CN109750044B - Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method - Google Patents
Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method Download PDFInfo
- Publication number
- CN109750044B CN109750044B CN201910159330.8A CN201910159330A CN109750044B CN 109750044 B CN109750044 B CN 109750044B CN 201910159330 A CN201910159330 A CN 201910159330A CN 109750044 B CN109750044 B CN 109750044B
- Authority
- CN
- China
- Prior art keywords
- aphid
- dsrna
- brown orange
- hunchback
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a brown orange aphid Hunchback gene, the sequence of which is shown in SEQ ID NO. 3; also discloses dsRNA of the Hunchback gene, and the sequence is shown as SEQ ID NO. 6; also discloses a synthetic method of dsRNA of the brown orange aphid Hunchback gene, which comprises the following steps: extracting total RNA, carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by using a primer of SEQ ID NO. 4 and a primer of SEQ ID NO. 5, carrying out electrophoresis on a PCR amplification product, recovering the product, and synthesizing to obtain dsRNA by using a gel recovery product as a template. Also discloses a novel aphid RNAi method: fixing the back of the brown orange aphid upwards, dripping dsRNA of the Hunchback gene on the back of the abdomen of the brown orange aphid, and putting the brown orange aphid into an incubator for feeding after the dsRNA liquid is fully absorbed to the body surface and dried.
Description
Technical Field
The invention relates to the field of insect growth and development regulation and genetic engineering, in particular to a brown orange aphid Hunchback gene, dsRNA, a synthetic method and a novel aphid RNAi method.
Background
The brown orange aphid (Toxoptera citricida) is a worldwide citrus pest, is also a main transmission medium of citrus tristeza virus, has large influence on the yield and quality of citrus, and is still an important measure for controlling the brown orange aphid at present through chemical control. Improper application of chemical pesticides not only affects the safety of fruits, but also causes serious drug resistance.
RNA interference (RNAi), an important gene silencing means discovered in recent years, refers to a phenomenon of highly conserved evolution, induced by Double-stranded RNA (dsRNA), and highly efficient and specific degradation of homologous RNA, and is the specific degradation of mRNA of a corresponding sequence through the mediation of dsRNA. Since the expression of a specific gene can be specifically inhibited using the RNAi technology, the technology has been widely used in the fields of exploring gene functions and gene therapy.
The Hunchback gene is a gap gene, is an important embryonic development related gene and regulates the development of somatic segments of insects. Genes controlling the occurrence of drosophila somites include gap genes (gap genes), pair-rule genes (pair-rule genes), and segment polarity genes (segment polarity genes), as previously studied. Mutation of gap genes can cause the embryo somite pattern to be vacant, namely, the clustered paratuber is lost, wherein the Hunchback is a specific embryo gene for inhibiting the formation of the abdomen, and the distribution of the superbithorax gene (ultrabithorrax) in the expression of the front somite and the back somite is regulated. In the aphid pea, the Hunchback gene regulates the formation of the anterior somite during embryonic development. However, no report about the brown orange aphid Hunchback gene and dsRNA thereof exists at present.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a brown orange aphid Hunchback gene, dsRNA, a synthetic method and a novel aphid RNAi method.
The technical scheme of the invention is as follows:
a brown orange aphid Hunchback gene has a sequence shown in SEQ ID NO. 3.
The dsRNA of the Hunchback gene of the brown orange aphid has a sequence shown in SEQ ID NO. 6.
A synthetic method of dsRNA of a brown orange aphid Hunchback gene comprises the following steps: extracting total RNA of the brown orange aphid, carrying out reverse transcription to form cDNA serving as an amplification template, carrying out PCR amplification by using an upstream primer with a sequence of SEQ ID NO. 4 and a downstream primer with a sequence of SEQ ID NO. 5, carrying out electrophoresis on a PCR amplification product, recovering the product, and synthesizing by using a gel recovery product as a template to obtain dsRNA of the brown orange aphid Hunchback gene.
In the above technical scheme, a 25 μ l PCR reaction system for PCR amplification includes: mu.l of cDNA template with the concentration of 800-1200 ng/mu.l, 1 mu.l of each of the upstream primer and the downstream primer with the concentration of 0.15-0.25 mu.M, 12.5 mu.l of PrimeSTARMax Premix and 10 mu.l of denuclease enzyme water.
In the above technical scheme, the PCR reaction conditions are: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 2min for 35 cycles; extension is carried out for 10min at 72 ℃.
A novel aphid RNAi method comprises the following steps: fixing the back of the brown orange aphid upwards, sucking the dsRNA solution of the Hunchback gene of the brown orange aphid by using a micropipettor, dripping the dsRNA on the back of the abdomen of the brown orange aphid, and putting the brown orange aphid into an incubator to feed after the dsRNA solution is fully absorbed to the body surface and dried.
The beneficial effects of the invention are: the Hunchback gene sequence of the brown orange aphids is identified and obtained, and dsRNA of the Hunchback gene is obtained according to the sequence, and the Hunchback gene dsRNA can be applied to RNA interference on the brown orange aphids so as to achieve the effect of preventing and treating the brown orange aphids. Experiments prove that the dsRNA gene has high silencing efficiency, the brown orange aphid has obvious phenotypic change after gene interference, the problem that the brown orange aphid does not have effective dsRNA of the Hunchback gene at present is solved, and the dsRNA has good application prospect in the aspect of researching and developing novel insecticides. Meanwhile, a novel, simple and efficient dsRNA (double-stranded ribonucleic acid) delivery mode is established, the gene can be caused to be severely reduced, the potential of targeted interference on biological control of the brown orange aphids is realized, experiments prove that the dsRNA delivery method is simple and feasible, the huge application potential is realized, the target gene silencing efficiency is high, the problem that the brown orange aphids do not have effective dsRNA of the Hunchback gene at present is solved, and the dsRNA delivery method has a good application prospect in the aspect of researching and developing novel insecticides.
Drawings
FIG. 1 is a comparison chart of Protein Blast of the brown orange aphid Hunchback gene in NCBI.
FIG. 2 is a tree diagram of the amino acid sequence of the Hunchback gene of Aphis citricola and the phylogenetic tree of the Hunchback transporter of other insects.
Fig. 3 is a brown orange aphid feeding device used in the third embodiment of the invention.
Fig. 4 is a schematic diagram of the operation of the three-purpose micropipette for delivering dsRNA to orange aphid brown color in the embodiment of the present invention.
FIG. 5 shows relative expression of the Hunchback gene after the brown orange aphid delivers dsRNA of the Hunchback gene, wherein GFP represents a control group, and dsHunchback represents an experimental group.
Detailed Description
The sources of the chemical reagents used in the embodiment of the invention are as follows:
LA Taq MIX (Takara, japan)
TRIzol kit (Invitrogen corporation, USA)
RNeasy Plus Micro Kit (QIAGEN, germany)
PrimeSTAR Max Premix (Takara, japan)
Gel recovery and purification kit (Takara, japan)
TranscriptAId T7High Yield Transcription Kit (Thermo fisher Scientific Co., USA) Perfect time RT reagent (Takara Co., japan)
TranscriptAId Enzyme Mix (Thermo fisher Scientific, USA)
ATP/CTP/GTP/UTP Mix (Thermo fisher Scientific, USA)
PrimeScriptRT Enzyme Mix I (Thermo fisher Scientific, USA)
Oligo dT Primer (Thermo fisher Scientific, USA)
Random 6mers (Thermo fisher Scientific, USA)
Example I, identification of the sequence of the ABCG4 gene of Aphis citricola
1) The possible Hunchback Unigene sequences are searched from brown orange aphid transcriptome data (provided by the university of southwest entomology and pest control emphasis laboratory), and one Unigene sequence is searched in the transcriptome through tBlastn.
2) Total RNA of brown orange aphid is extracted by using an RNA extraction Kit RNeasy plus Micro Kit according to the use instruction, and then 1 mu g of total RNA is reversely transcribed into cDNA by using a reverse transcription Kit Perfect real time RT reagent according to the use instruction.
3) Designing an amplification primer by taking the obtained cDNA as a template, and carrying out PCR amplification by using upstream and downstream primers Hunchback-A and Hunchback-S; the PCR conditions were: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 2min for 35 cycles; extension for 10min at 72 ℃. A total of 25. Mu.l of PCR reaction was included: 1. Mu.l of cDNA template with a concentration of 1000 ng/. Mu.l, 1. Mu.l of each of the upstream and downstream primers with a concentration of 0.15-0.25. Mu.M, 0.25. Mu.l of LA TaqMIX, 10 Xbuffer (Mg) 2+ plus) 3. Mu.l, dNTP 4. Mu.l and enucleated enzyme water 14.75. Mu.l; the sequences of primers Hunchback-A (shown in SEQ ID NO: 1) and Hunchback-S (shown in SEQ ID NO: 2) are as follows:
Hunchback-A：TGCGACTACAAGTGCGTGAG；
Hunchback-S：GCCGAGGTTGGGTAAGAG。
4) The PCR product was separated by 1% agarose gel electrophoresis to obtain a band of about 406bp, and the PCR product was sent to sequencing company for sequencing.
5) The sequencing result is manually corrected, the sequence is spliced, and Protein Blast similarity comparison is carried out in NCBI, the comparison result is shown in figure 1, so that the homology of the brown orange aphid Hunchback gene and the corn sinonovacula constricta (Rhopalosiphum maidis) Hunchback gene is the highest and is up to 84 percent. The results of comparison with other insects also show that the gene obtained by the clone is the Hunchback gene of brown orange aphid.
6) Through the construction of an amino acid phylogenetic tree, as shown in figure 2, the genes of brown orange aphid Hunchback have the highest homology with pea aphid and green peach aphid, and in addition, the homology with the same of Hemiptera yellow sugarcane aphid and corn aphid ductus avenae is also higher, and the obtained sequence is determined to be a brown orange aphid Hunchback gene sequence (as shown in SEQ ID NO: 3).
Example two Synthesis of dsRNA of the Pholiota citricola Hunchback Gene
1) According to brown orange aphid transcriptome data (provided by Insectiology and pest control emphasis laboratories of southwest university), designing and amplifying upstream and downstream primers T7-Hunchback-S (shown as SEQ ID NO: 4) and T7-Hunchback-A (shown as SEQ ID NO: 5) of a Hunchback gene, synthesizing primers, wherein the primer sequences are respectively as follows:
T7-Hunchback-S：
TAATACGACTCACTATAGGGTGCGACTACAAGTGCGTGA；
T7-Hunchback-A：
TAATACGACTCACTATAGGGATAGAGTACGGCGACGGATG。
2) Extracting total RNA of orange aphid with Trizol reagent according to the instruction, then reverse transcribing 1 mug total RNA into cDNA with reverse transcription kit Perfect real time RT reagent according to the instruction, the reverse transcription system is 20 mug, which includes: mu.l of total RNA (ca. 1. Mu.g), 4. Mu.l of 5 XPrimeScript Buffer, 1. Mu.l of PrimeScriptRT Enzyme Mix I, 1. Mu.l of Oligo dT Primer (50. Mu.M), 1. Mu.l of Random 6mers (100. Mu.M), RNase Free ddH 2 O 12μl。
3) Carrying out PCR amplification on the cDNA obtained in the step 2), wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 2min for 35 cycles; extending for 10min at 72 ℃; a total of 25. Mu.l of PCR reaction was included: mu.l of cDNA template with a concentration of 1000 ng/. Mu.l, 1. Mu.l each of upstream and downstream primers (T7-Hunchback-S, T7-Hunchback-A) with a concentration of 0.15-0.25. Mu.M, 12.5. Mu.l of PrimeSTAR Max Premix, and 10. Mu.l of enucleate enzyme water.
4) Purifying and recycling the PCR product in the step 3) by using a gel recycling and purifying Kit according to an instruction and then using the PCR product as a Transcription template for synthesizing dsRNA, using an in vitro synthesis RNA Kit Transcript Aid T7High Yield Transcription Kit to transcribe and purify according to the instruction to obtain a dsRNA (shown as SEQ ID NO: 6) solution of the brown orange aphid Hunchback gene, and diluting the concentration of the dsRNA solution to 200-300 ng/mu l for later use. The dsRNA synthesis reaction system is 20 mu l, and comprises: cDNA template 4. Mu.l (about 1. Mu.g), 5 × Transcriptaid Reaction Buffer 4. Mu.l, ATP/CTP/GTP/UTP Mix 8. Mu.l at a concentration of 100mM, transcriptaid Enzyme Mix 2. Mu.l and DEPC-sequenced water 2. Mu.l; the reaction conditions are as follows: incubate at 37 ℃ for 4h.
Meanwhile, the dsRNA solution of GFP (green fluorescent protein) synthesized and purified by the method is used as a negative control, and the sequences of upstream and downstream primers used when the cDNA obtained by reverse transcription is subjected to PCR amplification are respectively GFP-ds-T7F (shown as SEQ ID NO: 7) and GFP-ds-T7R (shown as SEQ ID NO: 8), and the sequences are as follows:
GFP-ds-T7F：
TAATACGACTCACTATAGGGCAGTTCTTGTTGAATTAGATG；
GFP-ds-T7R：
TAATACGACTCACTATAGGGTTTGGTTTGTCTCCCATGATG。
example three introduction of dsRNA of Hunchback Gene of Aphis citricola into Aphis citricola
Using a micropipette to deliver dsRNA to the brown orange aphid, the operation is as follows:
1) The bottom of a 1.5mL centrifuge tube is removed, about 1mL tap water is poured into the centrifuge tube, citrus shoots are inserted from the bottom of the centrifuge tube, and a gap between an orifice at the bottom of the centrifuge tube and the shoots of the shoots is sealed by a paraffin wax mold. The orange aphid feeder is placed in a culture dish, the culture dish is covered by gauze, and the orange aphid feeder is fixed around a dish opening by a rubber band, so that the orange aphid can normally breathe and can be prevented from escaping, and the orange aphid feeder can be used later (as shown in figure 3).
2) Fixing the orange aphid with the back facing upwards on a piece of sticky paper.
3) The Hamilton micropipette was rinsed with absolute ethanol followed by ultra pure water.
4) A dsRNA solution of the Hunchback gene of the brown orange aphid in example II at a concentration of 1080 ng/. Mu.L is pipetted and dripped on the back of the abdomen of the brown orange aphid (operation is shown in figure 4), and the treatment dose per insect is 0.5. Mu.L, namely 540 ng/insect.
5) After the dsRNA liquid on the back of the orange aphid body is fully absorbed until the insect body is dried, picking the orange aphid into the feeding device manufactured in the step 1); the whole feeding device is placed into an incubator and cultured for 36h under the conditions of 25 +/-1 ℃, humidity of 75 +/-5% and illumination: 14h in the dark.
Every 4 heads of orange aphids are one biological repetition, and 4 biological repetitions are set as an experimental group. At the same time, a treatment with a dsRNA solution of GFP was set as a control group.
EXAMPLE four silencing efficiency test
After the device for the brown orange aphid in the third embodiment is cultured in the incubator for 36 hours, the experimental group treated by the dsRNA solution of the brown orange aphid Hunchback gene and the brown orange aphid of the control group treated by the GFP dsRNA solution are collected, after RNA is extracted by using TriZol method, the corresponding cDNA is obtained by reverse transcription with Perfect real time RTreagent, the reverse transcription system is 20 μ l, and the system comprises: mu.l of total RNA (ca. 1. Mu.g), 4. Mu.l of 5 XPrimeScript Buffer, 1. Mu.l of PrimeScriptRT Enzyme Mix I, 1. Mu.l of Oligo dT Primer (50. Mu.M), 1. Mu.l of Random 6mers (100. Mu.M), RNase Free ddH 2 O12. Mu.l. The reaction conditions are as follows: 15min at 37 ℃ and 5s at 85 ℃.
And detecting the relative expression quantity of the Hunchback gene in an experimental group and a control group by utilizing a qRT-PCR technology. The upstream and downstream primers of the experiment group in qPCR are respectively Hunchback L and Hunchback R, the upstream and downstream primers of the control group are GFP-ds-F and GFP-ds-R, and the primer sequences are as follows:
hunchback L: GTCCTCCGGCAAAACAAGAAG, as shown in SEQ ID NO 9;
hunchback R: CCGAGGTTGGGGTAAGAGACA, as shown in SEQ ID NO. 10;
GFP-ds-F: CAGTTCTTGTTGAATTAGATG as shown in SEQ ID NO. 11;
GFP-ds-R: TTTGGTTTGTCTCCCATGATG as shown in SEQ ID NO. 12.
The qRT-PCR reaction conditions were: pre-denaturation at 95 ℃ for 2min; denaturation at 95 ℃ for 30s and annealing at 60 ℃ for 30s for 40 cycles. The PCR reaction system was 20. Mu.l, and included: cDNA template 1. Mu.l (250 ng), upstream and downstream qPCR primers 1. Mu.l each, enucleated enzyme water 7. Mu.l and fluorescent dye
qPCRMastermix 10. Mu.l. And (3) selecting EF1A gene and BACT gene of the brown orange aphid as reference genes to carry out relative quantitative analysis, wherein the analysis method adopts a qBase method which is customary internationally. qPCR primer sequences of internal reference genes EF1A and BACT:
EF1A-S GATGCACCTGGTCACACAGAGA as shown in SEQ ID NO. 13;
EF1A-A CCATCTTGTTCACCAACG, as shown in SEQ ID NO 14.
BACT-S TCCTTCGTCTCGATCTTGCT, shown in SEQ ID NO. 15;
BACT-A TGTCCATCAGGCAATTCGTA as shown in SEQ ID NO 16.
The results are shown in fig. 5, the relative expression level of the hunthback gene of the brown orange aphid in the experimental group fed with the corresponding dsRNA is significantly reduced compared with the control Group (GFP), and the reduction is as high as about 98%. The experimental result shows that dsRNA can be effectively introduced by dropping dsRNA on the orange aphid with the method of the invention, thereby achieving the effect of RNA interference.
Sequence listing
<110> university of southwest
<120> brown orange aphid Hunchback gene, dsRNA, synthetic method and novel aphid RNAi method
<160> 16
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Hunchback-A
<400> 1
tgcgactacaagtgcgtgag 20
<210>2
<211> 18
<212> DNA
<213> Artificial sequence
<223> Hunchback-S
<400> 2
gccgaggttgggtaagag 18
<210>3
<211> 406
<212> DNA
<213> Artificial sequence
<223> brown orange aphid Hunchback gene
<400> 3
gtatttcaattccagtgttacgactgcgggtacgcgtccaaatacatgcacagcctcaag 120
cagcacttgaagaagcgcgaccaccggccggccacgccgctcaacccggacggcactccg 180
aacccggacatcgtcatcgacgtggtaggcaaccgacgaggtcctcggcaaaacaagaag 240
cagaaccgccacaacccgtatcagcaacagcaccagcaacagccgcagcagactgtttgc 300
tcgtcgcaagacgacggcggcagcagcagtggcggacatccgtcgccgtactctatgcaa 360
cagctgttgcaaatgccgtcttcaaatgtctcttacccaacctcgg 406
<210>4
<211> 39
<212> DNA
<213> Artificial sequence
<223> T7-Hunchback-S
<400> 4
taatacgactcactatagggtgcgactacaagtgcgtga 39
<210>5
<211> 40
<212> DNA
<213> Artificial sequence
<223> T7-Hunchback-A
<400> 5
taatacgactcactatagggatagagtacggcgacggatg 40
<210>6
<211> 356
<212> DNA
<213> Artificial sequence
<223> dsRNA of brown orange aphid Hunchback gene
<400> 6
gtatttcaattccagtgttacgactgcgggtacgcgtccaaatacatgcacagcctcaag 120
cagcacttgaagaagcgcgaccaccggccggccacgccgctcaacccggacggcactccg 180
aacccggacatcgtcatcgacgtggtaggcaaccgacgaggtcctcggcaaaacaagaag 240
cagaaccgccacaacccgtatcagcaacagcaccagcaacagccgcagcagactgtttgc 300
tcgtcgcaagacgacggcggcagcagcagtggcggacatccgtcgccgtactctat 356
<210>7
<211> 41
<212> DNA
<213> Artificial sequence
<223> GFP-ds-T7F
<400> 7
taatacgactcactatagggcagttcttgttgaattagatg 41
<210>8
<211> 41
<212> DNA
<213> Artificial sequence
<223> GFP-ds-T7R
<400> 8
taatacgactcactatagggtttggtttgtctcccatgatg 41
<210>9
<211> 20
<212> DNA
<213> Artificial sequence
<223> Hunchback L
<400> 9
gtcctcggcaaaacaagaag 20
<210>10
<211> 20
<212> DNA
<213> Artificial sequence
<223> Hunchback R
<400> 10
ccgaggttgggtaagagaca 20
<210>11
<211> 21
<212> DNA
<213> Artificial sequence
<223> GFP-ds-F
<400> 11
cagttcttgttgaattagatg 21
<210>12
<211> 21
<212> DNA
<213> Artificial sequence
<223> GFP-ds-R
<400> 12
tttggtttgtctcccatgatg 21
<210>13
<211> 20
<212> DNA
<213> Artificial sequence
<223> EF1A-S
<400> 13
gatgcacctggtcacagaga 20
<210>14
<211> 20
<212> DNA
<213> Artificial sequence
<223> EF1A-A
<400> 14
ccatcttgttcacaccaacg 20
<210>15
<211> 20
<212> DNA
<213> Artificial sequence
<223> BACT-S
<400> 15
tccttcgtctcgatcttgct 20
<210>16
<211> 20
<212> DNA
<213> Artificial sequence
<223> BACT-A
<400> 16
tgtccatcaggcaattcgta 20
Claims (4)
1. An aphid RNAi method, comprising the steps of: fixing the back of the brown orange aphid upwards, sucking a dsRNA solution of a Hunchback gene of the brown orange aphid by using a micropipettor, dripping the dsRNA on the back of the abdomen of the brown orange aphid, and putting the brown orange aphid into an incubator for feeding after the dsRNA solution is fully absorbed to the body surface and dried; the dsRNA sequence of the Hunchback gene of the brown orange aphid is shown as SEQ ID NO. 6.
2. The aphid RNAi method of claim 1, wherein the dsRNA of the brown citrus aphid Hunchback gene is synthesized by the steps of: extracting total RNA of the brown orange aphid, carrying out reverse transcription to form cDNA serving as an amplification template, carrying out PCR amplification by using an upstream primer with a sequence of SEQ ID NO. 4 and a downstream primer with a sequence of SEQ ID NO. 5, carrying out electrophoresis on a PCR amplification product, recovering the product, and synthesizing by using a gel recovery product as a template to obtain dsRNA of the brown orange aphid Hunchback gene.
3. An aphid RNAi method according to claim 2, wherein 25 μ l of PCR reaction is used for PCR amplification comprising: mu.l of cDNA template with the concentration of 800-1200 ng/mu.l, 1 mu.l of each of the upstream and downstream primers with the concentration of 0.15-0.25 mu.M, 12.5 mu.l of PrimeSTAR Max Premix and 10 mu.l of denuclease enzyme water.
4. An aphid RNAi method as claimed in claim 2 or 3, wherein the PCR reaction conditions are: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 2min for 35 cycles; extension is carried out for 10min at 72 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910159330.8A CN109750044B (en) | 2019-03-04 | 2019-03-04 | Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910159330.8A CN109750044B (en) | 2019-03-04 | 2019-03-04 | Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109750044A CN109750044A (en) | 2019-05-14 |
| CN109750044B true CN109750044B (en) | 2023-01-24 |
Family
ID=66407916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910159330.8A Active CN109750044B (en) | 2019-03-04 | 2019-03-04 | Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109750044B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441575A (en) * | 2016-01-12 | 2016-03-30 | 西南大学 | Gene function identification method for toxoptera citricida |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9580709B2 (en) * | 2014-08-22 | 2017-02-28 | The United States Of America, As Represented By The Secretary Of Agriculture | Double stranded RNA constructs for aphid control |
-
2019
- 2019-03-04 CN CN201910159330.8A patent/CN109750044B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441575A (en) * | 2016-01-12 | 2016-03-30 | 西南大学 | Gene function identification method for toxoptera citricida |
Non-Patent Citations (4)
| Title |
|---|
| Feeding-Based RNA Intereference of a Gap Gene Is Lethal to the Pea Aphid, Acyrthosiphon pisum;Jianjun Mao等;《PLOS ONE》;20121107;第7卷(第11期);第5页右栏第3段 * |
| NCBI.XM_027996016.1.《GenBank》.2019,第1-2页. * |
| XM_027996016.1;NCBI;《GenBank》;20190206;第1-2页 * |
| 利用RNAi技术沉默麦长管蚜与桃蚜细胞色素P450;王晖等;《中国农业科学》;20121231;第45卷(第17期);3463-3472页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109750044A (en) | 2019-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rani et al. | A primate lncRNA mediates notch signaling during neuronal development by sequestering miRNA | |
| Willmann et al. | MicroRNAs regulate the timing of embryo maturation in Arabidopsis | |
| Probst et al. | A strand-specific burst in transcription of pericentric satellites is required for chromocenter formation and early mouse development | |
| CN107012174A (en) | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained | |
| CN108796086B (en) | Annular RNAcircBCBM1 and non-diagnostic fluorescent quantitative detection method thereof | |
| Chow et al. | Small RNA-mediated DNA methylation during plant reproduction | |
| CN105420255B (en) | Brown tangerine aphid chitin synthetase gene and its dsRNA | |
| CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
| CN109750044B (en) | Brown orange aphid Hunchback gene, dsRNA, synthesis method and novel aphid RNAi method | |
| CN104651499B (en) | The method for carrying out gene function verification for panonychus citri | |
| CN101932708A (en) | Improved gene silencing methods | |
| CN105441575B (en) | Method for verifying gene function of brown orange aphid | |
| CN112063602B (en) | Asian locusta migratoria small G protein Ras and coding gene and application thereof | |
| CN108949769B (en) | Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof | |
| CN110066799A (en) | Target dsRNA and the application of Tetranychus cinnabarinus molting hormone acceptor gene EcR | |
| CN109468328B (en) | Laodelphax striatellus lethal gene fragment Ribosomal protein L19 and application thereof | |
| CN109295064B (en) | Laodelphax striatellus lethal gene fragment and application thereof | |
| CN108998454B (en) | Chrysanthemum nankingense aphid resistance-related miRNA160a and application thereof | |
| CN110106172B (en) | Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants | |
| CN114921477B (en) | Brown orange aphid carotenoid oxygenase gene and dsRNA thereof | |
| CN111926018A (en) | Application of substance for reducing USP1 expression in preparation of medicine for treating children T-line acute lymphoblastic leukemia | |
| CN117089547B (en) | Application of dsRNA in preventing and controlling cyantraniliprole-resistant bemisia tabaci | |
| CN112779256B (en) | dsRNA (double-stranded ribonucleic acid) fragment of brown planthopper prevention and control gene Nach-like based on gene silencing and application of dsRNA fragment | |
| CN115678903B (en) | Sogatella furcifera Ago1 gene, method for synthesizing dsRNA and application thereof | |
| CN109652443B (en) | Artificial microRNA interference vector and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |