CN109762891A - A kind of kit based on rs7532173 detection juvenile form osteoporosis - Google Patents

Abstract

The invention discloses a kind of by detection rs7532173 come the kit of specific detection juvenile form osteoporosis.The kit include detect rs7532173 SNP site specific primer pair and specificity fluorescent probe to, for general components of fluorescence quantitative PCR detection etc..Kit of the invention assesses individual osteoporosis genetic predisposition with the mononucleotide polymorphism site genotype on the closely related rs7532173 of juvenile form osteoporosis genetic predisposition by detection simultaneously.

Description

A kind of kit based on rs7532173 detection juvenile form osteoporosis

Technical field

The invention belongs to gene diagnosis fields, are related to a kind of kit for the detection of juvenile form osteoporosis.

Background technique

Osteoporosis is a kind of systemic bone characterized by bone mineral content is reduced with bone tissue microstructure degeneration Bone disease.Its most important harm is induced osteoporosis fracture, and the latter significantly reduces the quality of life and survival rate of patient. It has been reported that only case fatality rate is just up to 20% in the osteoporotic fracture of hip joint its 1 year, person about 25% loses and lives within existence 1 year or more Kinetic force has serious harm.

Osteoporosis and fracture occur mainly in the middle-aged and the old especially postmenopausal women.It is old with China human mortality Age, osteoporosis incidence have leapt to the third position of common chronic disease.The current patients with osteoporosis in China is high Up to 90,000,000, and the incidence of fracture resulted from is more than 9%, and is in increase trend year by year.The year two thousand twenty is expected, only hip The fracture number at one position is just up to 1,600,000, cause 90,000,000,000 yuan direct medical expense and higher postoperative care Expense brings heavy burden to family and society.

The detection of osteoporosis includes the detection and auxiliary detection of laboratory checking index.

Laboratory checking index:

Patients with osteoporosis part serum studentization index can convert (including bon e formation and bone resorption) state with reactive bone, Under the high transition status (such as I type osteoporosis) of bone, these indexs can be increased, it can also be used to monitor the early stage for the treatment of Reaction.But its clinical meaning in osteoporosis is still up for further studying.These Biochemistry measurement indexs include: bone spy Different alkaline phosphatase, Tartrate resistant acid phosphatase, osteocalcin, 1 type virgin rubber former peptide, Pyridinoline and Deoxypyridinoline, I The end N-C- of Collagen Type VI is crosslinked peptide.As previously noted, not using the accuracy of biochemical indicator detection osteoporosis It is enough.

Auxiliary examination: including bone imageological examination and Bone mineral density.The object of auxiliary examination is typically all osteoporosis The patients with terminal of disease, it is impossible to be used in the screening of early stage patients with osteoporosis.

Osteoporosis is clinically using bone density as standard diagnostics.The diagnosis of osteoporosis of world health organisation recommendations Standard is bone density value lower than 2.5 standard deviations with gender group health adult peak bone mount of the same race, i.e. value < -2.5 T.Bone is close For degree mainly by genetic determination, genetic force (i.e. the specific gravity of the variation of bone density shared by inherent cause) is up to 50-80%.Therefore, implement Genetic diagnosis to osteoporosis is clinical prevention and the fundamental way for treating the disease.The article that inventor delivers in early period Joint study of two genome-wide association meta-analyses identified 20p12.1 And 20q13.33 for bone mineral density (Bone. 2018) also demonstrate bone density and several genes with And different regulations has very big relationship.But currently, to can be used for bone density underproof there is no particularly preferred marker Patient, the especially diagnosis of juvenile form osteoporosis.

Patients with osteoporosis blood calcium can generally maintain within normal range (NR), therefore cannot be diagnosed according to calcium level Osteoporosis.X-ray plain film is the common inspection method of Diagnosis of osteoporosis, and osteoporosis x-ray plain film is mainly presented with The light transmittance increase of bone, osteoporotic fracture.Bone mineral density is generally acknowledged Diagnosis of osteoporosis and understands disease The method of progress, can be with monitoring therapeuticing effect.It is that current use is most extensive, and can compare and be truly reflected skeletal status Detection methods.It is the diagnosis of osteoporosis goldstandard of world health organisation recommendations.But this method is due to needing special instrument Device, some poverty-stricken areas can not large area popularization and use.

Based on the limitation for the means for detecting osteoporosis in the prior art, find it is a kind of effectively can be in early days i.e. The method that diagnosable osteoporosis occurs is a problem to be solved.

Summary of the invention

The present invention provides a kind of by detection rs7532173 come the reagent of specific detection juvenile form osteoporosis Box.

An object of the present invention is to provide a kind of screening technique of osteoporosis susceptible gene SNP marker, institute Stating method is by analysis Britain's biological sample bank (UK Biobank) and international osteoporosis inherent cause alliance (GEFOS) The disclosed data on genetics of the two tissues, it was found that molecular labeling site rs7532173, position is in No. 1 chromosome 67086111 positions (be based on NCBI GRCH37 genome version), described to sport A/G directly related with people's osteoporosis.

The present invention provides on a kind of 1p31.3 chromosome according to rs7532173 molecule labelled series disclosed on NCBI The amplimer pair of rs7532173 molecular labeling, the upstream primer of the primer pair: gttaaaaaggttatttttaa；Downstream Primer: ctctctgtctctcttctctg；Amplified fragments size: 261bp.A pair of of detection primer pair, genotype are provided simultaneously One fluorescence probe sequence: 5 '-FAM-taaagaaaggaggtttaattg- TAMRA -3 '；Two fluorescence probe sequence of genotype: 5’-VIC-taaagaaagggggtttaattg -TAMRA -3’。

Rs7532173 SNP detection chip on chromosome 1p31.3 can be used for independent or parallel detection chromosome 1p31.3 The mutation of section A/G.The detection chip is prepared using the construction method of this field routine.

The present invention provides a kind of kit for detecting osteoporosis genetic predisposition.The kit includes:

The specific primer of rs7532173 SNP Genetic polymorphism type is detected to shown in SEQ ID NO:2 and 3；PCR reaction component (including Taq enzyme, dNTP mixed liquor, MgCl₂Solution, reaction buffer, deionized water etc.).

Main advantages of the present invention

The present invention identifies that obtaining rs7532173 SNP marker can be used for surveyor's osteoporosis from chromosome 1p31.3 Shape, the identification have accuracy good, the high advantage of specificity.

Detection method step of the invention is simple, and SNP site detection can be can be completed by One_step PCR, contains SNP site Target sequence amplification, avoid existing many uncertain factors during the complex operations such as repeated multiple times PCR, thus can Detection accuracy is greatly improved, qualitative and quantitative analysis feature while embodying accurate.

Specific embodiment

The acquisition of 1 SNP marker of embodiment

1. the selection of sample

Extensive genome-wide association study of the SNP marker analysis of this patent sample used from two bone densities (GWAS): 1) Britain's biological sample bank data set (UK Biobank, UKB).The sample size of the data set is up to 142487 Body, each individual determines heel bone density using quantization ultrasonic technique, while being obtained using high-throughput genotyping technique The genotypic sequences of genome SNP are taken, and using the sequence data of extensive reference sample to the SNP genotype sequence of not parting Column carry out genotype and fill a vacancy, to obtain the genotype information of all SNP on genome.The original of UKB has been researched and analysed each The genetic association of SNP and bone density, and analysis result be published on the net, downloading network address be (http: // Www.gefos.org)；2) osteoporosis inherent cause League of Nations (GEFOS), the alliance are associated to 30 full-length genomes Sample has carried out meta analysis, and total sample size is up to 66628.It is close that each individual uses dual-energy x-ray technology to determine Whole Body Bone Scanning Degree, while using the genotype information of extensive gene typing chips measurement genome SNP and carrying out genotype and fill a vacancy analysis.It should The analysis result of alliance is published in same web site (http://www.gefos.org).The sample of the two data sets has a small amount of It is overlapped.Specifically, 1553 individuals from UKB data set take part in GEFOS research.

2. SNP Quality Control

In the public data collection of UKB, 17166350 variant sites records are shared.1630877 non-SNP are excluded first (e.g., there is polymorphism in site in more than one base positions).Use chromosome and physical location as ID, then eliminates 1746 A not unique SNP site.In the public data collection of GEFOS, 18259433 variant sites records are shared.Using identical The row's of receiving standard deletes 1967262 non-SNP sites and 439850 not unique sites.Due to the data set of GEFOS From 30 GWASA research meta analyses, therefore further exclude the SNP site (I with significant genetic heterogeneity²>50% Or p value < 0.1 Q), 1608806 SNP sites are excluded altogether.After above-mentioned Quality Control, shares 9709677 SNP sites while depositing It is in UKB and GEFOS data set.Wherein, there is allele (such as A/ inconsistent in two datasets on 5224 sites G allele corresponds to T/G allele), these sites are also deleted.Finally, 9704453 unique and coexist in two data The SNP site of collection for analyzing in next step.

3. genetic association analysis

Carry out the genetic association analysis that two datasets merge using a kind of statistical method MTAG of recent development.MTAG is integrated with The information of two datasets assesses the genetic effect value of each SNP site each data set Nei.It can be with correction data Sample overlap problem between collection.Analysis result contains the effect value of each SNP site and the p value of genetic association.According to The significance of international practice, genetic association is defined as p < 5.0 × 10^-8。

Conclusion

Shared in UKB public data collection 34236 SNP and heel bone density full-length genome it is horizontal be significantly associated with (p < 5.0 × 10^-8), these SNP sites are covered by 284 different genome areas.Most significant SNP is selected out of each region, is shared 284 most significant SNP.Wherein, also routine is significant (p < 0.05) in GEFOS data set for 147 (51.8%) SNP sites, shows These sites can be repeated verifying.In MTAG analysis, 255(89.8%) a genome area is still in full-length genome level Significantly (p < 5.0 × 10^-8), but remaining 29 sites are no longer significant.In 255 significant associated sites, 110 sites Correlation signal becomes strong, and the correlation signal in 145 sites dies down.

Shared in GEFOS public data collection 5460 SNP and whole body bone density full-length genome it is horizontal be significantly associated with (p < 5.0×10^-8), these SNP are covered by 69 different genome areas.Wherein, 62 most significant SNP are in UKB data set It is conventional significant.In MTAG analysis, 64 sites (92.8%) are still in the horizontal significant correlation of full-length genome, and remaining 5 not It is related again.

In order to identify new genome area, analyzes in MTAG and identified region is excluded in result, assessment is surplus Under all SNP for reaching full-length genome level.It is horizontal significant that 163 full-length genomes are identified in the MTAG analysis of UKB SNP is covered by 13 genome areas.544 significant SNP are identified in the MTAG analysis of GEFOS simultaneously, by 14 bases Because of a group region overlay.Having 9 genome areas among these is to be overlapped.Therefore, newly identified associated gene group number of regions is 18 It is a.18 most significant SNP conventional significant (p < 0.05) in UKB and GEFOS data set, show that the two data sets can phase Mutual repeated authentication.It include an important SNP rs7532173 in 18 SNP.Its main result is listed in the following table 1.

1 rs7532173 result data of table

It can be seen that for the site rs7532173 from the data of table 1 there are the mutation of A/G, when it is G, show as having There is osteoporosis characteristic, does not show osteoporosis characteristic when it is A.Mutated-genotype G results in the drop of bone density It is low, to eventually lead to the generation of osteoporosis, this raising be statistically it is extreme significant, p value down to 2.24 × 10^-8, therefore osteoporosis can be detected by detecting the loci gene type.

By specific embodiment, the present invention will be described in detail above.It will be apparent to one skilled in the art that the present invention is not limited to Listed embodiment, protection scope are defined by the appended claims herein, and embodiment is only said in an illustrative manner The bright present invention, so that the present invention is more readily understood.

Sequence table

<110>Liu Lu

<120>a kind of kit based on rs7532173 detection juvenile form osteoporosis

<141> 2019-01-09

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 261

<212> DNA

<213>artificial sequence (Homo sapiens)

<400> 1

gttaaaaagg ttatttttaa aaagtttttt aaaaaaatgt ctttcaaact attcttgacc 60

tgcaatctat cataatgtac tagccgttct gacactgtta taaagatact acccaagact 120

gggtaattta taaagaaagg rggtttaatt gactcacagt tccacatggc tggggaggcc 180

tcaggaaact cacaatcatg gtagaaggtg aaggggaagc aaggcacgtc ttacatggca 240

gcagagaaga gagacagaga g 261

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Homo sapiens)

<400> 2

gttaaaaagg ttatttttaa 20

<210> 3

<211> 20

<212> DNA

<213>artificial sequence (Homo sapiens)

<400> 3

ctctctgtct ctcttctctg 20

<210> 4

<211> 21

<212> DNA

<213>artificial sequence (Homo sapiens)

<400> 4

taaagaaagg aggtttaatt g 21

<210> 5

<211> 21

<212> DNA

<213>artificial sequence (Homo sapiens)

<400> 5

taaagaaagg gggtttaatt g 21

Claims (7)

1. a kind of kit for detecting juvenile form osteoporosis, it is characterised in that: the kit includes can specific detection The probe and primer of SNP site relevant to juvenile form osteoporosis.

2. kit as described in claim 1, the kit includes the probe of energy specific detection rs7532173 and draws Object.

3. kit as claimed in claim 2, it is characterised in that: include described in SEQ ID NO:2-5 in the kit Primer or probe sequence.

The reagent of primer described in 4.SEQ ID NO:2-5 or probe sequence group in preparation for the detection of juvenile form osteoporosis Application in box.

5.rs7532173 the purposes of the target spot as detection juvenile form osteoporosis.

Application of the 6.rs7532173 in kit of the preparation for the detection of juvenile form osteoporosis.

7. a kind of method for detecting juvenile form osteoporosis, including use the described in any item kits of claim 1-3.