CN109748964A - CD317 single-chain antibody 317scFv, its coded sequence and preparation method and application - Google Patents

Abstract

The present invention provides a kind of 317 scFv of CD317 single-chain antibody, its coded sequence and preparation method and application, 317 scFv of the single-chain antibody is independent of ADCC, directly act on its growth of inhibiting tumour cells, it can be used in combination with chemicotherapy etc., it is free of Fc sections, molecular weight is small, and it is also more preferable to penetrate effect.

Description

CD317 single-chain antibody 317scFv, its coded sequence and preparation method and application

Technical field

The present invention relates to oncotherapy technical fields, and in particular to 317 scFv of CD317 single-chain antibody, its coded sequence and Preparation method and application.

Background technique

Tumour especially treatment of solid tumors is a global problem, now the clinical conventional treatments such as hand used Art, radiotherapy, chemotherapy can not all cut off completely or thoroughly kill tumour cell, and metastases or recurrence happen occasionally, clinical effectiveness Difference；In addition, it is conventional put/specificity of chemotherapy is very poor, very big damage is also brought to normal cell while killing tumor cell Wound, there is more serious adverse reaction, and cancer patient Chang Yin is not resistant to and is forced to stop receiving treatment；Another aspect chemicotherapy is outstanding It is easy to damage the immune system that critical role is accounted in antitumor mechanism, often leads to the immunologic escape of remaining tumor cells, Lead to the malignant transformations such as Preventive.The limitation of the big conventional treatments of tumour three promotes people to look for new treatment hand Section, the immunization therapy of tumour because of it safely, effectively, the features such as adverse reaction is low gradually show one's talent, become after operation, radiotherapy, The 4th kind of mode (Chinese tumour editorial office comment tumor biotherapy research special topic [J] China of oncotherapy after chemotherapy Tumour, 2011,20 (2): 80-81).Especially with technique for gene engineering production the immunization therapy of small molecule single-chain antibody because Its safety with higher and validity have become the new hot spot of oncotherapy.

The immune cell factor hu14.18-IL2 of the existing anti-bifunctional sialyltransferase ganglioside of human monoclonal antibody is used at present In neuroblastoma (Alderson K, the Sondel P.Clinical cancer therapy by for the treatment of relapsed or stubborn NK cells via antibody-dependent cell-mediated cytotoxicity[J].J Biomed Biotechnol,2011,2011:379123)；Mabthera (a kind of anti-CD-20 monoclonal antibody of mosaic type), it is multiple for treating Hair or refractory low potential malignancy or follicular non-Hodgkin lymphoma；A kind of Trastuzumab (and Oncoprotein HER2/ Neu combine monoclonal antibody), for treat metastatic breast cancer (Hamilton E, Blackwell K, Hobeika AC, et al.PhaseⅠclinical trial of HER2-specific immunotherapy with concomitant HER2kinase inhibition[J].J Transl Med,2012,10:28)；And cytotoxic antibiotics 3 antibody of Humanized CD 3-resisting that Calicheamicin is combined, for treating acute myeloid leukemia etc..

The critical limiting factor of immunotherapy of tumors based on antibody is that target spot selects.The effect of the antibody of different target spots Different with indication, therefore, the antibody of each target spot has unique meaning.

CD317 also known as BST-2, HM1.24 or Tetherin, be myeloma immunotherapy targeting antigen (Ohtomo, T.,et al.,Molecular cloning and characterization of a surface antigen preferentially overexpressed on multiple myeloma cells.Biochem Biophys Res Commun,1999.258(3):p.583-91；Rew,S.B.,et al.,Generation of potent antitumor CTL from patients with multiple myeloma directed against HM1.24.Clinical Cancer Research,2005.11(9):p.3377-3384.).The study found that CD317 is in Huppert's disease, B lymph Tumor, lung cancer, Head and neck squamous cell carcinoma, carcinoma of endometrium, the cancer of the brain and breast cancer of Bone tumour etc. have CD317 expression up-regulation Phenomenon (Wang, W., et al., Chimeric and humanized anti-HM1.24antibodies mediate antibody-dependent cellular cytotoxicity against lung cancer cells.Lung Cancer,2009.63(1):p. 23-31.；Schliemann,C.,et al.,In vivo biotinylation of the vasculature in B-cell lymphoma identifies BST-2as a target for antibody-based therapy.Blood,2010.115(3):p.736-744.； Wainwright,D.A.,et al.,The expression of BST2in human and experimental mouse brain tumors. Experimental and Molecular Pathology, 2011.91 (1): p.440-446.), it may be a tumor associated antigen and potential for prompting it Immunotherapeutic targets.

There is the expert of many cancer fields carrying out the research of the antineoplaston of targeting CD317 at present, in cellular water Preliminary achievement is achieved on flat, mouse model.Studies have shown that the CTL cell of CD317 specificity has obviously myeloma Inhibiting effect, and CD317 monoclonal antibody can also pass through ADCC effect inhibit Huppert's disease, nephrocyte kidney, son Development (Kawai, S., et al., Interferon-alpha the enhances CD317expression of endometrial carcinoma etc. and the antitumor activity of anti-CD317monoclonal antibody in renal cell carcinoma xenograft models.Cancer Science,2008.99(12):p.2461-2466.；Yokoyama, T.,et al.,Plasma membrane proteomics identifies bone marrow stromal antigen 2as a potential therapeutic target in endometrial cancer. International Journal of Cancer,2013.132(2):p.472-484.；Harada,T.,et al.,Combination with a defucosylated anti-HM1.24monoclonal antibody plus lenalidomide induces marked ADCC against myeloma cells and their progenitors.PLoS One,2013.8(12): p.e83905.)。

The antitumor mechanism of the antibody of existing targeting CD317 is all the cell-mediated cell toxicant by antibody dependent Effect (antibody-dependent cell-mediated cytotoxicity, ADCC) plays a role, but neoplastic disease People, a large amount of immunocytes of tumour patient especially lived through after chemicotherapy are dead, therefore ADCC effect is had a greatly reduced quality, also without Method and chemicotherapy are combined.In addition, traditional antibody molecule amount is larger, penetrability is poor, is difficult during treatment of solid tumors swollen Sufficient concentrations of antibody is enriched with inside tumor, therefore to treatment of solid tumors effect than relatively limited.

Summary of the invention

The present invention provides a kind of 317 scFv of CD317 single-chain antibody, its coded sequence and preparation method and application, this is single-stranded 317 scFv of antibody directly acts on its growth of inhibiting tumour cells independent of ADCC, and can combine with chemicotherapy etc. makes With without Fc sections, molecular weight is small, and it is also more preferable to penetrate effect.

According in a first aspect, providing a kind of 317 scFv of CD317 single-chain antibody in a kind of embodiment, coded sequence includes The nucleotide sequence as shown in SEQ ID NO:9 or its coded sequence include encoding same amino acid sequence with SEQ ID NO:9 Nucleotide sequence；Above-mentioned 317 scFv of CD317 single-chain antibody is free of Fc sections.

According to second aspect, a kind of nucleotides sequence for encoding 317 scFv of CD317 single-chain antibody is provided in a kind of embodiment Column, including the sequence as shown in SEQ ID NO:9, or the sequence with SEQ ID NO:9 coding same amino acid sequence.

According to the third aspect, the preparation method of 317 scFv of CD317 single-chain antibody a kind of is provided in a kind of embodiment, is wrapped It includes:

(1) recombinant expression carrier of 317 scFv of CD317 single-chain antibody is prepared, above-mentioned recombinant expression carrier includes such as SEQ Nucleotide sequence shown in ID NO:9, or the nucleotide sequence with SEQ ID NO:9 coding same amino acid sequence；

(2) above-mentioned recombinant expression carrier is transferred in host cell and gives expression to above-mentioned 317 scFv of CD317 single-chain antibody.

Further, above-mentioned expression vector is carrier for expression of eukaryon.

Further, above-mentioned carrier for expression of eukaryon is pcDNA3.1 (+).

Further, above-mentioned host cell is eukaryocyte.

Further, above-mentioned eukaryocyte is HEK293F cell.

Further, above-mentioned nucleotide sequence is by the heavy chain and light chain degenerate primer group of antibody, with from hybridoma The RNA of middle extraction is obtained as template through reverse transcription and amplification.

Further, above-mentioned degenerate primer group includes the sequence as shown in SEQ ID NO:1-8.

According to fourth aspect, a kind of 317 scFv of CD317 single-chain antibody or of first aspect is provided in a kind of embodiment The nucleotides sequence of two aspects is listed in the application in the drug of preparation treatment and/or pre- preventing tumor.

The present invention will encode weight, the light-chain variable region gene recombination to eukaryon table of CD317 antibody by genetic engineering means It is expressed on up to carrier, 317 scFv of single-chain antibody of preparation is not limited by animal strains and Antibody types, it is possible to reduce Potential epitope enhances the curative effect of antibody.The antibody of conventional method preparation, can only generally treat a type of tumour, And 317 scFv of single-chain antibody of the invention can effectively inhibit a series of growth of the highly expressed tumour cells of CD317, because This its antitumor clinical application will more extensively.Compared with other CD317 antibody, small fragment antibody of the invention independent of ADCC is functioned, and may have better curative effect to the patient of immunity difference after chemicotherapy, also can be the methods of with chemicotherapy It is used in combination.In addition, small fragment antibody molecule amount of the invention is small, has to solid tumor and preferably penetrate effect.

Detailed description of the invention

Fig. 1 shows the pcr amplification product of 317 scFv heavy chain and light-chain variable region gene of single-chain antibody.

Fig. 2 shows 317 scFv composition sequence fragment structure schematic diagrames of single-chain antibody.

Fig. 3 shows 317 scFv expressed sequence sequencing results in -317 scFv recombinant plasmid of pcDNA3.1 (+), wherein Arrow is designated as initiation codon ATG.

Fig. 4 shows expression of Dot Blot detection 317 scFv of single-chain antibody in eukaryocyte.

Fig. 5 shows the growth that 317 scFv of single-chain antibody inhibits kinds of tumor cells.

Fig. 6 shows 317 scFv of single-chain antibody to the killing experiments of tumour cell.

Specific embodiment

Below by specific embodiment combination attached drawing, invention is further described in detail.In the following embodiments and the accompanying drawings In, many datail descriptions are in order to enable the present invention can be better understood.However, those skilled in the art can be without lifting an eyebrow Recognize, part of feature is dispensed in varied situations, or can be by other elements, material, method institute Substitution.In some cases, the relevant some operations of the present invention there is no display in the description or describe, this is to keep away Exempt from core of the invention part to be flooded by excessive description, and to those skilled in the art, these phases are described in detail It closes operation not to be necessary, they can completely understand according to the general technology knowledge of description and this field in specification Relevant operation.

For the limitation of existing oncotherapy means, the limitation of the antitumor strategy of CD317, the present invention are especially targeted Using mouse antibodies degenerate primer group from hybridoma cell strain (1C12C6) by PCR amplification obtain CD317 antibody heavy chain, Light-chain variable sequence, construction of expression vector pcDNA3.1 (+) -317 scFv, and the table in mammalian cell HEK293F It reaches.The present invention has prepared 317 scFv of single-chain antibody for the first time, by finding 317 scFv of single-chain antibody to its active detection It can inhibit the growth of kinds of tumor cells in vitro.

The technical solution that the present invention will be described in detail by the following examples, it should be understood that embodiment is merely exemplary, no It can be interpreted as limiting the scope of the invention.

The building of the PCR amplification, clone identification and expression vector of 1 single-chain antibody of embodiment, 317 scFv gene

(1) PCR amplification of 317 scFv gene of single-chain antibody: collecting hybridoma cell strain (1C12C6), extracts cell RNA, the specific steps are as follows:

1. taking the cell handled well, culture medium is removed, 1mL Trizol is added by cell dissolution.

2. the cell dissolved with Trizol is added in EP pipe, 200 μ L chloroforms, 12000rpm after mixing, 4 DEG C of centrifugations are added 15min。

3. drawing 500 μ L supernatants, the isopropanol of 500 μ L pre-cooling, 12000rpm after mixing, 4 DEG C of centrifugation 15min is added.

4. removing supernatant, sediment, 12000rpm, 4 DEG C of centrifugation 8min are cleaned with 75% ethyl alcohol.

5. on super-clean bench, after drying precipitating, 20 μ L DEPC water are added.

6. detecting RNA concentration and purity.

With reverse transcription reagent box reverse transcription at cDNA, using this cDNA as template, Invitrogen Corp.'s synthetic antibody is utilized Heavy chain and light chain degenerate primer group (sequence is as shown in table 1 below) carry out PCR reaction amplification respectively.PCR condition are as follows: 95 DEG C of pre- changes Property 3min, 95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, recycle 35 times, 72 DEG C of 5min to 10 DEG C of extensions.Such as Fig. 1 Shown, 317 scFv heavy chain of amplified production segment (H chain) and light chain (L chain) DNA length are 300bp or so.

The heavy chain and light chain degenerate primer group of 1 antibody of table

(2) T clone and identification: heavy chain and light chain PCR product is separately recovered and is connect with pMD19T (TAKARA), passes through heat Sharp method is transferred to Trans5 α competent bacteria, is screened on amicillin resistance plate.Each picking at least ten positive bacteria It falls, expands and cultivate and extract plasmid, be sequenced.Sequencing result is in IMGT database (http://www.imgt.org/IMGT_ Vquest/share/textes/imgtvquest.html it) is compared, the highest antibody sequence of the picking frequency of occurrences.Heavy chain (VH) pass through (G between light chain (VL)₄S)₃Catenation sequence is attached, and is spliced into 317 scFv expressed sequences, following SEQ Shown in ID NO:9, composition sequence structural schematic diagram is as shown in Figure 2.

317 scFv sequences:

atgggctggtcctgcatcatcctgttcctggtggccaccgccaccggcgaggtgcagctggtggagtct gggggaggcttagtgcagc ctggagggtccctgaaactctcctgtgcagcctctggattcactttcagtagttatg gcatgtcttgggttcgccagactccagacaagaggctgg agtgggtcgcaaccattaatagtaatggtgctaacac ctattatccagacagtgtgaagggccgattcaccatctccagagacaatgccaagaac accctgtacctgcaaatgagcagtctgaagtctgaggacacagccatgtattactgtgcaaggatctatgatgctta ctcctcctggtttacttactg gggtgaaggaacttttgtcacagtcaatctcggtggcggtggctcgggcggtggt gggtcgggtggcggcggatctgatattgttctgacacag actacatcctccctgtctgcctctctgggagacagag tcaccatcagttgcagtgcaagtcaggggattaaaaattatttaaactggtatcagcaga aaccagatggaactgttaaactcctgatctattacacatcaagtttacactcaggagtcccatcaaggttcagtggc agtgggtctgggacagatta ttctctcaccatcagcaacctggaacctgaagatattgccacttactattgtcagc agtatagtaagcttccgtacacgttcggcgcaggcacaaaa ttggaaatcaatgattacaaggatgacgacgataa Gcaccaccaccaccaccactga (SEQ ID NO:9).

(3) building and identification of -317 scFv expression vector of pcDNA3.1 (+): by pMD19t-317 scFv and PcDNA3.1 (+) plasmid uses EcoR I, I double digestion of Xhol respectively, and 317 scFv are separately recovered and linearisation pcDNA3.1 (+) is carried Body segment；317 scFv and linearized vector pcDNA3.1 (+) are attached, Trans5 α competent bacteria, picking are transferred to Positive colony carries out digestion and sequencing identification, and Fig. 3 shows 317 scFv tables in -317 scFv recombinant plasmid of pcDNA3.1 (+) Up to sequence as a result, wherein arrow is designated as initiation codon ATG.

Expression of 2 single-chain antibody of embodiment, 317 scFv in eukaryocyte HEK293F

(1) expression of 317 scFv of single-chain antibody in eukaryocyte HEK293F: utilize PEI25000 transfection reagent will PcDNA3.1 (+) control plasmid and -317 scFv recombinant plasmid of pcDNA3.1 (+) are transfected into respectively in eukaryocyte HEK293F, In 8%CO₂, 37 DEG C of constant incubator shake culture (120rpm) 72h；It collects cell and expresses supernatant, 3000g is centrifuged 5min, small The heart draws supernatant, 0.45 μm of membrane filtration.

(2) expression of 317 scFv is detected by Dot Blot: respectively taking the control collected in 50 μ L above-mentioned steps (1) The cell of group and pcDNA3.1 (+) -317 scFv group expresses supernatant, and the PVDF activated in anhydrous methanol is equably added dropwise On film, 5% skimmed milk power room temperature closes 1h, be added Sigma company with HRP anti-His tag antibody (diluted concentration 1: 5000) it, is incubated at room temperature 45min, PBST is washed film 3 times, each 6min, ECL colour developing, and observation result is as shown in Figure 4.

The effect of 3 single-chain antibody of embodiment, 317 scFv inhibition growth of tumour cell

(1) 317 scFv of single-chain antibody inhibits the effect of growth of tumour cell: hepatoma cell strain Hep G2, breast cancer cell Strain MCF-7 strictly counts (TC20^TMAutomated Cell Counter) after, with every hole 1 × 10⁵A cell inoculation is in 12 holes Plate；Cervical cancer cell strain Hela is with every hole 2 × 10⁵A cell inoculation is in 12 orifice plates；500 μ L DMEM are removed in every hole after overnight Culture medium, and be added 500 μ L embodiments 2 in collect sterile HEK293F expression supernatant (pcDNA3.1 (+) control group, below Abbreviation Ctrl group) or -317 scFv supernatant of pcDNA3.1 (+) (hereinafter referred to as 317 scFv groups), in 5%CO after mixing gently₂、 37 DEG C of constant incubators continue to take pictures under microscope, and collect cell after culture 48h (3 multiple holes are respectively set in each experimental group) Count (TC20^TMAutomated Cell Counter), as a result as shown in figure 5, showing that 317 scFv of single-chain antibody inhibits tumour Cell growth.

(2) 317 scFv of single-chain antibody inhibits activity of tumor cells: after cervical cancer cell strain Hela cell strictly counts, It is inoculated in 96 orifice plates, every 200 μ L culture medium of hole, 1 × 10⁴A cell is separately added into different volumes (0 μ L, 5 μ L, 10 μ after staying overnight L, 20 μ L, 50 μ L, 100 μ L) single-chain antibody 317 scFv supernatant continue to cultivate 48h (every kind concentration be arranged 5 multiple holes), 48h Every hole is added the MTT working solution of 10 μ L and is incubated for 2h, machine testing OD in microplate reader in 37 DEG C of insulating boxs afterwards₄₉₀, as a result such as Fig. 6 It is shown, show that 317 scFv of single-chain antibody inhibits activity of tumor cells, and increase rejection ability with concentration and also increase.

Use above specific case is illustrated the present invention, is merely used to help understand the present invention, not to limit The system present invention.For those skilled in the art, according to the thought of the present invention, can also make several simple It deduces, deform or replaces.For example, the assembling mode of 317 scFv of single-chain antibody is not limited to the VH-VL connection of present disclosure Mode, other are belonged to by the modification mode for simply modifying junction fragment, being mutated Individual amino acids or being changed to VL-VH etc. In the scope of the present invention.

SEQUENCE LISTING

<110>Shenzhen Institutes of Advanced Technology, Chinese Academy of Science

<120>317 scFv of CD317 single-chain antibody, its coded sequence and preparation method and application

<130> 17I25047

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 14

<212> DNA

<213>artificial sequence

<400> 1

gaggtgmwgc ttrt 14

<210> 2

<211> 24

<212> DNA

<213>artificial sequence

<400> 2

gaggtgmwgc tkvwgsagtc tgga 24

<210> 3

<211> 17

<212> DNA

<213>artificial sequence

<400> 3

gacdgtgash gwrgtyc 17

<210> 4

<211> 27

<212> DNA

<213>artificial sequence

<400> 4

gacdgtgash rdrgtbcctk srcccca 27

<210> 5

<211> 14

<212> DNA

<213>artificial sequence

<400> 5

gahrtygtkm tsac 14

<210> 6

<211> 24

<212> DNA

<213>artificial sequence

<400> 6

gahrtygtkm tsacmcarwc tmca 24

<210> 7

<211> 15

<212> DNA

<213>artificial sequence

<400> 7

katytccary ytkgt 15

<210> 8

<211> 27

<212> DNA

<213>artificial sequence

<400> 8

katytccary ytkgtscchb cdccgaa 27

<210> 9

<211> 819

<212> DNA

<213>artificial sequence

<400> 9

atgggctggt cctgcatcat cctgttcctg gtggccaccg ccaccggcga ggtgcagctg 60

gtggagtctg ggggaggctt agtgcagcct ggagggtccc tgaaactctc ctgtgcagcc 120

tctggattca ctttcagtag ttatggcatg tcttgggttc gccagactcc agacaagagg 180

ctggagtggg tcgcaaccat taatagtaat ggtgctaaca cctattatcc agacagtgtg 240

aagggccgat tcaccatctc cagagacaat gccaagaaca ccctgtacct gcaaatgagc 300

agtctgaagt ctgaggacac agccatgtat tactgtgcaa ggatctatga tgcttactcc 360

tcctggttta cttactgggg tgaaggaact tttgtcacag tcaatctcgg tggcggtggc 420

tcgggcggtg gtgggtcggg tggcggcgga tctgatattg ttctgacaca gactacatcc 480

tccctgtctg cctctctggg agacagagtc accatcagtt gcagtgcaag tcaggggatt 540

aaaaattatt taaactggta tcagcagaaa ccagatggaa ctgttaaact cctgatctat 600

tacacatcaa gtttacactc aggagtccca tcaaggttca gtggcagtgg gtctgggaca 660

gattattctc tcaccatcag caacctggaa cctgaagata ttgccactta ctattgtcag 720

cagtatagta agcttccgta cacgttcggc gcaggcacaa aattggaaat caatgattac 780

aaggatgacg acgataagca ccaccaccac caccactga 819

Claims (10)

1. a kind of 317 scFv of CD317 single-chain antibody, which is characterized in that its coded sequence includes as shown in SEQ ID NO:9 Nucleotide sequence or its coded sequence include the nucleotide sequence with SEQ ID NO:9 coding same amino acid sequence；It is described 317 scFv of CD317 single-chain antibody is free of Fc sections.

2. a kind of nucleotide sequence for encoding 317 scFv of CD317 single-chain antibody, which is characterized in that the nucleotide sequence packet Include the sequence as shown in SEQ ID NO:9, or the sequence with SEQ ID NO:9 coding same amino acid sequence.

3. a kind of preparation method of 317 scFv of CD317 single-chain antibody, which is characterized in that the described method includes:

(1) recombinant expression carrier of 317 scFv of CD317 single-chain antibody is prepared, the recombinant expression carrier includes such as SEQ ID Nucleotide sequence shown in NO:9, or the nucleotide sequence with SEQ ID NO:9 coding same amino acid sequence；

(2) recombinant expression carrier is transferred in host cell and gives expression to 317 scFv of CD317 single-chain antibody.

4. preparation method according to claim 3, which is characterized in that the expression vector is carrier for expression of eukaryon.

5. the preparation method according to claim 4, which is characterized in that the carrier for expression of eukaryon is pcDNA3.1 (+).

6. preparation method according to claim 3, which is characterized in that the host cell is eukaryocyte.

7. preparation method according to claim 6, which is characterized in that the eukaryocyte is HEK293F cell.

8. according to the described in any item preparation methods of claim 3-7, which is characterized in that the nucleotide sequence passes through antibody Heavy chain and light chain degenerate primer group, the RNA to extract from hybridoma are obtained as template through reverse transcription and amplification.

9. preparation method according to claim 8, which is characterized in that the degenerate primer group includes such as SEQ ID NO: Sequence shown in 1-8.

10. 317 scFv of CD317 single-chain antibody described in claim 1 or nucleotides sequence as claimed in claim 2 are listed in preparation Application in the drug for the treatment of and/or pre- preventing tumor.