CN109748964B

CN109748964B - CD317 single-chain antibody 317scFv, coding sequence thereof, preparation method and application

Info

Publication number: CN109748964B
Application number: CN201711057847.3A
Authority: CN
Inventors: 万晓春; 李欣; 章桂忠; 李俊鑫; 刘绿艳
Original assignee: Shenzhen Bindebio Technology Co ltd
Current assignee: Shenzhen Bindebio Technology Co ltd
Priority date: 2017-11-01
Filing date: 2017-11-01
Publication date: 2020-11-17
Anticipated expiration: 2037-11-01
Also published as: CN109748964A

Abstract

The invention provides a CD317 single-chain antibody 317scFv, a coding sequence, a preparation method and application thereof, wherein the single-chain antibody 317scFv does not depend on ADCC, directly acts on tumor cells to inhibit the growth of the tumor cells, can be used in combination with radiotherapy, chemotherapy and the like, does not contain an Fc segment, and has small molecular weight and better penetration effect.

Description

CD317 single-chain antibody 317scFv, coding sequence thereof, preparation method and application

Technical Field

The invention relates to the technical field of tumor treatment, in particular to a CD317 single-chain antibody 317scFv, a coding sequence thereof, a preparation method and application.

Background

The treatment of tumors, particularly solid tumors, is a worldwide problem, the conventional treatment methods adopted clinically at present, such as operation, radiotherapy and chemotherapy, cannot completely remove or completely kill tumor cells, and tumor metastasis or recurrence sometimes occurs, so that the clinical effect is poor; in addition, the specificity of the conventional radiotherapy/chemotherapy is extremely poor, the tumor cells are killed and the normal cells are greatly damaged, the adverse reaction is serious, and cancer patients are forced to stop receiving the treatment because the cancer patients cannot tolerate the cancer cells; on the other hand, radiotherapy and chemotherapy are particularly easy to damage the immune system which is important in the anti-tumor mechanism, often cause the immune escape of residual tumor cells, and cause malignant transformation such as relapse, metastasis and the like. The limitations of three major conventional tumor treatment methods have prompted people to find new treatment means, and immunotherapy of tumors gradually emerges due to the characteristics of safety, effectiveness, low adverse reaction and the like, and becomes a fourth mode of tumor treatment after operations, radiotherapy and chemotherapy (department of editorial Chinese tumors, review of research on tumor biological treatment topic [ J ]. Chinese tumors, 2011,20(2): 80-81). Especially, small molecule single chain antibody immunotherapy produced by using genetic engineering technology has become a new hotspot for tumor therapy due to higher safety and effectiveness.

Human monoclonal antibody anti-bis-sialoganglioside immunocytokine hu14.18-IL2 has been used to treat recurrent or refractory neuroblastoma (Alderson K, Sondel p. clinical cancer therapy by NK cells via antibody-dependent cell-mediated cytotoxicity [ J ]. J Biomed Biotechnol,2011,2011: 379123); rituximab (a chimeric anti-CD 20 monoclonal antibody) for the treatment of relapsed or refractory low-grade malignant or follicular non-hodgkin lymphoma; herceptin (a monoclonal antibody that binds to the proto-oncogene product HER 2/neu) for use in the treatment of metastatic breast cancer (Hamilton E, Blackwell K, Hobeika AC, et al phase i clinical trial of HER2-specific immunological therapy with comomatant HER2kinase inhibition [ J ]. J fransnal Med,2012,10: 28); and a humanized anti-CD 33 antibody conjugated with the cytotoxic antibiotic Calichemicin, for the treatment of acute myeloid leukemia and the like.

A key limiting factor in antibody-based tumor immunotherapy is target selection. Antibodies of different targets have different effects and indications, and therefore, antibodies of each target have unique meanings.

CD317, also known as BST-2, HM1.24 or Tetherin, is a targeted antigen for myeloma immunotherapy (Ohtomo, T., et al, Molecular cloning and characterization of a surface anti-expressed on multiple myeloma cells Biochem Biophys Res Commun,1999.258(3): p.583-91; Rew, S.B., et al, Generation of a patent antibody CTL from multiple genes with multiple myeloma direct imaging HM1.24.clinical Cancer Research,2005.11(9): p.3377-3384). CD317 has been found to be an upregulated expression of CD317 In multiple myeloma, B lymphoma, lung carcinoma, squamous cell carcinoma of The head and neck, endometrial carcinoma, brain Cancer, and metastatic breast Cancer (Wang, W., et al, Cancer and humanized anti-HM1.24antisense antibodies, 2009.63(1) p.23-31.; Schlemn, C., et al, In vivo biological diagnosis of The variable In B-cell antigens BST-2a target for antibody-based therapy, blood,2010.115(3): p.63744; tissue D.736, tissue D.21, 7. and 446. for tumor therapy, and The like, and it is suggested that antigens of interest, Cancer, tissue antigen, tissue.

At present, a plurality of experts in the field of cancer are developing research on anti-tumor therapy targeting CD317, and primary results are obtained on a cell level and a mouse model. Studies have shown that CD 317-specific CTL cells have significant inhibitory effect on myeloma, while CD317monoclonal antibodies can also inhibit development of multiple myeloma, renal cell renal carcinoma, endometrial carcinoma, etc. by ADCC effect (Kawai, S., et al, Interferon-alpha enzymes CD317expression and the inhibitor activity of anti-CD317monoclonal antibody in secondary cell bacterial model, Cancer Science,2008.99(12) p.2461-2466.; Yokoyama, T., et al, plasmid membrane proteins antibody 2as a potential thermal target in vivo biological sample, reactor, Cancer Journal of Cancer,2013.132(2 p. 2. p. -mark 2. a. biological sample, 2. c. ideal, 3. a. biological sample, 2. p. -cell, 2. c., 3. a. c., 3. and 2. 3. A. biological sample, 2. 3. A. and 3. A. biological sample, 2. A. 3. A. a. biological sample, 2. a. biological sample, 2. a. biological sample, 3. a.

The existing anti-tumor mechanism of the antibody targeting CD317 plays a role in antibody-dependent cell-mediated cytotoxicity (ADCC), but a large amount of immune cells of tumor patients, particularly tumor patients after undergoing chemotherapy, die, so the ADCC effect is greatly reduced and cannot be used together with chemoradiotherapy. In addition, the traditional antibody has large molecular weight and poor penetrability, and is difficult to enrich enough antibody concentration in the tumor in the process of treating solid tumor, so the treatment effect on the solid tumor is limited.

Disclosure of Invention

According to a first aspect, in one embodiment there is provided a CD317 single chain antibody 317scFv whose coding sequence comprises the amino acid sequence as set forth in SEQ ID NO: 9, or a coding sequence thereof comprises a nucleotide sequence identical to SEQ ID NO: 9 nucleotide sequences encoding the same amino acid sequence; the CD317 single-chain antibody 317scFv described above does not contain an Fc fragment.

According to a second aspect, one embodiment provides a nucleotide sequence encoding a CD317 single chain antibody 317scFv comprising the amino acid sequence set forth in SEQ ID NO: 9, or a sequence corresponding to SEQ ID NO: 9 encode a sequence of the same amino acid sequence.

According to a third aspect, one embodiment provides a method for preparing a CD317 single chain antibody 317scFv, comprising:

(1) preparing a recombinant expression vector of a CD317 single-chain antibody 317scFv, wherein the recombinant expression vector comprises a sequence shown as SEQ ID NO: 9, or a nucleotide sequence corresponding to SEQ ID NO: 9 nucleotide sequences encoding the same amino acid sequence;

(2) the recombinant expression vector is transferred into a host cell to express the CD317 single-chain antibody 317 scFv.

Further, the above expression vector is a eukaryotic expression vector.

Further, the eukaryotic expression vector is pcDNA3.1 (+).

Further, the host cell is a eukaryotic cell.

Further, the above eukaryotic cell is a HEK293F cell.

Further, the above nucleotide sequence is obtained by reverse transcription and amplification using RNA extracted from hybridoma cells as a template by a heavy chain and light chain degenerate primer set of an antibody.

Further, the degenerate primer set comprises the nucleotide sequence as set forth in SEQ ID NO: 1-8.

According to a fourth aspect, there is provided in one embodiment a CD317 single chain antibody 317scFv of the first aspect or a nucleotide sequence of the second aspect for use in the preparation of a medicament for the treatment and/or prevention of a tumour.

The invention recombines the heavy chain variable region gene and the light chain variable region gene of the coded CD317 antibody to a eukaryotic expression vector for expression by means of genetic engineering, and the prepared single-chain antibody 317scFv is not limited by animal strains and antibody types, thereby reducing potential epitope and enhancing the curative effect of the antibody. The antibody prepared by the traditional method can only treat one type of tumor generally, but the single-chain antibody 317scFv can effectively inhibit the growth of a series of tumor cells with high expression of CD317, so the anti-tumor clinical application of the antibody is wider. Compared with other CD317 antibodies, the small fragment antibody of the invention does not depend on ADCC to function, possibly has better curative effect on patients with poor immunity after radiotherapy and chemotherapy, and can also be used together with methods such as radiotherapy and chemotherapy. In addition, the small fragment antibody has small molecular weight and better penetrating effect on solid tumors.

Drawings

FIG. 1 shows PCR amplification products of the variable region genes of the heavy and light chains of the scFv of the single chain antibody 317.

FIG. 2 shows a schematic diagram of the structure of a fragment of the synthetic sequence of the single chain antibody 317 scFv.

FIG. 3 shows the sequencing result of the 317scFv expression sequence in the pcDNA3.1(+) -317 scFv recombinant plasmid, in which the arrow indicates the initiation codon ATG.

FIG. 4 shows the expression of the Dot Blot detection single-chain antibody 317scFv in eukaryotic cells.

FIG. 5 shows that single chain antibody 317scFv inhibits the growth of various tumor cells.

FIG. 6 shows the killing experiment of the single chain antibody 317scFv on tumor cells.

Detailed Description

The present invention will be described in further detail with reference to the following detailed description and accompanying drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, those skilled in the art will readily recognize that some of the features may be omitted or replaced with other elements, materials, methods in different instances. In some instances, certain operations related to the present invention have not been shown or described in the specification in order to avoid obscuring the present invention from the excessive description, and it is not necessary for those skilled in the art to describe these operations in detail, so that they can be fully understood from the description in the specification and the general knowledge in the art.

Aiming at the limitations of the existing tumor treatment means, particularly the limitations of a targeted CD317 anti-tumor strategy, the invention obtains the variable region sequences of the heavy chain and the light chain of a CD317 antibody from a hybridoma cell strain (1C12C6) through PCR amplification by utilizing a mouse antibody degenerate primer group, constructs an expression vector pcDNA3.1(+) -317 scFv, and expresses the pcDNA3.1(+) -317 scFv in a mammalian cell HEK 293F. The invention prepares the single-chain antibody 317scFv for the first time, and finds that the single-chain antibody 317scFv can inhibit the growth of various tumor cells in vitro through detecting the activity of the single-chain antibody 317 scFv.

The technical solutions of the present invention are described in detail by the following embodiments, and it should be understood that the embodiments are only exemplary and should not be construed as limiting the scope of the present invention.

Example 1 PCR amplification, cloning identification of the 317scFv Gene of Single chain antibody, and construction of an expression vector

(1) PCR amplification of the single chain antibody 317scFv gene: collecting hybridoma cell strain (1C12C6), and extracting cell RNA, which comprises the following steps:

first, the treated cells were removed from the medium, and 1mL of Trizol was added to lyse the cells.

② adding the cells dissolved by Trizol into an EP tube, adding 200. mu.L chloroform, mixing uniformly, then centrifuging at 12000rpm for 15min at 4 ℃.

③ sucking 500 mu L of supernatant, adding 500 mu L of precooled isopropanol, mixing uniformly, then centrifuging at 12000rpm for 15min at 4 ℃.

Fourthly, removing the supernatant, washing the precipitate with 75 percent ethanol, and centrifuging for 8min at 12000rpm and 4 ℃.

Fifthly, on an ultra-clean bench, after drying and precipitating, adding 20 mu L of DEPC water.

Sixthly, detecting the concentration and the purity of the RNA.

The cDNA was reverse-transcribed into cDNA using a reverse transcription kit, and the degenerate primer sets (sequences shown in Table 1 below) for the heavy chain and the light chain of the antibody synthesized by EnxWeiji corporation were used as templates to amplify the respective PCR reactions. The PCR conditions were: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and circulation for 35 times, and extension at 72 ℃ for 5min to 10 ℃. As shown in FIG. 1, the length of the amplified product fragment 317scFv heavy chain (H chain) and light chain (L chain) DNA was about 300 bp.

TABLE 1 degenerate primer sets for heavy and light chains of antibodies

(2) T cloning and identification: the heavy and light chain PCR products were recovered separately and ligated with pMD19T (TAKARA), transferred to Trans5 α competent bacteria by heat shock method, and screened on ampicillin resistant plates. At least 10 positive colonies were picked, expanded and plasmid extracted, and sequenced. The sequencing results were aligned in the IMGT database (http:// www.imgt.org/IMGT _ vquest/share/textes/imgtvquest. html) and the antibody sequence with the highest frequency of occurrence was selected. Between the heavy chain (VH) and the light chain (VL) by (G)₄S)₃The connecting sequences are connected to form a 317scFv expression sequence, and the sequence is shown as the following SEQ ID NO: 9, the structure of the synthetic sequence is schematically shown in FIG. 2.

317scFv sequence:

atgggctggtcctgcatcatcctgttcctggtggccaccgccaccggcgaggtgcagctggtggagtctgggggaggcttagtgcagc ctggagggtccctgaaactctcctgtgcagcctctggattcactttcagtagttatggcatgtcttgggttcgccagactccagacaagaggctgg agtgggtcgcaaccattaatagtaatggtgctaacacctattatccagacagtgtgaagggccgattcaccatctccagagacaatgccaagaac accctgtacctgcaaatgagcagtctgaagtctgaggacacagccatgtattactgtgcaaggatctatgatgcttactcctcctggtttacttactg gggtgaaggaacttttgtcacagtcaatctcggtggcggtggctcgggcggtggtgggtcgggtggcggcggatctgatattgttctgacacag actacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagtgcaagtcaggggattaaaaattatttaaactggtatcagcaga aaccagatggaactgttaaactcctgatctattacacatcaagtttacactcaggagtcccatcaaggttcagtggcagtgggtctgggacagatta ttctctcaccatcagcaacctggaacctgaagatattgccacttactattgtcagcagtatagtaagcttccgtacacgttcggcgcaggcacaaaa ttggaaatcaatgattacaaggatgacgacgataagcaccaccaccaccaccactga(SEQ ID NO：9)。

(3) construction and characterization of pcDNA3.1(+) -317 scFv expression vector: carrying out double enzyme digestion on pMD19t-317 scFv and pcDNA3.1(+) plasmid respectively by using EcoRI and XholI, and respectively recovering 317scFv and linearized pcDNA3.1(+) vector fragments; the 317scFv is connected with a linearization vector pcDNA3.1(+), transferred into a Trans5 alpha competent bacterium, and positive clones are picked for enzyme digestion and sequencing identification, and the sequencing result of the 317scFv expression sequence in the pcDNA3.1(+) -317 scFv recombinant plasmid is shown in figure 3, wherein an arrow indicates an initiation codon ATG.

Example 2 expression of the Single chain antibody 317scFv in eukaryotic cells HEK293F

(1) Expression of the single chain antibody 317scFv in eukaryotic HEK 293F: the pcDNA3.1(+) control plasmid and the pcDNA3.1(+) -317 scFv recombinant plasmid were transfected into eukaryotic HEK293F in 8% CO respectively by using PEI25000 transfection reagent₂Shake culturing at 37 deg.C (120rpm) for 72 h; the cell expression supernatant was collected, centrifuged at 3000g for 5min, carefully aspirated, and filtered through a 0.45 μm filter.

(2) 317scFv expression is detected by Dot Blot: 50 μ L of cell expression supernatant of the control group and pcDNA3.1(+) -317 scFv group collected in the step (1) above was uniformly dropped on the PVDF membrane activated with anhydrous methanol, 5% skimmed milk powder was sealed at room temperature for 1 hour, HRP-containing anti-His tag antibody (dilution concentration: 5000) from Sigma was added, and the membrane was incubated at room temperature for 45min, washed with PBST for 3 times, 6min each time, and developed with ECL, and the results of observation were shown in FIG. 4.

EXAMPLE 3 Effect of the single chain antibody 317scFv on inhibiting tumor cell growth

(1) Effect of the single chain antibody 317scFv in inhibiting tumor cell growth: hepatoma cell line Hep G2 and breast cancer cell line MCF-7 (TC 20)^TMAutomated Cell Counter), at 1 × 10 per well⁵Inoculating each cell in a 12-well plate; cervical cancer cell line Hela with 2 x 10 per hole⁵Inoculating each cell in a 12-well plate; after overnight, 500. mu.L of DMEM medium was removed from each well, and 500. mu.L of the supernatant of the expression of sterile HEK293F collected in example 2 (pcDNA3.1(+) control, Ctrl for short) or pcDNA3.1(+) -317 scFv (317 scFv for short) was added thereto, and gently mixed and then mixed with 5% CO₂After the constant-temperature incubator at 37 ℃ is continuously cultured for 48 hours (each experimental group is respectively provided with 3 multiple holes), photographing is carried out under a microscope, and cell counting is collected (TC 20)^TMAutomated Cell Counter) results are shown in fig. 5, indicating that single chain antibody 317scFv inhibits tumor Cell growth.

(2) The single chain antibody 317scFv inhibits tumor cell activity: after strictly counting the cells of the cervical cancer cell line Hela, the cells are inoculated into a 96-well plate, 200 mu L of culture medium is added into each well, and the volume is 1 multiplied by 10⁴After each cell, adding different volumes (0 mu L, 5 mu L, 10 mu L,20 mu L, 50 mu L, 100 mu L) of single-chain antibody 317scFv supernatant respectively after overnight, continuously culturing for 48h (5 multiple wells are set for each concentration), adding 10 mu L of MTT working solution into each well after 48h, incubating for 2h in a 37 ℃ incubator, and detecting OD (optical Density) on a microplate reader₄₉₀The results are shown in FIG. 6, which shows that the single-chain antibody 317scFv inhibits tumor cell activity, and that the inhibitory ability increases with increasing concentration.

The present invention has been described in terms of specific examples, which are provided to aid understanding of the invention and are not intended to be limiting. For a person skilled in the art to which the invention pertains, several simple deductions, modifications or substitutions may be made according to the idea of the invention. For example, the assembly of the single-chain antibody 317scFv is not limited to the VH-VL linkage disclosed in the present invention, and other modifications such as simply modifying the linkage fragment, mutating individual amino acids, or changing to VL-VH are also within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> CD317 single-chain antibody 317scFv, coding sequence thereof, preparation method and application

<130> 17I25047

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 14

<212> DNA

<213> Artificial sequence

<400> 1

gaggtgmwgc ttrt 14

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

gaggtgmwgc tkvwgsagtc tgga 24

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence

<400> 3

gacdgtgash gwrgtyc 17

<210> 4

<211> 27

<212> DNA

<213> Artificial sequence

<400> 4

gacdgtgash rdrgtbcctk srcccca 27

<210> 5

<211> 14

<212> DNA

<213> Artificial sequence

<400> 5

gahrtygtkm tsac 14

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

gahrtygtkm tsacmcarwc tmca 24

<210> 7

<211> 15

<212> DNA

<213> Artificial sequence

<400> 7

katytccary ytkgt 15

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence

<400> 8

katytccary ytkgtscchb cdccgaa 27

<210> 9

<211> 819

<212> DNA

<213> Artificial sequence

<400> 9

atgggctggt cctgcatcat cctgttcctg gtggccaccg ccaccggcga ggtgcagctg 60

gtggagtctg ggggaggctt agtgcagcct ggagggtccc tgaaactctc ctgtgcagcc 120

tctggattca ctttcagtag ttatggcatg tcttgggttc gccagactcc agacaagagg 180

ctggagtggg tcgcaaccat taatagtaat ggtgctaaca cctattatcc agacagtgtg 240

aagggccgat tcaccatctc cagagacaat gccaagaaca ccctgtacct gcaaatgagc 300

agtctgaagt ctgaggacac agccatgtat tactgtgcaa ggatctatga tgcttactcc 360

tcctggttta cttactgggg tgaaggaact tttgtcacag tcaatctcgg tggcggtggc 420

tcgggcggtg gtgggtcggg tggcggcgga tctgatattg ttctgacaca gactacatcc 480

tccctgtctg cctctctggg agacagagtc accatcagtt gcagtgcaag tcaggggatt 540

aaaaattatt taaactggta tcagcagaaa ccagatggaa ctgttaaact cctgatctat 600

tacacatcaa gtttacactc aggagtccca tcaaggttca gtggcagtgg gtctgggaca 660

gattattctc tcaccatcag caacctggaa cctgaagata ttgccactta ctattgtcag 720

cagtatagta agcttccgta cacgttcggc gcaggcacaa aattggaaat caatgattac 780

aaggatgacg acgataagca ccaccaccac caccactga 819

Claims

1. A CD317 single chain antibody 317scFv, encoding the amino acid sequence set forth in SEQ ID NO: 9, or the coding sequence thereof is the nucleotide sequence shown in SEQ ID NO: 9 nucleotide sequences encoding the same amino acid sequence; the CD317 single-chain antibody 317scFv does not contain an Fc segment.

2. A gene encoding a CD317 single-chain antibody 317scFv, wherein the encoding gene is SEQ ID NO: 9, or a variant of SEQ ID NO: 9 encoding the same amino acid sequence.

3. A method for producing a CD317 single chain antibody 317scFv, the method comprising:

(1) a recombinant expression vector for producing a CD317 single chain antibody 317scFv, the recombinant expression vector comprising the amino acid sequence set forth in SEQ ID NO: 9, or a nucleotide sequence corresponding to SEQ ID NO: 9 nucleotide sequences encoding the same amino acid sequence;

(2) transferring the recombinant expression vector into a host cell to express the CD317 single-chain antibody 317 scFv.

4. The method of claim 3, wherein the expression vector is a eukaryotic expression vector.

5. The method according to claim 4, wherein the eukaryotic expression vector is pcDNA3.1 (+).

6. The method of claim 3, wherein the host cell is a eukaryotic cell.

7. The method of claim 6, wherein the eukaryotic cell is a HEK293F cell.

8. Use of the CD317 single-chain antibody 317scFv of claim 1 or the encoding gene of claim 2 for the preparation of a medicament for the treatment and/or prevention of a tumor.