CN109762830A - Regulate and control the myb transcription factor FvMYB330 gene of eugenol accumulation and its application in strawberry fruit - Google Patents

Abstract

The invention discloses a kind of myb transcription factor FvMYB330 genes of eugenol accumulation in regulation strawberry fruit, it is related to plant molecular gene engineering technology field, FvMYB330 gene provided by the invention has the nucleotide sequence as shown in SEQ ID NO:1, the present invention also provides the amino acid sequence of FvMYB330 gene coding, expression vector, host strain containing above-mentioned FvMYB330 gene, FvMYB330 gene provided by the invention can be applied to eugenol accumulation in regulation strawberry fruit, expression EGS1, EGS2, CAD gene.The beneficial effects of the present invention are: the present invention clones strawberry myb transcription factor FvMYB330 gene, overexpression FvMYB330 promotes the accumulation of strawberry fruit eugenol in strawberry, while eugenol synthesis oligogene EGS1, EGS2, CAD expression quantity obviously increases.

Description

Regulate and control strawberry fruit in eugenol accumulation myb transcription factor FvMYB330 gene and It is applied

Technical field

The present invention relates to plant molecular gene engineering technology fields, and in particular to it is a kind of regulation strawberry in eugenol accumulation Myb transcription factor FvMYB330 gene and its application.

Background technique

Strawberry (Fragaria × ananassa Duch.) is the herbaceos perennial of rosaceae Fragaria, fruit colour Bright-coloured, fragrant strong, sour and sweet palatability, nutrition and health care value with higher has the good reputation of " fruit queen ".Fragrance is evaluation One of the important indicator of strawberry fruit quality, has identified more than 360 kinds of volatile materials so far, in strawberry fruit, many of Component is related with fruit aroma quality, mainly includes esters, alcohols, aldehydes, ketone, furanone, eugenol, sulfur-containing compound Deng.Eugenol (4-Allyl-2-methoxyphenol) is to be widely present in a kind of important benzene in plant flowers and ripening fruits Ring-like/phenylpropionic acid volatile matter has various biological effect and medical health care function.Such as attract biology pollination and propagates kind Son defends herbivore, can also be used as the invasion of the protective agent defence parasites such as pathogen, at the same also have it is anti-oxidant, The functions such as antibacterial, pest-resistant and seasoning, current research discovery, eugenol can prevent and treat diabetes.Therefore, carry out eugenol in strawberry The correlative studys such as metabolism and accumulation in fruit, have a very important significance.

The biosynthesis pathway of eugenol is substantially clear, and relative enzyme gene is also cloned and identified successively.Cloves The L-phenylalanine that the synthesis precursor of phenol is generated from shikimic acid pathway, through phenylalanine lyases (PAL), cinnamic acid -4- hydroxyl Change enzyme (C4H), p-coumaric acid -3- hydroxylase (C3H), caffeic acid 3-O- transmethylase (COMT), 4- coumaric acid coacetylase Ligase (4CL), cinnamoyl_CoA reductase (CCR) and cinnamyl-alcohol dehydrogenase (cinnamyl-alcohol Dehydrogenase, CAD) catalytic action under form coniferyl alcohol；Effect of the coniferyl alcohol in pine and cypress alcohol acetyl transferase (CFAT) Lower formation coniferyl alcohol, coniferyl alcohol synthesize cloves under the catalytic action of eugenol synzyme (eugenol synthase, EGS) Phenol.Although the biosynthesis pathway of eugenol is substantially clear in plant, closely related volatility is synthesized with eugenol Benzenoid form/benzenpropanoic acid metabolic pathway regulated and control network is still inaccurate and perfect.

Recently, it has identified to obtain the R2R3-MYB transcription factor (FaEOBII) of a regulation eugenol synthesis in strawberry, The gene expression is inhibited and the acid active that falls off by auxin, and the expression of just adjusted and controlled gene FaCAD1 and FaEGS2.It is interesting , the promoter of FaEOBII contains MYB binding site, and by the direct regulation and control of FaMYB10, the silencing of FaMYB10 expresses meeting Lead to FaEOBII expression downward and anthocyanidin and eugenol synthesis decline, but with the presence or absence of other eugenols in strawberry Controlling gene and eugenol synthesis regulation network are unclear.

Summary of the invention

Present invention solves the technical problem that being to provide a kind of regulation strawberry fruit for the deficiencies in the prior art The myb transcription factor FvMYB330 gene of middle eugenol accumulation.

The present invention adopts the following technical solutions solves above-mentioned technical problem:

Regulate and control the myb transcription factor FvMYB330 gene of eugenol accumulation in strawberry fruit, the FvMYB330 gene tool Just like nucleotide sequence shown in SEQ ID NO:1.

Preferably, the amino acid sequence of the FvMYB330 gene coding is as shown in SEQ ID NO:2.

The present invention also provides the expression vectors for containing above-mentioned FvMYB330 gene.

Preferably, the expression vector is pCXSN-FLAG-FvMYB330.

The present invention also provides the host strains for containing above-mentioned FvMYB330 gene.

The present invention also provides application of the above-mentioned FvMYB330 gene in regulation strawberry fruit in eugenol accumulation.

The present invention also provides application of the above-mentioned FvMYB330 gene in expression EGS1, EGS2, CAD gene.

The present invention also provides a kind of methods accumulated by eugenol in FvMYB330 gene regulation strawberry fruit, will be described FvMYB330 gene injection enters in strawberry.

Preferably, the method accumulated by eugenol in FvMYB330 gene regulation strawberry fruit, including following step It is rapid:

(1) pCXSN-FLAG-FvMYB330 expression vector is constructed；

(2) Agrobacterium is converted；

(3) identified correct single colonie in picking step (2), infects strawberry fruit using injection method.

The beneficial effects of the present invention are:

(1) present invention clones strawberry myb transcription factor FvMYB330 gene, and passes through dip dyeing strawberry fruit test hair Existing, overexpression FvMYB330 promotes strawberry fruit eugenol to accumulate in strawberry, while eugenol synthesis oligogene EGS1, EGS2, CAD expression quantity obviously increase；

(2) present invention inquires into strawberry eugenol using Biochemistry and Molecular Biology and transgenic technology means and accumulates Molecular regulation mechanism, to promote the molecular breeding of biosynthesis of strawberry eugenol to provide new genetic resources.

Detailed description of the invention

Fig. 1 is FvMYB330 gene cloning PCR gel electrophoresis figure in the embodiment of the present invention 1；

Fig. 2 is plant overexpression plasmid pCXSN-FLAG plasmid map used in the embodiment of the present invention 2；

Fig. 3 is that real-time quantitative PCR detects FvMYB330 gene expression results after strawberry fruit injection in the embodiment of the present invention 3 Figure；

Fig. 4 is the variation diagram of cloves phenol content after GC-MS detection injection strawberry fruit in the embodiment of the present invention 3；

Fig. 5 is that real-time quantitative PCR detects eugenol synthesis key gene after strawberry fruit injection in the embodiment of the present invention 3 CAD expression figure；

Fig. 6 is that real-time quantitative PCR detects eugenol synthesis key gene after strawberry fruit injection in the embodiment of the present invention 3 EGS1 expression figure；

Fig. 7 is that real-time quantitative PCR detects eugenol synthesis key gene after strawberry fruit injection in the embodiment of the present invention 3 EGS2 expression figure；

Wherein blank control is the fruit after infected liquid infects, and zero load control is the fruit that pCXSN-FLAG empty carrier infects Real, 1 and 2 be the fruit after pCXSN-FLAG-MYB330 Agrobacterium is infected.

Specific embodiment

In order to be easy to understand the technical means, the creative features, the aims and the efficiencies achieved by the present invention, tie below Specific embodiment is closed, the present invention is further explained.

Experimental method in following embodiments is unless otherwise specified conventional method or according to proposed by manufacturer Condition.

Test material and reagent as used in the following examples etc., unless otherwise specified, commercially obtain.

Embodiment 1

The clone of strawberry myb transcription factor FvMYB330 gene

Using strawberry genomic information as template, by bioinformatic analysis and correlation analysis, candidate gene is obtained MYB330 designs full length gene primer；Using the cDNA of " Hawaii4 " strawberry phase fruit green greatly as template, the wherein extraction of cDNA Using MYB330-R as downstream primer, PCR reaction is carried out, clone obtains using MYB330-F as upstream primer for the prior art FvMYB330 gene converts pMD18-T carrier, and it is spare to extract plasmid.

(1) candidate gene MYB330 is searched for, in rosaceae database GDR (www.Rosaceae.org) with MYB330 base Because the area overall length CDS is purpose segment, upstream and downstream primer is designed.

The primer sequence are as follows:

MYB330-F:ATGGTAGGGAGGGGAAGAAC；

MYB330-R:TCAGTTAGCGGAGTTCTCTG.

(2) PCR system is as follows:

PCR response procedures are as follows: 94 DEG C of denaturation 1min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 45sec, 35 circulations；72 DEG C of 10min, 4 DEG C of heat preservations.

(3) step of converting is as follows:

1. connection product converts E. coli competent: recombinant DNA is adhered to bacterial cell surface, by 42 DEG C of thermal shock 90sec is handled, promotes to absorb DNA, then the shake culture 1h in 37 DEG C of non-selection LB liquid (being not added with antibiotic) culture mediums, It is uniformly coated to be incubated overnight for 37 DEG C in the solid LB media of 100mg/L ampicillin (Amp)；

2. picking monoclonal re-starts activation, i.e., the scribing line activation again on new antibiotic solid medium, 37 DEG C are incubated overnight；

3. picking colony carries out bacterium colony PCR reaction detection according to above-mentioned PCR reaction system；

4. according to bacterium colony PCR as a result, picking colony, is placed in the LB liquid medium of addition 100mg/L Amp and shakes training 12h is supported, the sequencing of Hai Shenggong bioengineering Co., Ltd is served；

Correct single colonie is sequenced 5. choosing, is inoculated with the LB liquid medium into 20mL (Amp containing 100mg/L), 37 DEG C are shaken Bed shakes 12-16h, upgrading grain.

(4) steps are as follows for upgrading grain:

1. taking the bacterium solution of 1-4mL overnight incubation in LB culture medium, 12000 × g is centrifuged 1min, abandons supernatant to the greatest extent.

2. plus 250 μ L Buffer S1 suspension cells precipitating, suspending needs uniformly, should not there are small fungus blocks.

3. RNaseA is added in Buffer S1；

4. 250 μ L Buffer S2 are added, spinning upside down mildly and fully 4-6 times and being uniformly mixed splits thallus sufficiently Solution, until forming bright solution.

5. 350 μ L Buffer S3 are added, mildly and fully spin upside down 4-6 times, 12000 × g is centrifuged 10min.

6. centrifugation supernatant in aspiration step 4 is simultaneously transferred to preparation pipe (providing in kit), 12000 × g is centrifuged 1min, Abandon filtrate.

7. putting back into centrifuge tube for pipe is prepared, adds 500 μ L Buffer W1,12000 × g to be centrifuged 1min, abandon filtrate.

8. putting back into centrifuge tube for pipe is prepared, adds 700 μ L Buffer W2,12000 × g to be centrifuged 1min, abandon filtrate, repeat one It is secondary.

9. will prepare pipe to put back into 2mL centrifuge tube, 12000 × g is centrifuged 1min.

10. moving into pipe is prepared in new 1.5mL, add 60-80 μ L Eluent or deionized water, room preparing periosteum center Temperature stands 1min, and 12000 × g is centrifuged 1min.

Fig. 1 be FvMYB330 gene cloning PCR gel electrophoresis figure, FvMYB330 gene order overall length 1134bp, The base sequence of FvMYB330 gene is as shown in SEQ ID NO:1, the amino acid sequence such as SEQ ID of FvMYB330 gene coding Shown in NO:2,377 amino acid are encoded.

Embodiment 2

Construct pCXSN-FLAG-FvMYB330 expression vector

PCXSN-FLAG plasmid is that a plant is overexpressed plasmid, and 35S promoter driving FLAG label and target gene melt Expression is closed, under the action of ccdb lethal gene, clone gene becomes to be more easier, and positive rate is high, plasmid map such as Fig. 2 institute Show.

The FvMYB330 gene that embodiment 1 is obtained converts pMD18-T carrier, extracts plasmid；With FvMYB330- PCXSN-F and FvMYB330-pCXSN-R is amplimer, carries out PCR reaction by template of pMD18-T-FvMYB330 plasmid, Recycle target gene product；Target gene and pCXSN-FLAG carrier are attached；Heat shock method conversion is big after 16 DEG C of connection 12h Enterobacteria competence；It extracts and verifies correct bacterial strain plasmid, freeze-thaw method conversion Agrobacterium competence GV3101 (is purchased from Shanghai only Bioisystech Co., Ltd)；Bacterium colony PCR identification.

Specific steps are as follows:

Recombination to construct is carried out using pCXSN-FLAG Overexpression vector, chooses 20bp's or so at the 5 ' ends of FvMYB330 Segment design primer, and a base A, the upstream primer as target fragment are added before special primer；FvMYB330's Choose the segment design primer of 20bp or so, the downstream primer as target fragment in 3 ' ends.Primer information is as follows: with MYB330- PMD18-T be template amplification obtain target fragment PCR product it is recovered after, be connected to pCXSN-FLAG carrier through Soultion1, It is built into purpose carrier.Choose after bacterium colony PCR reaction correctly monoclonal bacterial strain, extract plasmid and with pCXSN-FLAG carrier from Body upstream primer pCXSN-FLAG-F and MYB330 downstream primer FvMYB330-pCXSN-R carries out PCR verifying.

(1) according to the correct sequence of MYB330-pMD18-T sequencing gained, over-express vector pCXSN-FLAG, design are connected Add the primer of base A before special initiation codon.

The primer sequence are as follows:

FvMYB330-pCXSN-F:AATGGTAGGGAGGGGAAGAAC；

FvMYB330-pCXSN-R:TCAGTTAGCGGAGTTCTCTG；

PCXSN-FLAG-F:GATTACAAGGATGATGATGAT.

(3) PCR response procedures are as follows: 94 DEG C of denaturation 1min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C extend 45sec, 35 circulations；72 DEG C of 10min, 4 DEG C of heat preservations.

(4) Agrobacterium-mediated Transformation step are as follows:

1. taking out the competence Agrobacterium saved from -80 DEG C to melt on ice；

2. every 100 μ L competence add 1 μ g Plasmid DNA mix, successively on ice stand 5min, liquid nitrogen 5min, 37 DEG C of 5min, Ice bath 5min；

3. the LB liquid medium of 700 μ L antibiotic-frees is added, in 28 DEG C of 2~3h of shaken cultivation；

4. 5000rpm is centrifuged three minutes collection bacterium, the supernatant for leaving and taking 50 μ L or so, which is gently inhaled to beat that fungus block is resuspended and is coated on, to be contained On the LB plate of corresponding antibiotic, inversion is put in 28 DEG C of incubator cultures 2~3 days

5. choosing single colonie culture and identifying, identify that the every 300 μ L of correct bacterium solution is added 50% glycerol, 700 μ L and is placed in -80 DEG C It saves.

Embodiment 3

Turn myb transcription factor FvMYB330 gene strawberry acquisition and the gene strawberry fruit expression pattern

(1) it selects embodiment 2 and identifies that correct single colonie carries out strawberry fruit and infects；Select the octoploid in big green fruit period Fruit is test material, carries out fruit using injection method and infects, the specific method is as follows:

1. choosing the positive colony of the plasmid containing pCXSN-FLAG-MYB330, it is seeded in 15mLLB culture medium (containing 50mg L^-1Card that and 50mg L^-1Rifampin), 28 DEG C, 200rpm (rev/min) shake bacterium to OD600 ≈ 2.0.

2. the LB liquid medium for taking 20mL fresh is (containing 50mg L^-1Card that and 50mg L^-1Rifampin), access 1mL The Agrobacterium of step 1,28 DEG C, 200rpm shakes to OD₆₀₀≈0.6。

3. collecting bacterium solution, room temperature, 6000rpm are centrifuged 3min.

4. under room temperature, 6000r/s is centrifuged 3min with infected liquid again suspension bacteria liquid.Infected liquid configuration: it is respectively configured Concentration is 1.0mol L^-1MES, 1.0mol L^-1MgCl₂And concentration is 1.0mol L^-1Acetosyringone, take 200 μ L MES, 200 μ L MgCl₂, 20 μ L acetosyringones, aqua sterilisa is settled to 20mL, as infected liquid, spare.

5. it is 4. primary to repeat step.

6. finally being suspended again bacterial strain with 20mL infected liquid, the static 2h of room temperature, injection method infects strawberry fruit.

Data determination: pCXSN-FLAG-MYB330 Agrobacterium is injected into fruit, using Medina-Puche et al (2015) method described in carries out fluorescent quantitation QPCR, analyzes the gene in the expression pattern of strawberry fruit.

(2) PCR program are as follows:

(3) PCR response procedures are as follows: 95 DEG C, 2min；95 DEG C, 15sec；60 DEG C, 1min (50 circulations)；Solubility curve.

(4) measuring method of cloves phenol content are as follows:

Strawberry fruit cloves phenol content: 10 fruits of each processing, three weights is measured using solid phase microextraction GC-MS method It is multiple；

1. 0.5g strawberry fruit ground sample is packed into 7mL sealing container, it is full that 1.25mL is added in water-bath 5min under the conditions of 30 DEG C And NaCl solution, and 3ng β-carypohyllene is added and does internal standard；

2. 1mL mixture is transferred to 10mL container after sample homogenization；

3. 100 μm of PDMS extracting heads are protruded into sample, 30min is extracted under the conditions of 50 DEG C, then 50 DEG C of heat preservations 10min；

4. 250 DEG C of desorption 1min on gas chromatograph-mass spectrometer；

GC operating condition: chromatographic column is HP-5MS quartz capillary column (30m × 0.25mm × 0.25 μm), and carrier gas is helium (He) (99.999%), injector temperature are 250 DEG C.Temperature programming: initial temperature be 40 DEG C, keep 3min, then with 5 DEG C/ The speed of min is warming up to 250 DEG C, keeps 5min.MS operating condition: ionization mode is EI, and ion source temperature is 200 DEG C.It shunts Sample introduction, flow velocity 1.2mL/min, streaming rate 20, electron energy 70eV.Scanning range is 30-500m/z, when solvent is cut off Between 0.05min.

Experimental result:

Fig. 3 is that real-time quantitative PCR detects FvMYB330 gene expression results figure after strawberry fruit injection, wherein blank control Fruit after infecting for infected liquid, zero load control are the fruits that pCXSN-FLAG empty carrier infects, and 1 and 2 be pCXSN-FLAG- MYB330 Agrobacterium infect after fruit, it can be seen that Agrobacterium injection after, the expression quantity of gene M YB330 obviously rises；

Fig. 4 is eugenol changes of contents in strawberry fruit after GC-MS detection injection pCXSN-FLAG-MYB330 Agrobacterium Figure, wherein blank control is the fruit after infected liquid infects, and zero load control is fruit that pCXSN-FLAG empty carrier infects, 1 and 2 It is the fruit after pCXSN-FLAG-MYB330 Agrobacterium is infected, it can be seen that after Agrobacterium injection, eugenol contains in strawberry fruit Amount dramatically increases；

Fig. 5, Fig. 6, Fig. 7 be respectively real-time quantitative PCR detection strawberry fruit injection after eugenol synthesis key gene CAD, EGS1 and EGS2 expression figure, it can be seen that after gene FvMYB330 excess, eugenol synthesizes oligogene EGS1, EGS2, CAD table It is significantly risen up to amount.

The above is only the preferred embodiment of the present invention, protection scope of the present invention is not limited in above-described embodiment, with The various process programs of present inventive concept indifference are within the scope of the invention.

Sequence table

<110>Agricultural University Of Anhui

<120>regulate and control the myb transcription factor FvMYB330 gene of eugenol accumulation and its application in strawberry fruit

<130> 100

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1134

<212> DNA

<213> Fragaria × ananassa Duch.

<400> 1

atggtaggga ggggaagaac accatgttgt gataagagcc aagtgaagag aggaccttgg 60

agtccttctg aggacttaag gctcatcagc ttcattcaga aacacggtca tgataactgg 120

agggctctcc ctaaacaagc aggtttactg cgatgtggga aaagttgtcg tttgagatgg 180

atcaactacc ttcggcctga tctgaagcga ggtaacttca caaaggagga agaagagtcc 240

atcattatgc tacatgaagc atggggaaac aagtggtcca aaattgcatc ccattttcct 300

ggaagaacag acaacgaaat caagaatgtg tggaacactc atctgcggaa gaaattggct 360

ttgaagtatt cttgtggaga tgatcaatca aaggagttat cttccataac ttcctcttca 420

tcctcatcat cttcttccag tgcttcattt cagttgtcta gtggagaacc gagtgcagga 480

gtcaccgctg aattacagaa tcaacctaac caagaaagca acacgtccaa gacccggaac 540

gactgtgaac tgcccgattc gttgacaatc caagaaaaac ttgaaaaaaa attaccaatg 600

gaagtaacag atcaagttag ggttgatgat gctgtaggca tgaaaatgtt gacgacaagt 660

tcatcctttt catcctacgc ctcctcaaac ggttcaagtt ccagccaagg gggcggtgtt 720

tcgaggccag atgatttggt gtttgactta aaaggagctt atgaacctca aatagcagac 780

aaggcagtct ttgaaattcc attcgaatct gactatggtt tctggaacat gttagatggg 840

acgttatcat ttgagggtaa ccctgagcct ctactacctc aggcggatca gacctaccag 900

agctcaaact tggagctagt cgaaagtggg aactggctca gttacttgga gaaagaactt 960

ggccttgagg attcaacaaa gaccaacaac caagattttg tgatgaagga tgcaaccgaa 1020

caattagcgt cggagaagta ctgtgataag ttgccaaagc ctacagaaat ggaccacggc 1080

atggatgatt acttcggaat gtggccacct ttgccagaga actccgctaa ctga 1134

<210> 2

<211> 377

<212> PRT

<213> Fragaria × ananassa Duch.

<400> 2

Met Val Gly Arg Gly Arg Thr Pro Cys Cys Asp Lys Ser Gln Val Lys

1 5 10 15

Arg Gly Pro Trp Ser Pro Ser Glu Asp Leu Arg Leu Ile Ser Phe Ile

20 25 30

Gln Lys His Gly His Asp Asn Trp Arg Ala Leu Pro Lys Gln Ala Gly

35 40 45

Leu Leu Arg Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu

50 55 60

Arg Pro Asp Leu Lys Arg Gly Asn Phe Thr Lys Glu Glu Glu Glu Ser

65 70 75 80

Ile Ile Met Leu His Glu Ala Trp Gly Asn Lys Trp Ser Lys Ile Ala

85 90 95

Ser His Phe Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Val Trp Asn

100 105 110

Thr His Leu Arg Lys Lys Leu Ala Leu Lys Tyr Ser Cys Gly Asp Asp

115 120 125

Gln Ser Lys Glu Leu Ser Ser Ile Thr Ser Ser Ser Ser Ser Ser Ser

130 135 140

Ser Ser Ser Ala Ser Phe Gln Leu Ser Ser Gly Glu Pro Ser Ala Gly

145 150 155 160

Val Thr Ala Glu Leu Gln Asn Gln Pro Asn Gln Glu Ser Asn Thr Ser

165 170 175

Lys Thr Arg Asn Asp Cys Glu Leu Pro Asp Ser Leu Thr Ile Gln Glu

180 185 190

Lys Leu Glu Lys Lys Leu Pro Met Glu Val Thr Asp Gln Val Arg Val

195 200 205

Asp Asp Ala Val Gly Met Lys Met Leu Thr Thr Ser Ser Ser Phe Ser

210 215 220

Ser Tyr Ala Ser Ser Asn Gly Ser Ser Ser Ser Gln Gly Gly Gly Val

225 230 235 240

Ser Arg Pro Asp Asp Leu Val Phe Asp Leu Lys Gly Ala Tyr Glu Pro

245 250 255

Gln Ile Ala Asp Lys Ala Val Phe Glu Ile Pro Phe Glu Ser Asp Tyr

260 265 270

Gly Phe Trp Asn Met Leu Asp Gly Thr Leu Ser Phe Glu Gly Asn Pro

275 280 285

Glu Pro Leu Leu Pro Gln Ala Asp Gln Thr Tyr Gln Ser Ser Asn Leu

290 295 300

Glu Leu Val Glu Ser Gly Asn Trp Leu Ser Tyr Leu Glu Lys Glu Leu

305 310 315 320

Gly Leu Glu Asp Ser Thr Lys Thr Asn Asn Gln Asp Phe Val Met Lys

325 330 335

Asp Ala Thr Glu Gln Leu Ala Ser Glu Lys Tyr Cys Asp Lys Leu Pro

340 345 350

Lys Pro Thr Glu Met Asp His Gly Met Asp Asp Tyr Phe Gly Met Trp

355 360 365

Pro Pro Leu Pro Glu Asn Ser Ala Asn

370 375

Claims (9)

1. regulating and controlling the myb transcription factor FvMYB330 gene of eugenol accumulation in strawberry fruit, it is characterised in that: described FvMYB330 gene has the nucleotide sequence as shown in SEQ ID NO:1.

2. the myb transcription factor FvMYB330 gene of eugenol accumulation in regulation strawberry fruit according to claim 1, Be characterized in that: the amino acid sequence of the FvMYB330 gene coding is as shown in SEQ ID NO:2.

3. a kind of myb transcription factor FvMYB330 gene containing eugenol accumulation in regulation strawberry fruit described in claim 1 Expression vector.

4. the myb transcription factor FvMYB330 gene of eugenol accumulation in regulation strawberry fruit according to claim 3 Expression vector, it is characterised in that: the expression vector is pCXSN-FLAG-FvMYB330.

5. a kind of myb transcription factor FvMYB330 gene containing eugenol accumulation in regulation strawberry fruit described in claim 1 Host strain.

6. the application of FvMYB330 gene as described in claim 1 eugenol accumulation in regulation strawberry fruit.

7. application of the FvMYB330 gene as described in claim 1 in expression EGS1, EGS2, CAD gene.

8. a kind of method accumulated by eugenol in FvMYB330 gene regulation strawberry fruit, it is characterised in that: will be described FvMYB330 gene injection enters in strawberry.

9. the method according to claim 8 accumulated by eugenol in FvMYB330 gene regulation strawberry fruit, special Sign is: the following steps are included:

(1) pCXSN-FLAG-FvMYB330 expression vector is constructed；

(2) Agrobacterium is converted；

(3) identified correct single colonie in picking step (2), infects strawberry fruit using injection method.