CN109762894A - A kind of kit based on rs310749 detection juvenile form osteoporosis - Google Patents

A kind of kit based on rs310749 detection juvenile form osteoporosis Download PDF

Info

Publication number
CN109762894A
CN109762894A CN201910106587.7A CN201910106587A CN109762894A CN 109762894 A CN109762894 A CN 109762894A CN 201910106587 A CN201910106587 A CN 201910106587A CN 109762894 A CN109762894 A CN 109762894A
Authority
CN
China
Prior art keywords
osteoporosis
detection
kit
snp
juvenile form
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910106587.7A
Other languages
Chinese (zh)
Inventor
刘露
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CN109762894A publication Critical patent/CN109762894A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of by detection rs310749 come the kit of specific detection juvenile form osteoporosis.The kit include detect rs310749 SNP site specific primer pair and specificity fluorescent probe to, for general components of fluorescence quantitative PCR detection etc..Kit of the invention assesses individual osteoporosis genetic predisposition with the mononucleotide polymorphism site genotype on the closely related rs310749 of juvenile form osteoporosis genetic predisposition by detection simultaneously.

Description

A kind of kit based on rs310749 detection juvenile form osteoporosis
Technical field
The invention belongs to gene diagnosis fields, are related to a kind of kit for the detection of juvenile form osteoporosis.
Background technique
Osteoporosis is a kind of systemic bone characterized by bone mineral content is reduced with bone tissue microstructure degeneration Bone disease.Its most important harm is induced osteoporosis fracture, and the latter significantly reduces the quality of life and survival rate of patient. It has been reported that only case fatality rate is just up to 20% in the osteoporotic fracture of hip joint its 1 year, person about 25% loses and lives within existence 1 year or more Kinetic force has serious harm.
Osteoporosis and fracture occur mainly in the middle-aged and the old especially postmenopausal women.It is old with China human mortality Age, osteoporosis incidence have leapt to the third position of common chronic disease.The current patients with osteoporosis in China is high Up to 90,000,000, and the incidence of fracture resulted from is more than 9%, and is in increase trend year by year.The year two thousand twenty is expected, only hip The fracture number at one position is just up to 1,600,000, cause 90,000,000,000 yuan direct medical expense and higher postoperative care Expense brings heavy burden to family and society.
The detection of osteoporosis includes the detection and auxiliary detection of laboratory checking index.
Laboratory checking index:
Patients with osteoporosis part serum studentization index can convert (including bon e formation and bone resorption) state with reactive bone, Under the high transition status (such as I type osteoporosis) of bone, these indexs can be increased, it can also be used to monitor the early stage for the treatment of Reaction.But its clinical meaning in osteoporosis is still up for further studying.These Biochemistry measurement indexs include: bone spy Different alkaline phosphatase, Tartrate resistant acid phosphatase, osteocalcin, 1 type virgin rubber former peptide, Pyridinoline and Deoxypyridinoline, I The end N-C- of Collagen Type VI is crosslinked peptide.As previously noted, not using the accuracy of biochemical indicator detection osteoporosis It is enough.
Auxiliary examination: including bone imageological examination and Bone mineral density.The object of auxiliary examination is typically all osteoporosis The patients with terminal of disease, it is impossible to be used in the screening of early stage patients with osteoporosis.
Osteoporosis is clinically using bone density as standard diagnostics.The diagnosis of osteoporosis of world health organisation recommendations Standard is bone density value lower than 2.5 standard deviations with gender group health adult peak bone mount of the same race, i.e. value < -2.5 T.Bone is close For degree mainly by genetic determination, genetic force (i.e. the specific gravity of the variation of bone density shared by inherent cause) is up to 50-80%.Therefore, implement Genetic diagnosis to osteoporosis is clinical prevention and the fundamental way for treating the disease.The article that inventor delivers in early period Joint study of two genome-wide association meta-analyses identified 20p12.1 And 20q13.33 for bone mineral density (Bone. 2018) also demonstrate bone density and several genes with And different regulations has very big relationship.But currently, to can be used for bone density underproof there is no particularly preferred marker Patient, the especially diagnosis of juvenile form osteoporosis.
Patients with osteoporosis blood calcium can generally maintain within normal range (NR), therefore cannot be diagnosed according to calcium level Osteoporosis.X-ray plain film is the common inspection method of Diagnosis of osteoporosis, and osteoporosis x-ray plain film is mainly presented with The light transmittance increase of bone, osteoporotic fracture.Bone mineral density is generally acknowledged Diagnosis of osteoporosis and understands disease The method of progress, can be with monitoring therapeuticing effect.It is that current use is most extensive, and can compare and be truly reflected skeletal status Detection methods.It is the diagnosis of osteoporosis goldstandard of world health organisation recommendations.But this method is due to needing special instrument Device, some poverty-stricken areas can not large area popularization and use.
Based on the limitation for the means for detecting osteoporosis in the prior art, find it is a kind of effectively can be in early days i.e. The method that diagnosable osteoporosis occurs is a problem to be solved.
Summary of the invention
The present invention provides a kind of by detection rs310749 come the kit of specific detection juvenile form osteoporosis.
An object of the present invention is to provide a kind of screening technique of osteoporosis susceptible gene SNP marker, institute Stating method is by analysis Britain's biological sample bank (UK Biobank) and international osteoporosis inherent cause alliance (GEFOS) The disclosed data on genetics of the two tissues, it was found that molecular labeling site rs310749, position is in No. 3 chromosomes 12273768 positions (be based on NCBI GRCH37 genome version), described to sport G/T directly related with people's osteoporosis.
The present invention provides on a kind of 3p25.2 chromosome according to rs310749 molecule labelled series disclosed on NCBI The amplimer pair of rs310749 molecular labeling, the upstream primer of the primer pair: ctaagatagtctcttttaaa;Draw in downstream Object: atgaagataaaatccaagtg;Amplified fragments size: 261bp.A pair of of detection primer pair, genotype one are provided simultaneously Fluorescence probe sequence: 5 '-FAM- actagacaacgaagagtaaac-TAMRA -3 ';Two fluorescence probe sequence of genotype: 5’-VIC- actagacaactaagagtaaac -TAMRA -3’。
Rs310749 SNP detection chip on chromosome 3p 25.2 can be used for independent or parallel detection chromosome 3p 25.2 The mutation of section G/T.The detection chip is prepared using the construction method of this field routine.
The present invention provides a kind of kit for detecting osteoporosis genetic predisposition.The kit includes:
The specific primer of rs310749 SNP Genetic polymorphism type is detected to shown in SEQ ID NO:2 and 3;PCR reaction component (including Taq enzyme, dNTP mixed liquor, MgCl2Solution, reaction buffer, deionized water etc.).
Main advantages of the present invention
The present invention identifies that obtaining rs310749 SNP marker can be used for surveyor's osteoporosis symptoms from chromosome 3p 25.2, The identification has accuracy good, the high advantage of specificity.
Detection method step of the invention is simple, and SNP site detection can be can be completed by One_step PCR, contains SNP site Target sequence amplification, avoid existing many uncertain factors during the complex operations such as repeated multiple times PCR, thus can Detection accuracy is greatly improved, qualitative and quantitative analysis feature while embodying accurate.
Specific embodiment
The acquisition of 1 SNP marker of embodiment
1. the selection of sample
Extensive genome-wide association study of the SNP marker analysis of this patent sample used from two bone densities (GWAS): 1) Britain's biological sample bank data set (UK Biobank, UKB).The sample size of the data set is up to 142487 Body, each individual determines heel bone density using quantization ultrasonic technique, while being obtained using high-throughput genotyping technique The genotypic sequences of genome SNP are taken, and using the sequence data of extensive reference sample to the SNP genotype sequence of not parting Column carry out genotype and fill a vacancy, to obtain the genotype information of all SNP on genome.The original of UKB has been researched and analysed each The genetic association of SNP and bone density, and analysis result be published on the net, downloading network address be (http: // Www.gefos.org);2) osteoporosis inherent cause League of Nations (GEFOS), the alliance are associated to 30 full-length genomes Sample has carried out meta analysis, and total sample size is up to 66628.It is close that each individual uses dual-energy x-ray technology to determine Whole Body Bone Scanning Degree, while using the genotype information of extensive gene typing chips measurement genome SNP and carrying out genotype and fill a vacancy analysis.It should The analysis result of alliance is published in same web site (http://www.gefos.org).The sample of the two data sets has a small amount of It is overlapped.Specifically, 1553 individuals from UKB data set take part in GEFOS research.
2. SNP Quality Control
In the public data collection of UKB, 17166350 variant sites records are shared.1630877 non-SNP are excluded first (e.g., there is polymorphism in site in more than one base positions).Use chromosome and physical location as ID, then eliminates 1746 A not unique SNP site.In the public data collection of GEFOS, 18259433 variant sites records are shared.Using identical The row's of receiving standard deletes 1967262 non-SNP sites and 439850 not unique sites.Due to the data set of GEFOS From 30 GWASA research meta analyses, therefore further exclude the SNP site (I with significant genetic heterogeneity2>50% Or p value < 0.1 Q), 1608806 SNP sites are excluded altogether.After above-mentioned Quality Control, shares 9709677 SNP sites while depositing It is in UKB and GEFOS data set.Wherein, there is allele (such as A/ inconsistent in two datasets on 5224 sites G allele corresponds to T/G allele), these sites are also deleted.Finally, 9704453 unique and coexist in two data The SNP site of collection for analyzing in next step.
3. genetic association analysis
Carry out the genetic association analysis that two datasets merge using a kind of statistical method MTAG of recent development.MTAG is integrated with The information of two datasets assesses the genetic effect value of each SNP site each data set Nei.It can be with correction data Sample overlap problem between collection.Analysis result contains the effect value of each SNP site and the p value of genetic association.According to The significance of international practice, genetic association is defined as p < 5.0 × 10-8
Conclusion
Shared in UKB public data collection 34236 SNP and heel bone density full-length genome it is horizontal be significantly associated with (p < 5.0 × 10-8), these SNP sites are covered by 284 different genome areas.Most significant SNP is selected out of each region, is shared 284 most significant SNP.Wherein, also routine is significant (p < 0.05) in GEFOS data set for 147 (51.8%) SNP sites, shows These sites can be repeated verifying.In MTAG analysis, 255(89.8%) a genome area is still in full-length genome level Significantly (p < 5.0 × 10-8), but remaining 29 sites are no longer significant.In 255 significant associated sites, 110 sites Correlation signal becomes strong, and the correlation signal in 145 sites dies down.
Shared in GEFOS public data collection 5460 SNP and whole body bone density full-length genome it is horizontal be significantly associated with (p < 5.0×10-8), these SNP are covered by 69 different genome areas.Wherein, 62 most significant SNP are in UKB data set It is conventional significant.In MTAG analysis, 64 sites (92.8%) are still in the horizontal significant correlation of full-length genome, and remaining 5 not It is related again.
In order to identify new genome area, analyzes in MTAG and identified region is excluded in result, assessment is surplus Under all SNP for reaching full-length genome level.It is horizontal significant that 163 full-length genomes are identified in the MTAG analysis of UKB SNP is covered by 13 genome areas.544 significant SNP are identified in the MTAG analysis of GEFOS simultaneously, by 14 bases Because of a group region overlay.Having 9 genome areas among these is to be overlapped.Therefore, newly identified associated gene group number of regions is 18 It is a.18 most significant SNP conventional significant (p < 0.05) in UKB and GEFOS data set, show that the two data sets can phase Mutual repeated authentication.It include an important SNP rs310749 in 18 SNP.Its main result is listed in the following table 1.
1 rs310749 result data of table
It can be seen that for the site rs310749 from the data of table 1 there are the mutation of G/T, when it is T, show as having There is osteoporosis characteristic, does not show osteoporosis characteristic when it is G.Mutated-genotype T results in the drop of bone density It is low, to eventually lead to the generation of osteoporosis, this raising be statistically it is extreme significant, p value down to 4.71 × 10-9, therefore osteoporosis can be detected by detecting the loci gene type.
By specific embodiment, the present invention will be described in detail above.It will be apparent to one skilled in the art that the present invention is not limited to Listed embodiment, protection scope are defined by the appended claims herein, and embodiment is only said in an illustrative manner The bright present invention, so that the present invention is more readily understood.
Sequence table
<110>Liu Lu
<120>a kind of kit based on rs310749 detection juvenile form osteoporosis
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 261
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 1
ctaagatagt ctcttttaaa ctttagcctc aatcaaatgc ttttaatgca caaatattca 60
ttgagcactt atatatgttc aaaattacat tagtcaccat ggagaattaa agaaaaaaaa 120
aaacaagagt actagacaac kaagagtaaa ctgctcttct gaagctcaaa gcctaatcca 180
ctgtgtcttc aggtttgggg ggattcttga tttttaaatt tccttttttt attcaaactt 240
acacttggat tttatcttca t 261
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 2
ctaagatagt ctcttttaaa 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 3
atgaagataa aatccaagtg 20
<210> 4
<211> 21
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 4
actagacaac gaagagtaaa c 21
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 5
actagacaac taagagtaaa c 21

Claims (7)

1. a kind of kit for detecting juvenile form osteoporosis, it is characterised in that: the kit includes can specific detection The probe and primer of SNP site relevant to juvenile form osteoporosis.
2. kit as described in claim 1, the kit includes the probe and primer of energy specific detection rs310749.
3. kit as claimed in claim 2, it is characterised in that: include described in SEQ ID NO:2-5 in the kit Primer or probe sequence.
The reagent of primer described in 4.SEQ ID NO:2-5 or probe sequence group in preparation for the detection of juvenile form osteoporosis Application in box.
5.rs310749 the purposes of the target spot as detection juvenile form osteoporosis.
Application of the 6.rs310749 in kit of the preparation for the detection of juvenile form osteoporosis.
7. a kind of method for detecting juvenile form osteoporosis, including use the described in any item kits of claim 1-3.
CN201910106587.7A 2019-01-22 2019-02-02 A kind of kit based on rs310749 detection juvenile form osteoporosis Pending CN109762894A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2019100596192 2019-01-22
CN201910059619 2019-01-22

Publications (1)

Publication Number Publication Date
CN109762894A true CN109762894A (en) 2019-05-17

Family

ID=66455871

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910106587.7A Pending CN109762894A (en) 2019-01-22 2019-02-02 A kind of kit based on rs310749 detection juvenile form osteoporosis

Country Status (1)

Country Link
CN (1) CN109762894A (en)

Similar Documents

Publication Publication Date Title
CN109762894A (en) A kind of kit based on rs310749 detection juvenile form osteoporosis
CN109666733A (en) A kind of kit based on rs310749 detection juvenile form osteoporosis
CN109797214A (en) A kind of kit based on rs7156107 detection juvenile form osteoporosis
CN109762893A (en) A kind of kit based on rs1992011 detection juvenile form osteoporosis
CN109762890A (en) A kind of kit based on rs2531992 detection juvenile form osteoporosis
CN109762887A (en) A kind of kit based on rs73403830 detection juvenile form osteoporosis
CN109762888A (en) A kind of kit based on rs6866306 detection juvenile form osteoporosis
CN109762891A (en) A kind of kit based on rs7532173 detection juvenile form osteoporosis
CN109797213A (en) A kind of kit based on rs2012627 detection juvenile form osteoporosis
CN109762892A (en) A kind of kit based on rs72906356 detection juvenile form osteoporosis
CN109762885A (en) A kind of kit based on rs35079125 detection juvenile form osteoporosis
CN109762889A (en) A kind of kit based on rs6470763 detection juvenile form osteoporosis
CN109825570A (en) A kind of kit based on rs13469 detection juvenile form osteoporosis
CN109609622A (en) A kind of kit based on rs7156107 detection juvenile form osteoporosis
CN109837337A (en) A kind of kit based on rs12408576 detection juvenile form osteoporosis
CN109609626A (en) A kind of kit based on rs6866306 detection juvenile form osteoporosis
CN109652534A (en) A kind of kit based on rs1992011 detection juvenile form osteoporosis
CN109609624A (en) A kind of kit based on rs2531992 detection juvenile form osteoporosis
CN109666737A (en) A kind of kit based on rs8071778 detection juvenile form osteoporosis
CN109666730A (en) A kind of kit based on rs8071778 detection juvenile form osteoporosis
CN109762886A (en) A kind of kit based on rs146551666 detection juvenile form osteoporosis
CN109536604A (en) A kind of kit based on rs2012627 detection juvenile form osteoporosis
CN109609623A (en) A kind of kit based on rs7532173 detection juvenile form osteoporosis
CN109666732A (en) A kind of kit based on rs72906356 detection juvenile form osteoporosis
CN109666738A (en) A kind of kit based on rs13055979 detection juvenile form osteoporosis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination