain.

14. The bacterium as claimed in any of claims 11 to 13, wherein the pyc gene is functionally linked to a strong promoter.

15. The bacterium of claim 14, wherein the pyc gene is functionally linked to a promoter according to SEQ ID NO: 82.

16. The bacterium of claim 14, wherein the pyc gene is functionally linked to a promoter according to SEQ ID NO: 83.

17. The bacterium as claimed in any of the preceding claims, wherein the bacterium is of the species Corynebacterium glutamicum.

18. A method for the fermentative production of L-threonine, comprising the steps of cultivating the bacterium of the genus Corynebacterium as defined in any of the preceding claims in a suitable medium under suitable conditions, accumulating L-threonine in the medium to form an L- threonine containing fermentation broth and purifying the L-threonine.