CN109762790A - Hybridoma cell strain, preparation method, monoclonal antibody, application and kit - Google Patents
Hybridoma cell strain, preparation method, monoclonal antibody, application and kit Download PDFInfo
- Publication number
- CN109762790A CN109762790A CN201810383013.XA CN201810383013A CN109762790A CN 109762790 A CN109762790 A CN 109762790A CN 201810383013 A CN201810383013 A CN 201810383013A CN 109762790 A CN109762790 A CN 109762790A
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- cell strain
- hybridoma cell
- albumen
- cctcc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides a kind of hybridoma cell strain, preparation method, monoclonal antibody, application and kits, are related to animal gene engineering technology field.The hybridoma cell strain of the monoclonal antibody of the anti-Hp albumen of secretion provided by the invention is the combination of the hybridoma cell strain of CCTCC NO:C2017119 and the hybridoma cell strain of CCTCC NO:C201858.A kind of monoclonal antibody of anti-Hp albumen is also disclosed, which is selected from the monoclonal antibody of the monoclonal antibody of the hybridoma cell strain secretion of the CCTCC NO:C2017119 of pairing and the hybridoma cell strain secretion of CCTCC NO:C201858.Antibody secreted by two strain of hybridoma strains is used to prepare milk cow early pregnancy detection ELISA kit, and the ELISA kit sensibility is good, specific height, convenient for detection early pregnancy cows earlier.
Description
Technical field
The present invention relates to animal gene engineering technology fields, and in particular to a kind of hybridoma cell strain, preparation method, Dan Ke
Grand antibody, application and kit.
Background technique
Clinically there are examination per rectum and ultrasonic examination using wide diagnostic method at present.But examination per rectum is general
It is all carried out in cows' breeding 60d, some even time is longer just to make diagnosis, and the breeding for not only affecting cow in this way is all
Phase, moreover, also affecting the performance of cow production performance.And ultrasonic Detection Method is at high cost, and easy infection.Some cattle farms make
It 28d can be made more reliably after gestation with ox pregnancy-associated plasma protein (PAG) ELISA kit being still not yet widely popularized
Judgement.But these methods can only make after three weeks Accurate Diagnosis in milk cow artificial insemination.And studies have shown that if manually awarding
(three weeks) can check out nonpregnant ox in smart the latter feelings phase, quick Estrus synchronization can be carried out to it, in 21-23d
Compounded, reduce nonpregnant number of days, improve the reproductive efficiency of milk cow, thus to a certain extent for, can be artificial in milk cow
Milk cow gestation or nonpregnant is judged in insemination the latter feelings phase, is the key that shorten the milk cow calving interval and improve breeding potential.
Hoptoglobin (Haptoglobin；Hp it) is also known as haptoglobin, is that a kind of acute phase protein is widely present in the mankind
In the serum and other body fluid of many mammals, signal can be transmitted between parent and embryo in Early placental phase.In addition,
There is scholar further study show that there is Hp protein secretion in the endometrial tissue of the gestational period and non-pregnancy, but with decidua group
It is the abundantest to knit middle content, secretory phase inner membrance takes second place, and proliferation period inner membrance is minimum, thus speculates that Hp may be important pregnant phase
Close albumen.Haptoglobin is paid close attention to as a kind of new significant albumen by people, but the albumen is in milk cow early pregnancy
The mechanism of action and functional application on it is largely still unknown.
Therefore, a kind of relevant milk cow diagnosis of early gestation scheme of milk cow Hp albumen is needed, and is able to achieve artificial in milk cow
Accurate judgement milk cow gestation or nonpregnant in insemination the latter feelings phase.
Summary of the invention
In view of the deficiencies in the prior art, the purpose of the present invention is to provide a kind of hybridoma cell strains, preparation side
Method, monoclonal antibody, application and kit, realize within milk cow artificial insemination the latter feelings phase accurate judgement milk cow gestation or
It is nonpregnant.
To achieve the above objectives, the technical solution adopted by the present invention is that: a kind of monoclonal antibody that secreting anti-Hp albumen
Hybridoma cell strain: the hybridoma cell strain is the hybridoma cell strain and CCTCC NO of CCTCC NO:C2017119:
The combination of the hybridoma cell strain of C201858.
The invention also discloses a kind of a kind of hybridoma cell strains for the monoclonal antibody for secreting anti-Hp albumen as mentioned
Preparation method:
Using milk cow RNA as template amplification Hp genetic fragment；
The Hp gene expanded is inserted into the site NcoI and HindIII of Baculovirus transfer plasmids PFastBacHTB
It is configured to recombinant transfer plasmid PFastBacHTB-Hp；
Recombinant transfer plasmid PFastBacHTB-Hp is converted to the DH10Bac impression containing baculoviral skeleton plasmid
State cell, by homologous recombination by Hp gene integration into baculoviral skeleton plasmid Bacmid；
Screening, recombinant shuttle vector after purification are transfected into sf9 insect cell, collected after cytopathy to appear thin
Born of the same parents' supernatant obtains recombinant baculovirus rBacmid-Hp；
The Hp albumen for using recombinant baculovirus rBacmid-Hp to express is crossed after column purification and mouse is immunized as immunizing antigen, will
The splenocyte of immune mouse is merged with Sp2/0 myeloma, then the list of the energy anti-Hp albumen of stably excreting is screened through 3 subclones
The hybridoma cell strain of clonal antibody is respectively: 3B12、4F4、4F11、5D7、5G8、7E5、10C3、12F9；Filter out a pair of of pairing
Hybridoma cell strain: 4F11And 12F9；The hybridoma cell strain 4F filtered out11The as hybridization of CCTCC NO:C2017119
Tumor cell strain, the hybridoma cell strain 12F filtered out9The as hybridoma cell strain of CCTCC NO:C201858.
The invention also discloses a kind of monoclonal antibodies for secreting anti-Hp albumen: the monoclonal of the anti-Hp albumen of secretion
Antibody is selected from two kinds of monoclonal antibodies of pairing: a kind of Dan Ke that the hybridoma cell strain for CCTCC NO:C2017119 is secreted
Grand antibody, the monoclonal antibody that the hybridoma cell strain that another kind is CCTCC NO:C201858 is secreted.
The invention also discloses the preparation methods that one kind secretes the monoclonal antibody of anti-Hp albumen as mentioned: to mouse abdomen
Chamber injection is respectively selected from hybridoma cell strain 4F as mentioned11And 12F9Hybridoma, after a period of time acquire mouse abdomen
Water obtains the monoclonal antibody of the anti-Hp albumen of secretion after centrifugal purification.
The invention also discloses a kind of applications that the monoclonal antibody for secreting anti-Hp albumen is detected in milk cow early pregnancy: institute
It states and secretes the monoclonal antibody of anti-Hp albumen to be selected from the monoclonal that the hybridoma cell strain of CCTCC NO:C2017119 is secreted anti-
The monoclonal antibody of the hybridoma cell strain of body and CCTCC NO:C201858 secretion.
The invention also discloses a kind of double crush syndrome kits for the detection of milk cow early pregnancy: the reagent
Box includes: the ELISA Plate and horseradish for being coated with the monoclonal antibody of hybridoma cell strain secretion of CCTCC NO:C2017119
The monoclonal antibody of the hybridoma cell strain secretion of peroxidase labelling CCTCC NO:C201858.
Based on the above technical solution, the kit further include:
Substrate solution: the citric acid solution of 100mmol/L: the Na of 24.3ml, 200mmol/L2HPO4.12H2O:25.7ml is mixed
It is even, the tetramethyl benzidine of 50mg is added, the 30%H of 50 μ l is added before use2O2；
Terminate liquid: distilled water 177.8ml and concentrated sulfuric acid 22.2ml；
Cleaning solution: 0.5mlTween-20 is added in the PBS of 1000ml10mmol/LPH7.4；
Negative control and positive control.
Compared with the prior art, the advantages of the present invention are as follows:
The present invention provides a kind of hybridoma cell strain of monoclonal antibody for secreting anti-Hp albumen, the anti-Hp albumen of the secretion
The hybridoma cell strain of monoclonal antibody is the hybridoma cell strain and CCTCC NO:C201858 of CCTCC NO:C2017119
Hybridoma cell strain combination.
The present invention provides the preparation method for secreting the hybridoma cell strain of monoclonal antibody of anti-Hp albumen, is expanded by PCR
Increase milk cow Hp gene, the Hp gene expanded is inserted into the NcoI and HindIII of Baculovirus transfer plasmids PFastBacHTB
Site is configured to recombinant transfer plasmid PFastBacHTB-Hp, then converts the recombinant transfer plasmid to containing baculoviral bone
The DH10Bac competent cell of frame plasmid, by homologous recombination by Hp gene integration into baculoviral skeleton plasmid Bacmid,
Screening, recombinant shuttle vector after purification are transfected into sf9 insect cell, cell conditioned medium is collected after cytopathy to appear is
It can get recombinant baculovirus rBacmid-Hp.After crossing column purification with the Hp albumen of above-mentioned recombinant baculovirus expression, as exempting from
Epidemic disease mice immunized with antigen obtains the hybridoma cell strain of the monoclonal antibody of the energy anti-Hp albumen of stably excreting.Prior art expression
Hp protein expression is all prokaryotic expression mode, and this case can make Hp by baculovirus expression Hp albumen using eukaryotic expression mode
Protein structure and function are close to native protein, expression quantity with higher and bioactivity.It is detected applied to milk cow early pregnancy
Milk cow gestation or nonpregnant can be judged earlier, and testing result is accurate.
The invention also discloses a kind of monoclonal antibody of anti-Hp albumen, which is selected from the CCTCC of pairing
The monoclonal antibody of the hybridoma cell strain secretion of NO:C2017119 and the hybridoma cell strain secretion of CCTCC NO:C201858
Monoclonal antibody.The invention also discloses a kind of preparation methods of monoclonal antibody for secreting anti-Hp albumen, to mouse peritoneal
Injection is respectively selected from hybridoma cell strain 4F11And 12F9Hybridoma, mouse ascites, centrifugal purification are acquired after a period of time
The monoclonal antibody of the anti-Hp albumen of secretion is obtained afterwards.
The present invention, which is provided, detects the monoclonal antibody for secreting anti-Hp albumen applied to milk cow early pregnancy, can be realized
Accurate judgement milk cow gestation or nonpregnant, compared with conventional diagnostic techniques, can be shortened 20 days in milk cow artificial insemination the latter feelings phase
The nonpregnant phase of left and right, saving milk cattle cultivating cost, remarkable in economical benefits, application prospect are extensive.
The present invention also provides a kind of double crush syndrome kits for the detection of milk cow early pregnancy, which can
Detect that pregnant dairy cows, testing result are accurate in 21d or so.
Detailed description of the invention
Fig. 1 is recombinant plasmid pFastBacHTB-Hp digestion qualification figure in the embodiment of the present invention 1；
Fig. 2 is that the PCR of recombinant baculovirus plasmid in the embodiment of the present invention 1 identifies schematic diagram；
Fig. 3 is the cytopathy schematic diagram that recombinant baculovirus transfects after sf9 cell in the embodiment of the present invention 1；
Fig. 4 is the western-blot testing result schematic diagram that albumen is expressed in the embodiment of the present invention 1；
Fig. 5 is monoclonal antibody western-blot testing result schematic diagram in the embodiment of the present invention 2；
Fig. 6 is antibody purity schematic diagram in the embodiment of the present invention 9.
Specific embodiment
Invention is further described in detail with reference to the accompanying drawings and embodiments.
Embodiment 1: recombinant baculovirus rBV-hp infects sf9 cell and expresses Hp
1, the design of primer
According to the special of Hp gene order (NM_001040470) the design pair for amplification Hp gene announced on GeneBank
Property primers F 1/F2, and be inserted into NcoI restriction enzyme site in upstream primer, HindIII restriction enzyme site be inserted into downstream primer.Primer
By Dalian, treasured bioengineering Co., Ltd is synthesized.Primer is as follows:
F1:AAACCATGGCGATGAGCGCCCTGCAA NCOI
F2:TTTAAGCTTTTAGTTGTTAGCGATGG HindIII
2, PCR amplification
The pregnant dairy cows ox blood RNA being separated to using this laboratory is template amplification HP genetic fragment, amplification condition are as follows: 1. 94
DEG C 3 minutes, 2. (94 DEG C 30 seconds → 55 DEG C 30 seconds → 72 DEG C 1 point 30 seconds) totally 35 circulations；3. 72 DEG C 10 minutes.Reaction terminates
It is detected afterwards with 0.8% agarose gel electrophoresis.
3, the building of recombinant transfer plasmid pFastBacHTB-Hp
Recycling PCR positive products are arrived the Hp gene cloning expanded by NcoI and HindIII restriction enzyme site
It confirms that building in kind is correct through digestion and sequencing identification in pFastBacHTB carrier, obtains positive recombinant plasmid
pFastBacHTB-Hp.Recombinant plasmid digestion qualification result as shown in Figure 1, in figure 1,2 be recombinant plasmid pFastBacHTB-Hp
NCOI and HindIII digestion products, 3 be DNAMark (DL2000).
4, the pFastBacHTb-Hp carrier built is transferred to the competent cell of the Bacmid containing shuttle vector
In DH10Bac, blue hickie filters out white positive colony, extracts recombination Bacmid plasmid, is identified with M13 universal primer PCR.
PCR qualification result is as shown in Fig. 2, and 1 is DNAMark (DL2000) in figure；2, it 3 is identified for pFastBacHTb-Hp PCR；4
It is identified for the PCR of wild type Bacmid.
5, using liposome-mediated infection protocol, screening, recombinant shuttle vector after purification are transfected into sf9 insect cell
In, cell conditioned medium is collected after cytopathy to appear can be obtained recombinant baculovirus.
1) it prepares Bacmid DNA plasmid and measures its concentration, form is good, eugonic sf9 cell accesses 6 holes
Tissue culture plate is cultivated in 27 DEG C of incubators, long to the preparation transfection of 70-80% single layer to cell.
2) it prepares cell transfecting liquid: taking two 1.5ml sterile centrifugation tubes, 5-8 μ l liposome and 100 μ l is added without blood in A pipe
Clear Grace ' s culture solution, mixing are stored at room temperature 5min and 100 μ l serum-free Grace ' s culture solutions and 3-5 μ g are added in B pipe therebetween
BacmidDNA to be transfected, mixing are stored at room temperature 5min.
3) mixed liquor in A pipe is added dropwise in pipe B, in being stored at room temperature 20min after mixing, inhales abandon cell to be transfected therebetween
The culture medium in hole is washed 3 times with serum-free Grace ' s culture solution.
4) serum-free Grace ' the s culture solution for abandoning cell hole to be transfected is inhaled, 200 μ l mixed liquors in B pipe are added drop-wise to carefully
On born of the same parents' single layer, adds 800 μ l serum-free Grace ' s culture solutions and gently shake up, then cell plates are placed in 27 DEG C of incubators and are trained
It supports.
5) suction abandoning transfection cocktail adds 3ml Grace ' s growth-promoting media to continue to cultivate 72h after cultivating 5h.
It is cultivated in 27 DEG C, cells and supernatant is collected after cytopathy to appear can be obtained recombinant baculovirus, and will
The recombinant baculovirus of the first generation continues to be inoculated with the passage of sf9 cell, and the recombinant baculovirus of high titre can be obtained, will recombinate bar
Shape virus continues to be inoculated with insect cell expansion collection viral supernatants, and 500x is centrifuged 5min, shifts supernatant to sterile tube in -80 DEG C.
Cytopathy shown in Figure 3, after normal sf9 cell and rBacmid-Hp transfection are shown in figure.
6, the expression of SDS-PAGE and western-blot testing goal albumen
After recombinant baculovirus is inoculated with sf9 cell 72 hours, cell sample is collected.It is added on equivalent 2xSDS-PAGE
Sample buffer is resuspended, and mixes, then 95 DEG C of water-bath 5min set and wait loading on ice, carries out SDS-PAGE and Westernblot points
Analysis.The primary antibody that western blot is used in the present invention is the monoclonal antibody (three hawks) of anti-His label, the use of secondary antibody is that HRP is marked
Sheep anti-mouse igg, shown in result figure 4.
Embodiment 2: the preparation of monoclonal antibody
1) preparation of monoclonal antibody
After crossing column purification with the Hp albumen of above-mentioned recombinant baculovirus expression, protein concentration is calculated according to formula.With this
Hp albumen is as antigen immune balb/c mice.
Hp albumen after purification is immunized 6 week old female BABLB/C mouse totally 5 times as immunizing antigen, every minor tick 2-3
Week.The immune Freund's complete adjuvant for adding equivalent with Hp albumen for the first time, 100 μ of immunizing dose g/, immunization route the nape of the neck multiple spot
Subcutaneous injection, uses incomplete Freund's adjuvant later.Four exempt from rear 12-15 days tail portions takes a blood sample in a small amount, and indirect ELISA measures serum effect
Valence, if serum titer is qualified, first three days do booster immunization after fusion.It is injected intraperitoneally with Hp albumen, dosage is 100 μ g/.Finally
Primary immunization latter week merges the splenocyte of immune mouse with Sp2/0 myeloma, then screens to stablize through 3 subclones and divide
The hybridoma for secreting the monoclonal antibody of anti-Hp albumen is respectively: 3B12、4F4、4F11、5D7、5G8、 7E5、10C3、12F9.
Supernatant is collected by extracorporeal culture-ing, cell fragment, -20 DEG C of cell conditioned medium preservations are removed after being centrifuged.Conventionally make
The ascites of standby monoclonal antibody, selects female mice, every intraperitoneal injection sterile paraffin oil 0.5ml divides multi-point injection, 10-14
After it, hybridoma in good condition is gently blown down out of Tissue Culture Flask, 1000r/min is centrifuged 10min, supernatant is abandoned,
It is suspended, is counted spare with sterile PBS；Every mouse peritoneal injects hybridoma 5x105-1x106It is a, soft mouse after injection
Abdomen is dispersed in cell in the abdominal cavity of mouse；After 7-10 days, it is seen that mouse peritoneal significantly increases, and acquires ascites for abdomen
Water 3000r/min is centrifuged 10min, collects -20 DEG C of supernatant preservations.
2) analysis of monoclonal antibody identification epitope
Using the antigen recognizing epitope of Additive Index measurement monoclonal antibody, i.e., with Hp albumen with 3-4 μ g/ml concentration
100 μ l coated elisa plates, closing, be separately added into after washing saturation dilution monoclonal antibody, 37 DEG C of effect 60min, equally
After washing, every hole distinguishes combination of two and another plant of monoclonal antibody, 37 DEG C of effect 60min is added, then that work is added after washing is dense
The HRP of degree marks goat anti-mouse secondary antibody (sigma Products), and 37 DEG C of effect 60min are finally washed again, and substrate colour developing is surveyed
Determine OD450 value.The superimposed AI value of two kinds of monoclonal antibodies is calculated as follows:
AI=(A1+2- A1)/A2*100% (A1+2) the expression superimposed OD value of 2 plants of monoclonal antibodies；A1 indicates first
The OD value of strain monoclonal antibody itself superposition；A2 indicates the OD value of the 2nd plant of monoclonal antibody itself superposition) when antibody two-by-two is folded
In addition the AI value after is greater than 30%, is judged to two plants of monoclonal antibody identification different locis.
It is calculated through additivity index, and identifies 2 different epitopes as a result, determining in conjunction with monoclonal antibody titer of ascites
Monoclonal antibody representative strains are respectively 4F11And 12F9。
3) measurement of hybridoma Monoclonal Antibodies in Mice Ascites potency
The titration of ascites McAb: indirect elisa method is used.Coating expression albumen, is surveyed using sheep anti-mouse igg as secondary antibody
Titer of ascites.Cell conditioned medium makees doubling dilution since 1:100, and ascites makees doubling dilution since 1/500, according to indirect
ELISA method measures its potency.The titration result of cells and supernatant and purifying ascites is shown in Table respectively.
1 two plants of monoclonal hybridoma culture supernatant antibody ELISA potency of table
The potency of 2 two plants of monoclonal antibody ascites of table
4) immunoblotting (western-blot) is tested
SDS-PAGE and western-blot test is carried out according to a conventional method, and monoclonal antibody 4F11 and 12F9 make respectively
For primary antibody, the diluted sheep anti-mouse igg of 1:10000 (sigma company) is used as secondary antibody, develops the color the results show that 2 plants of monoclonal antibodies are equal
Energy specific recognition Hp albumen, shown in Figure 5,1 is 12F9 antibody in figure, and 2 be 4F11 antibody.
5) subgroup identification of monoclonal antibody
It is carried out according to Bai Aotong mouse monoclonal Ig class/subgroup identification kit operational manual.Subgroup identification as a result,
Above-mentioned 8 plants of monoclonal antibodies remove 3B12、4F11、10C3For IgG2aOutside, remaining monoclonal antibody belongs to IgG1
6) Detection of Stability of hybridoma cell line secrete monoclonal antibody
After Cryopreservation of Hybridoma Cells 6 months, it is removed from liquid nitrogen the hybridoma cell strain recovery frozen, mouse ascites
Potency, which has no, to be substantially reduced.
Embodiment 3: the hybridoma cell strain of the monoclonal antibody of anti-Hp albumen is secreted
The embodiment of the invention discloses a kind of hybridoma cell strains of monoclonal antibody for secreting anti-Hp albumen: hybridoma is thin
Hybridoma cell strain (the i.e. hybridoma cell strain 4F that born of the same parents' strain is CCTCC NO:C201711911) and CCTCC NO:C201858
Combination (the i.e. hybridoma cell strain 12F of hybridoma cell strain9)。
Embodiment 4: the preparation method of the hybridoma cell strain of the monoclonal antibody of anti-Hp albumen, including following step are secreted
It is rapid:
S1, using milk cow RNA as template amplification Hp genetic fragment；
S2, by amplification to Hp gene be inserted into the NcoI of Baculovirus transfer plasmids PFastBacTMHTB with
The site HindIII is configured to recombinant transfer plasmid PFastBacHTB-Hp；
S3 converts recombinant transfer plasmid PFastBacHTB-Hp to the DH10Bac containing baculoviral skeleton plasmid
Competent cell, by homologous recombination by Hp gene integration into baculoviral skeleton plasmid Bacmid；
Screening, recombinant shuttle vector after purification are transfected into sf9 insect cell, receive after cytopathy to appear by S4
Collection cell conditioned medium can be obtained recombinant baculovirus rBacmid-Hp；
S5 expresses Hp albumen after recombinant baculovirus rBacmid-Hp is infected sf9 cell；
Mouse is immunized using Hp albumen after purification as immunizing antigen, by the splenocyte of immune mouse and Sp2/0 marrow in S6
Tumor fusion, then the hybridoma cell strain for screening the monoclonal antibody of the energy anti-Hp albumen of stably excreting is subcloned through 3 times, respectively
It is: 3B12、4F4、4F11、 5D7、5G8、7E5、10C3、12F9；Filter out the hybridoma cell strain 4F of a pair of of pairing11And 12F9；Sieve
The hybridoma cell strain 4F selected11The as hybridoma cell strain of CCTCC NO:C2017119, the hybridoma cell strain filtered out
12F9The as hybridoma cell strain of CCTCC NO:C201858.
Prior art expression Hp protein expression is all prokaryotic expression mode, and this case uses eukaryotic expression mode, by rod-shaped
Expressing viral Hp albumen can make Hp protein structure and function close to native protein, expression quantity with higher and bioactivity.It answers
It can judge that milk cow is pregnant or nonpregnant earlier for the detection of milk cow early pregnancy, testing result is accurate.
A kind of embodiment 5: monoclonal antibody for secreting anti-Hp albumen
The embodiment of the invention discloses a kind of monoclonal antibodies of anti-Hp albumen: secreting the monoclonal antibody of anti-Hp albumen
Two kinds of monoclonal antibodies selected from pairing: a kind of monoclonal that the hybridoma cell strain for CCTCC NO:C2017119 is secreted is anti-
Body, the monoclonal antibody that the hybridoma cell strain that another kind is CCTCC NO:C201858 is secreted.
A kind of embodiment 6: preparation method of monoclonal antibody that secreting anti-Hp albumen
The hybridoma cell strain 4F of embodiment 4 is respectively selected to mouse peritoneal injection11And 12F9Hybridoma, one section
Mouse ascites are acquired after time, and the monoclonal antibody of the anti-Hp albumen of secretion is obtained after centrifugal purification.
A kind of embodiment 7: application that monoclonal antibody that secreting anti-Hp albumen is detected in milk cow early pregnancy
The embodiment of the invention discloses a kind of monoclonal antibodies for secreting anti-Hp albumen to answer what milk cow early pregnancy detected
With.The monoclonal for the hybridoma cell strain secretion that the monoclonal antibody for secreting anti-Hp albumen is selected from CCTCC NO:C2017119 is anti-
The monoclonal antibody of the hybridoma cell strain of body and CCTCC NO:C201858 secretion.
A kind of embodiment 8: double crush syndrome kit for the detection of milk cow early pregnancy
The embodiment of the invention discloses the double crush syndrome kits detected for milk cow early pregnancy, comprising: packet
The ELISA Plate and horseradish peroxidase of the monoclonal antibody for the hybridoma cell strain secretion for being had CCTCC NO:C2017119
Enzyme marks the monoclonal antibody of the hybridoma cell strain secretion of CCTCC NO:C201858.
Kit further include:
Substrate solution: the citric acid solution 24.3ml, 200mmol/LNa of 100mmol/L2HPO4.12H2O25.7ml is mixed,
The tetramethyl benzidine of 50mg is added, the 30%H of 50 μ l is added before use2O2；
Terminate liquid: distilled water 177.8ml and concentrated sulfuric acid 22.2ml；
Cleaning solution: 0.5mlTween-20 is added in the PBS of 1000ml10mmol/LPH7.4.
Negative control and positive control, wherein negative control is nonpregnant cow serum, and positive control is pregnant dairy cows blood
Clearly.
Embodiment 9: the foundation of double crush syndrome antigen detection method
1) monoclonal antibody of Hp albumen is detected
The monoclonal antibody for being coated on the anti-Hp albumen of ELISA Plate is hybridoma cell strain 4F11(CCTCC NO:
C2017119) secretion obtains, and it is hybridoma cell strain 12F that enzyme, which marks Hp protein monoclonal antibody,9(CCTCC NO:C201858)
Secretion obtains.
2) preparation and purification of monoclonal antibody ascites
4F is prepared according to the above method11And 12F9Monoclonal antibody ascites.Using GE company ProteinG prepacked column into
Row monoclonal antibody IgG purifying.It is identified after purification using SDS-PAGE, as a result obtains the good monoclonal antibody of purity, joined
As shown in Figure 6, in figure 1 be 12F9 antibody, 2 be 4F11 antibody.
3) preparation of monoclonal antibody linked with peroxidase
Using reinforced active oxidation object enzyme and labelling kit to monoclonal antibody 4F11And 12F9Carry out HRP enzyme mark
Note, is denoted as 4F11- HRP and 12F9-HRP.Its activity is identified using the method for indirect ELISA.As a result, potency reaches 1:104With
1:2x104。
4) selection of sandwich pairing antibody
By 4F11And 12F9The IgG of Puri fication McAb is as capture antibody, 4F11- HRP and 12F9- HRP is as detection
Antibody carries out sandwich pairing property and tests, and is paired into optimal antibody combination so that OD450nm value is highest, comparison result such as table 3,
As a result, it has been found that 4F11As capture antibody, 12F9- HRP is best as detection antibody effects.
The selection of the sandwich pairing antibody of table 3
5) monoclonal antibody peridium concentration and monoclonal antibody linked with peroxidase (12F9- HRP) working concentration determination use square matrix titration
To measure: selected P/N maximum and positive OD450The hole of nm value 1.5 or so, corresponding to capture antibody peridium concentration and enzyme mark
The concentration for detecting antibody is optimum condition, and final to determine that monoclonal antibody peridium concentration is 3 μ g/ml, the effect of enzyme labelled antibody is dense
Degree is 0.8 μ g/ml.
6) determination of antigenic action time
It uses confining liquid to compare as diluted yin and yang attribute, carries out ELISA detection by determining program, antigen is 37
30min, 45min, 60min, 90min, 120min are reacted DEG C respectively, are carried out under other conditions and the identical situation of response procedures
ELISA detection determines P/N minimum, and positive value finally determines that the antigenic action time is 60min at 0.2.
7) monoclonal antibody linked with peroxidase 12F9The determination of action time
By the reaction condition having had determined that, ELISA antigen detection is carried out with the control of known yin and yang attribute, enzyme mark monoclonal is anti-
The reaction time of body is respectively 30min, 45min, 60min, 90min.When determining P/N minimum, as a result determine that enzyme mark monoclonal is anti-
The best effort time of body is 60min.
8) determination of substrate-function time
By yin and yang attribute compare according to the conditioned response having had determined that, the reaction time of substrate be respectively 5min, 10min,
15min, 20min, double wave measure each hole, the substrate-function time are determined by comparing P/N value.It is final to determine the substrate-function time
For 15min or so.
9) determination of yin and yang attribute critical value
The nonpregnant cow's serum of 160 parts of selection (18-28d) health carries out ELISA inspection according to fixed optimum reaction condition
It surveys, double wave measures each hole, and according to formula: yin and yang attribute critical value=negative sample average value+3x standard deviation (SD) is as a result, OD450
Average value be 0.354854, variance 0.073131 is judged as negative as OD450 >=0.57, and OD450≤0.57 is judged as
It is positive.
10) sensitization test
Milk cow 7d, 14d, 18d, 21d, 28d blood sample after acquisition artificial insemination, separates serum.It is tried respectively with ELISA of the present invention
Agent box and the detection of import ELISA kit, the results showed that the kit can detect pregnant dairy cows in 21d or so.
Table 4 is compared with import reagent box
Embodiment 10: double crush syndrome antigen detection kit clinical sample testing result
With double crush syndrome antigen detection kit of the invention, to Huang gang, Jiangxia, the inspection of the cattle farm Huang Po 814
Part clinical sample is detected, while being compared with import ELISA antigen detection kit, the results showed that, this double antibodies sandwich
ELISA antigenic reagent box can detecte out pregnant dairy cows at 21 days and import reagent box needs 28 days.And negative match-rate reaches
100%, 95% or more positive coincidence rate.
Coated elisa plate: being diluted to 3.2 μ g/ml with coating buffer for the IgG of 4F11 monoclonal antibody, 100 holes μ g/, and 37 DEG C
60min, 4 DEG C overnight.
Washing: adding 230 hole μ l/ of cleaning solution, and each 2min is washed 3 times, patted dry.
Closing: coated elisa plate is taken out, is washed 4 times, 3min/ times with PBST；It is closed with 5% skimmed milk, 300 holes μ g/, 37
DEG C place 2h, washed after closing.
Sample-adding: being added the good ELISA Plate of above-mentioned closing after serum to be checked is diluted in equal volume with serum dilution (PBST),
100 holes μ l/: yin and yang attribute control does not dilute, and 37 DEG C of reaction 90min, washing is same as above.
Enzyme mark monoclonal antibody: by 12F9- HRP is diluted to 0.8 μ g/ml, 100 holes μ l/, 37 DEG C of reaction 60min, and washing is same as above
Colour developing: 100 μ l of tmb substrate liquid is added and reacts 10min
It terminates: 50 μ l 2mol/ml H is added2SO4Terminate reaction
Read plate: measuring each hole OD450nm in microplate reader, carries out result judgement.
The composition of kit:
ELISA Plate: the monoclonal antibody that coating 4F11 cell strain secretion generates.
Enzyme labelled antibody: horseradish peroxidase-labeled 12F9The monoclonal antibody 12F that cell strain secretion generates9-HRP
Substrate solution is prepared: the citric acid solution (21g citric acid (C of 100mmol/L6H8O7.H2O it) is dissolved in deionized water, it is fixed
Hold to 1L) 24.3ml, 200mmol/LNa2HPO4.12H2O(71.6g Na2HPO4.12H2O is dissolved in deionized water, is settled to 1L)
25.7ml is mixed, and the tetramethyl benzidine (TMB) of 50mg is added, the 30%H of 50 μ l is added before use2O2；
Terminate liquid: (2mol/LH2SO4): distilled water 177.8ml and concentrated sulfuric acid 22.2ml is taken to mix respectively.
Cleaning solution: 0.5mlTween-20 is added in the PBS of 1000ml10mmol/LPH7.4；
Negative control and positive control.
The present invention is not limited to the above-described embodiments, for those skilled in the art, is not departing from
Under the premise of the principle of the invention, several improvements and modifications can also be made, these improvements and modifications are also considered as protection of the invention
Within the scope of.The content being not described in detail in this specification belongs to the prior art well known to professional and technical personnel in the field.
Claims (7)
1. a kind of hybridoma cell strain for the monoclonal antibody for secreting anti-Hp albumen, it is characterised in that: the hybridoma cell strain
For the combination of the hybridoma cell strain of the hybridoma cell strain and CCTCC NO:C201858 of CCTCC NO:C2017119.
2. a kind of a kind of preparation side of the hybridoma cell strain for the monoclonal antibody for secreting anti-Hp albumen as described in claim 1
Method, it is characterised in that:
Using milk cow RNA as template amplification Hp genetic fragment；
The Hp gene expanded is inserted into the site the NcoI and HindIII building of Baculovirus transfer plasmids PFastBacHTB
For recombinant transfer plasmid PFastBacHTB-Hp；
Recombinant transfer plasmid PFastBacHTB-Hp is converted thin to the DH10Bac competence containing baculoviral skeleton plasmid
Born of the same parents, by homologous recombination by Hp gene integration into baculoviral skeleton plasmid Bacmid；
Screening, recombinant shuttle vector after purification are transfected into sf9 insect cell, collected on cell after cytopathy to appear
It is clear to obtain recombinant baculovirus rBacmid-Hp；
The Hp albumen for using recombinant baculovirus rBacmid-Hp to express is crossed after column purification and mouse is immunized as immunizing antigen, will be immunized
The splenocyte of mouse is merged with Sp2/0 myeloma, then the monoclonal for screening the energy anti-Hp albumen of stably excreting through 3 subclones is anti-
The hybridoma cell strain of body is respectively: 3B12、4F4、4F11、5D7、5G8、7E5、10C3、12F9；Filter out the hybridization of a pair of of pairing
Tumor cell strain: 4F11And 12F9；The hybridoma cell strain 4F filtered out11The as hybridoma of CCTCC NO:C2017119
Strain, the hybridoma cell strain 12F filtered out9The as hybridoma cell strain of CCTCC NO:C201858.
3. a kind of monoclonal antibody for secreting anti-Hp albumen, it is characterised in that: the monoclonal antibody choosing of the anti-Hp albumen of secretion
From two kinds of monoclonal antibodies of pairing: a kind of monoclonal antibody that the hybridoma cell strain for CCTCC NO:C2017119 is secreted,
The monoclonal antibody that the hybridoma cell strain that another kind is CCTCC NO:C201858 is secreted.
4. the preparation method that one kind secretes the monoclonal antibody of anti-Hp albumen as claimed in claim 3, it is characterised in that: to small
Mouse intraperitoneal injection is respectively selected from hybridoma cell strain 4F as claimed in claim 211And 12F9Hybridoma, a period of time
After acquire mouse ascites, the monoclonal antibody of the anti-Hp albumen of the secretion is obtained after centrifugal purification.
5. a kind of application that the monoclonal antibody for secreting anti-Hp albumen is detected in milk cow early pregnancy, it is characterised in that: described point
Secrete anti-Hp albumen monoclonal antibody be selected from CCTCC NO:C2017119 hybridoma cell strain secrete monoclonal antibody and
The monoclonal antibody of the hybridoma cell strain secretion of CCTCC NO:C201858.
6. a kind of double crush syndrome kit for the detection of milk cow early pregnancy, it is characterised in that: the kit packet
It includes: being coated with the ELISA Plate and horseradish peroxide of the monoclonal antibody of the hybridoma cell strain secretion of CCTCC NO:C2017119
Compound enzyme marks the monoclonal antibody of the hybridoma cell strain secretion of CCTCC NO:C201858.
7. a kind of double crush syndrome kit for the detection of milk cow early pregnancy as claimed in claim 6, feature exist
In: the kit further include:
Substrate solution: the citric acid solution of 100mmol/L: the Na of 24.3ml, 200mmol/L2HPO4.12H2O:25.7ml is mixed, and is added
Enter the tetramethyl benzidine of 50mg, the 30%H of 50 μ l is added before use2O2；
Terminate liquid: distilled water 177.8ml and concentrated sulfuric acid 22.2ml；
Cleaning solution: 0.5mlTween-20 is added in the PBS of 1000ml10mmol/LPH7.4；
Negative control and positive control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810383013.XA CN109762790B (en) | 2018-04-26 | 2018-04-26 | Application of monoclonal antibody in early pregnancy detection of dairy cow and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810383013.XA CN109762790B (en) | 2018-04-26 | 2018-04-26 | Application of monoclonal antibody in early pregnancy detection of dairy cow and kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109762790A true CN109762790A (en) | 2019-05-17 |
| CN109762790B CN109762790B (en) | 2021-01-26 |
Family
ID=66449840
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810383013.XA Active CN109762790B (en) | 2018-04-26 | 2018-04-26 | Application of monoclonal antibody in early pregnancy detection of dairy cow and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109762790B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111650369A (en) * | 2020-05-19 | 2020-09-11 | 迪瑞医疗科技股份有限公司 | Helicobacter pylori magnetic particle chemiluminescence detection kit and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104987379A (en) * | 2015-07-08 | 2015-10-21 | 武汉市畜牧兽医科学研究所 | Differential protein in serum at early pregnancy stage of cow and application of differential protein |
| CN106841636A (en) * | 2017-01-24 | 2017-06-13 | 北京美正生物科技有限公司 | A kind of enzyme-linked immunosorbent assay kit for detecting cow subclinical mastitis and its production and use |
| CN107219368A (en) * | 2017-06-06 | 2017-09-29 | 山西农业大学 | Milk cow PAG1 test strips and preparation method thereof |
-
2018
- 2018-04-26 CN CN201810383013.XA patent/CN109762790B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104987379A (en) * | 2015-07-08 | 2015-10-21 | 武汉市畜牧兽医科学研究所 | Differential protein in serum at early pregnancy stage of cow and application of differential protein |
| CN106841636A (en) * | 2017-01-24 | 2017-06-13 | 北京美正生物科技有限公司 | A kind of enzyme-linked immunosorbent assay kit for detecting cow subclinical mastitis and its production and use |
| CN107219368A (en) * | 2017-06-06 | 2017-09-29 | 山西农业大学 | Milk cow PAG1 test strips and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| CAMILA I. VANNUCCHI等: "Acute-phase protein profile during gestation and diestrous: proposal for an early pregnancy test in bitches", 《ANIMAL REPRODUCTION SCIENCE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111650369A (en) * | 2020-05-19 | 2020-09-11 | 迪瑞医疗科技股份有限公司 | Helicobacter pylori magnetic particle chemiluminescence detection kit and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109762790B (en) | 2021-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Development of a convenient immunochromatographic strip for the diagnosis of infection with Japanese encephalitis virus in swine | |
| CN104459144B (en) | A kind of PRV velogen strain and vaccine strain differentiate Test paper | |
| CN107541500A (en) | A kind of A types foot and mouth disease virus monoclonal antibody and application | |
| CN103344761A (en) | Double sandwich immunoassay test kit labeled by HE4 quantum dots and application thereof | |
| CN109900902A (en) | A kind of porcine pseudorabies virus gB blocks ELISA antibody assay kit and its application | |
| CN107459574A (en) | A kind of PRV gB monoclonal antibodies and its application | |
| CN102464716B (en) | ELISA (Enzyme-Linked Immuno Sorbent Assay) kit for detecting Japanese encephalitis virus antigens in swine, human and mosquitoes and application | |
| CN102747044B (en) | Hybridoma cell line of a kind of resisting pstudorabies virus and preparation method thereof and a kind of monoclonal antibody and application thereof | |
| CN111999496A (en) | SARS-CoV-2 antigen-antibody combined detection kit and its preparation method | |
| CN107937352A (en) | For detecting the colloidal gold immuno-chromatography test paper strip of PPR virus H protein antibodies | |
| CN109265542A (en) | Specifically bind norovirus GII.4 genotype VP1 albumen and/or the antibody of VLP and its preparation method and application | |
| CN103509760B (en) | Hybridoma cell capable of secreting anti-beta2-microglobulin monoclonal antibody, and application thereof | |
| CN105348372A (en) | Method for detecting porcine pseudorabies virus | |
| CN102277332A (en) | Monoclonal antibody for anti-foot and mouth disease virus and application thereof | |
| CN109206509A (en) | With the protein bound monoclonal antibody of pseudorabies virus gD and its application | |
| CN109212239A (en) | A kind of giant panda luteotropin colloidal gold immuno-chromatography test paper strip, preparation method and application | |
| CN109762790A (en) | Hybridoma cell strain, preparation method, monoclonal antibody, application and kit | |
| CN109321532A (en) | It is a kind of for detecting the double-antibody sandwich elisa detection kit and its application of goat haemadsorption virus 1 | |
| Renukaradhya et al. | Mapping of B-cell epitopic sites and delineation of functional domains on the hemagglutinin–neuraminidase protein of peste des petits ruminants virus | |
| CN115947835B (en) | Antibody targeting influenza B virus nucleoprotein and application thereof | |
| CN109666071A (en) | A kind of polyclonal antibody of Pasteurella albumen and the preparation of monoclonal antibody | |
| JP2006071631A (en) | Detection method for virus in pestivirus of fravivirus, and use thereof in immuno-chromatography | |
| CN110018304A (en) | A kind of newcastle epidemic disease antibody blocking Test paper | |
| CN109851671A (en) | Detect the monoclonal antibody and its application of the O-shaped Guangxi Strain antigen of aftosa | |
| CN109900903A (en) | A kind of porcine pseudorabies virus gE blocks ELISA antibody assay kit and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |