CN109750100A - A kind of kit based on rs59412811 detection juvenile form osteoporosis - Google Patents
A kind of kit based on rs59412811 detection juvenile form osteoporosis Download PDFInfo
- Publication number
- CN109750100A CN109750100A CN201910106560.8A CN201910106560A CN109750100A CN 109750100 A CN109750100 A CN 109750100A CN 201910106560 A CN201910106560 A CN 201910106560A CN 109750100 A CN109750100 A CN 109750100A
- Authority
- CN
- China
- Prior art keywords
- osteoporosis
- detection
- kit
- snp
- juvenile form
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of by detection rs59412811 come the kit of specific detection juvenile form osteoporosis.The kit include detect rs59412811 SNP site specific primer pair and specificity fluorescent probe to, for general components of fluorescence quantitative PCR detection etc..Kit of the invention assesses individual osteoporosis genetic predisposition with the mononucleotide polymorphism site genotype on the closely related rs59412811 of juvenile form osteoporosis genetic predisposition by detection simultaneously.
Description
Technical field
The invention belongs to gene diagnosis fields, are related to a kind of kit for the detection of juvenile form osteoporosis.
Background technique
Osteoporosis is a kind of systemic bone characterized by bone mineral content is reduced with bone tissue microstructure degeneration
Bone disease.Its most important harm is induced osteoporosis fracture, and the latter significantly reduces the quality of life and survival rate of patient.
It has been reported that only case fatality rate is just up to 20% in the osteoporotic fracture of hip joint its 1 year, person about 25% loses within existence 1 year or more
Mobility has serious harm.
Osteoporosis and fracture occur mainly in the middle-aged and the old especially postmenopausal women.It is old with China human mortality
Age, osteoporosis incidence have leapt to the third position of common chronic disease.The current patients with osteoporosis in China is high
Up to 90,000,000, and the incidence of fracture resulted from is more than 9%, and is in increase trend year by year.The year two thousand twenty is expected, only hip
The fracture number at one position is just up to 1,600,000, cause 90,000,000,000 yuan direct medical expense and higher postoperative care expense
With bringing heavy burden to family and society.
The detection of osteoporosis includes the detection and auxiliary detection of laboratory checking index.
Laboratory checking index:
Patients with osteoporosis part serum studentization index can convert (including bon e formation and bone resorption) state with reactive bone,
Under the high transition status (such as I type osteoporosis) of bone, these indexs can be increased, it can also be used to which the early stage for monitoring treatment is anti-
It answers.But its clinical meaning in osteoporosis is still up for further studying.These Biochemistry measurement indexs include: that bone is special
Alkaline phosphatase, Tartrate resistant acid phosphatase, osteocalcin, 1 type virgin rubber former peptide, Pyridinoline and Deoxypyridinoline, I type glue
The former end N-C- is crosslinked peptide.As previously noted, the accuracy using biochemical indicator detection osteoporosis is inadequate.
Auxiliary examination: including bone imageological examination and Bone mineral density.The object of auxiliary examination is typically all osteoporosis
The patients with terminal of disease, it is impossible to be used in the screening of early stage patients with osteoporosis.
Osteoporosis is clinically using bone density as standard diagnostics.The diagnosis of osteoporosis of world health organisation recommendations
Standard is bone density value lower than 2.5 standard deviations with gender group health adult peak bone mount of the same race, i.e. value < -2.5 T.Bone is close
For degree mainly by genetic determination, genetic force (i.e. the specific gravity of the variation of bone density shared by inherent cause) is up to 50-80%.Therefore, real
Applying to the genetic diagnosis of osteoporosis is clinical prevention and the fundamental way for treating the disease.The text that inventor delivers in early period
Chapter Joint study of two genome-wide association meta-analyses identified
20p12.1and 20q13.33for bone mineral density (Bone.2018) also demonstrates bone density and a variety of bases
Cause and different regulations have very big relationship.But do not conform to currently, can be used for bone density there is no particularly preferred marker
The patient of lattice, the especially diagnosis of juvenile form osteoporosis.
Patients with osteoporosis blood calcium can generally maintain within normal range (NR), therefore cannot be diagnosed according to calcium level
Osteoporosis.X-ray plain film is the common inspection method of Diagnosis of osteoporosis, and osteoporosis x-ray plain film is mainly presented with
The light transmittance increase of bone, osteoporotic fracture.Bone mineral density is generally acknowledged Diagnosis of osteoporosis and understands disease
The method of progress, can be with monitoring therapeuticing effect.It is that current use is most extensive, and can compare and be truly reflected skeletal status
Detection methods.It is the diagnosis of osteoporosis goldstandard of world health organisation recommendations.But this method is due to needing special instrument
Device, some poverty-stricken areas can not large area popularization and use.
Based on the limitation for the means for detecting osteoporosis in the prior art, find it is a kind of effectively can be in early days i.e.
The method that diagnosable osteoporosis occurs is a problem to be solved.
Summary of the invention
The present invention provides a kind of by detection rs59412811 come the reagent of specific detection juvenile form osteoporosis
Box.
An object of the present invention is to provide a kind of screening technique of osteoporosis susceptible gene SNP marker, institute
Stating method is by analysis Britain's biological sample bank (UK Biobank) and international osteoporosis inherent cause alliance (GEFOS)
The disclosed data on genetics of the two tissues, it was found that molecular labeling site rs59412811, position is in No. 6 chromosomes
34218575 positions (be based on NCBI GRCH37 genome version), described to sport A/C directly related with people's osteoporosis.
The present invention provides on a kind of 6p21.31 chromosome according to rs59412811 molecule labelled series disclosed on NCBI
The amplimer pair of rs59412811 molecular labeling, the upstream primer of the primer pair: attagctgggcgtggtggca;Downstream
Primer: ttttcatctctagaagatca;Amplified fragments size: 261bp.A pair of of detection primer pair, genotype are provided simultaneously
One fluorescence probe sequence: 5 '-FAM-caagagtgaaactctgtctca-TAMRA-3 ';Two fluorescence probe sequence of genotype: 5 '
-VIC-caagagtgaacctctgtctca-TAMRA-3’。
Rs59412811SNP detection chip on chromosome 6p21.31 can be used for independent or parallel detection chromosome
6p21.31 the mutation of section A/C.The detection chip is prepared using the construction method of this field routine.
The present invention provides a kind of kit for detecting osteoporosis genetic predisposition.The kit includes:
The specific primer of rs59412811SNP Genetic polymorphism type is detected to shown in SEQ ID NO:2 and 3;PCR reaction component
(including Taq enzyme, dNTP mixed liquor, MgCl2Solution, reaction buffer, deionized water etc.).
Main advantages of the present invention
The present invention identifies that obtaining rs59412811SNP label can be used for surveyor's osteoporosis from chromosome 6p21.31
Shape, the identification have accuracy good, the high advantage of specificity.
Detection method step of the invention is simple, and SNP site detection can be can be completed by One_step PCR, contains SNP site
Target sequence amplification, avoid existing many uncertain factors during the complex operations such as repeated multiple times PCR, thus can
Detection accuracy is greatly improved, qualitative and quantitative analysis feature while embodying accurate.
Specific embodiment
The acquisition of embodiment 1SNP molecular labeling
1. the selection of sample
Extensive genome-wide association study of the SNP marker analysis of this patent sample used from two bone densities
(GWAS): 1) Britain's biological sample bank data set (UK Biobank, UKB).The sample size of the data set is up to 142487
Body, each individual determines heel bone density using quantization ultrasonic technique, while being obtained using high-throughput genotyping technique
The genotypic sequences of genome SNP are taken, and using the sequence data of extensive reference sample to the SNP genotype sequence of not parting
Column carry out genotype and fill a vacancy, to obtain the genotype information of all SNP on genome.The original of UKB has been researched and analysed each
The genetic association of SNP and bone density, and analysis result be published on the net, downloading network address be (http: //
www.gefos.org);2) osteoporosis inherent cause League of Nations (GEFOS), the alliance are associated to 30 full-length genomes
Sample has carried out meta analysis, and total sample size is up to 66628.It is close that each individual uses dual-energy x-ray technology to determine Whole Body Bone Scanning
Degree, while using the genotype information of extensive gene typing chips measurement genome SNP and carrying out genotype and fill a vacancy analysis.It should
The analysis result of alliance is published in same web site (http://www.gefos.org).The sample of the two data sets has a small amount of
It is overlapped.Specifically, 1553 individuals from UKB data set take part in GEFOS research.
2.SNP Quality Control
In the public data collection of UKB, 17166350 variant sites records are shared.1630877 non-SNP are excluded first
(e.g., there is polymorphism in site in more than one base positions).Use chromosome and physical location as ID, then eliminates 1746
A not unique SNP site.In the public data collection of GEFOS, 18259433 variant sites records are shared.Using identical
The row's of receiving standard deletes 1967262 non-SNP sites and 439850 not unique sites.Due to the data set of GEFOS
From 30 GWASA research meta analyses, therefore further exclude the site the SNP (I with significant genetic heterogeneity2>
P value < 0.1 50% or Q), 1608806 SNP sites are excluded altogether.After above-mentioned Quality Control, 9709677 SNP sites are shared
It exists simultaneously in UKB and GEFOS data set.Wherein, there is the allele on 5224 sites different in two datasets
It causes (such as A/G allele corresponds to T/G allele), these sites are also deleted.Finally, 9704453 unique and coexist in
The SNP site of two datasets for analyzing in next step.
3. genetic association analysis
Carry out the genetic association analysis that two datasets merge using a kind of statistical method MTAG of recent development.MTAG is integrated with
The information of two datasets assesses the genetic effect value of each SNP site each data set Nei.It can be with correction data
Sample overlap problem between collection.Analysis result contains the effect value of each SNP site and the p value of genetic association.According to
The significance of international practice, genetic association is defined as p < 5.0 × 10-8。
Conclusion
Shared in UKB public data collection 34236 SNP and heel bone density full-length genome it is horizontal be significantly associated with (p < 5.0 ×
10-8), these SNP sites are covered by 284 different genome areas.Most significant SNP is selected out of each region, is shared
284 most significant SNP.Wherein, also routine is significant (p < 0.05) in GEFOS data set for 147 (51.8%) SNP sites, table
These bright sites can be repeated verifying.In MTAG analysis, a genome area of 255 (89.8%) is still in full-length genome water
Head up display writes (p < 5.0 × 10-8), but remaining 29 sites are no longer significant.In 255 significant associated sites, 110 positions
The correlation signal of point becomes strong, and the correlation signal in 145 sites dies down.
Shared in GEFOS public data collection 5460 SNP and whole body bone density full-length genome it is horizontal be significantly associated with (p <
5.0 ×10-8), these SNP are covered by 69 different genome areas.Wherein, 62 most significant SNP are in UKB data set
Also conventional significant.In MTAG analysis, 64 sites (92.8%) are still in the horizontal significant correlation of full-length genome, and remaining 5
It is a no longer related.
In order to identify new genome area, analyzes in MTAG and identified region is excluded in result, assessment is surplus
Under all SNP for reaching full-length genome level.It is horizontal significant that 163 full-length genomes are identified in the MTAG analysis of UKB
SNP is covered by 13 genome areas.544 significant SNP are identified in the MTAG analysis of GEFOS simultaneously, by 14 bases
Because of a group region overlay.Having 9 genome areas among these is to be overlapped.Therefore, newly identified associated gene group number of regions is 18
It is a.18 most significant SNP conventional significant (p < 0.05) in UKB and GEFOS data set, show that the two data sets can phase
Mutual repeated authentication.It include an important SNP rs59412811 in 18 SNP.Its main result is listed in the following table 1.
Table 1rs59412811 result data
It can be seen that for the site rs59412811 from the data of table 1 there are the mutation of A/C, when it is C, show as
With osteoporosis characteristic, osteoporosis characteristic is not shown when it is A.Mutated-genotype C results in bone density
Reduce, to eventually lead to the generation of osteoporosis, this raising be statistically it is extreme significant, p value is down to 8.23
× 10-9, therefore osteoporosis can be detected by detecting the loci gene type.
By specific embodiment, the present invention will be described in detail above.It will be apparent to one skilled in the art that the present invention is not limited to
Listed embodiment, protection scope are defined by the appended claims herein, and embodiment is only said in an illustrative manner
The bright present invention, so that the present invention is more readily understood.
Claims (7)
1. a kind of kit for detecting juvenile form osteoporosis, it is characterised in that: the kit includes can specific detection
The probe and primer of SNP site relevant to juvenile form osteoporosis.
2. kit as described in claim 1, the kit includes the probe of energy specific detection rs59412811 and draws
Object.
3. kit as claimed in claim 2, it is characterised in that: include described in SEQ ID NO:2-5 in the kit
Primer or probe sequence.
The reagent of primer described in 4.SEQ ID NO:2-5 or probe sequence group in preparation for the detection of juvenile form osteoporosis
Application in box.
5.rs59412811 the purposes of the target spot as detection juvenile form osteoporosis.
Application of the 6.rs59412811 in kit of the preparation for the detection of juvenile form osteoporosis.
7. a kind of method for detecting juvenile form osteoporosis, including use the described in any item kits of claim 1-3.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910060415 | 2019-01-22 | ||
CN2019100604150 | 2019-01-22 |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109750100A true CN109750100A (en) | 2019-05-14 |
Family
ID=66406521
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910106560.8A Pending CN109750100A (en) | 2019-01-22 | 2019-02-02 | A kind of kit based on rs59412811 detection juvenile form osteoporosis |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109750100A (en) |
-
2019
- 2019-02-02 CN CN201910106560.8A patent/CN109750100A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109750100A (en) | A kind of kit based on rs59412811 detection juvenile form osteoporosis | |
CN109825570A (en) | A kind of kit based on rs13469 detection juvenile form osteoporosis | |
CN109797213A (en) | A kind of kit based on rs2012627 detection juvenile form osteoporosis | |
CN109797214A (en) | A kind of kit based on rs7156107 detection juvenile form osteoporosis | |
CN109762885A (en) | A kind of kit based on rs35079125 detection juvenile form osteoporosis | |
CN109762890A (en) | A kind of kit based on rs2531992 detection juvenile form osteoporosis | |
CN109762891A (en) | A kind of kit based on rs7532173 detection juvenile form osteoporosis | |
CN109762887A (en) | A kind of kit based on rs73403830 detection juvenile form osteoporosis | |
CN109762888A (en) | A kind of kit based on rs6866306 detection juvenile form osteoporosis | |
CN109762893A (en) | A kind of kit based on rs1992011 detection juvenile form osteoporosis | |
CN109762892A (en) | A kind of kit based on rs72906356 detection juvenile form osteoporosis | |
CN109536604A (en) | A kind of kit based on rs2012627 detection juvenile form osteoporosis | |
CN109609622A (en) | A kind of kit based on rs7156107 detection juvenile form osteoporosis | |
CN109762894A (en) | A kind of kit based on rs310749 detection juvenile form osteoporosis | |
CN109837337A (en) | A kind of kit based on rs12408576 detection juvenile form osteoporosis | |
CN109609624A (en) | A kind of kit based on rs2531992 detection juvenile form osteoporosis | |
CN109762889A (en) | A kind of kit based on rs6470763 detection juvenile form osteoporosis | |
CN109609626A (en) | A kind of kit based on rs6866306 detection juvenile form osteoporosis | |
CN109609623A (en) | A kind of kit based on rs7532173 detection juvenile form osteoporosis | |
CN109652534A (en) | A kind of kit based on rs1992011 detection juvenile form osteoporosis | |
CN109666732A (en) | A kind of kit based on rs72906356 detection juvenile form osteoporosis | |
CN109666737A (en) | A kind of kit based on rs8071778 detection juvenile form osteoporosis | |
CN109666730A (en) | A kind of kit based on rs8071778 detection juvenile form osteoporosis | |
CN109762886A (en) | A kind of kit based on rs146551666 detection juvenile form osteoporosis | |
CN109666733A (en) | A kind of kit based on rs310749 detection juvenile form osteoporosis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |