CN107488231B

CN107488231B - anti-CD 56 antibodies and uses thereof

Info

Publication number: CN107488231B
Application number: CN201710833921.XA
Authority: CN
Inventors: 姚于勤; 余琳; 杨金亮
Original assignee: Sichuan University
Current assignee: Chengdu weisk biomedical Co.,Ltd.
Priority date: 2017-09-15
Filing date: 2017-09-15
Publication date: 2020-10-30
Anticipated expiration: 2037-09-15
Also published as: CN107488231A

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to an anti-CD 56 antibody and application thereof. The present invention provides an anti-CD 56 antibody, comprising: comprises a heavy chain variable domain, a light chain variable domain, a constant region; the heavy chain variable domain is the same domain as the heavy chain complementarity determining region of the antibody, and the light chain variable domain is the same domain as the light chain complementarity determining region of the antibody. The invention can randomly combine two of the heavy chain variable domains of 6 different amino acid sequences and the light chain variable domains of 4 amino acid sequences to obtain the anti-CD 56 antibodies with different titers. The anti-CD 56 antibody has high affinity, high internalization efficiency and good specificity, and the affinity of the antibody for binding CD56 is 10^‑9To 10^‑14M, can be effectively used for preparing medicaments for diagnosing and treating tumor, immune system and nervous system diseases.

Description

anti-CD 56 antibodies and uses thereof

Technical Field

The invention belongs to the technical field of antibody preparation, and particularly relates to an anti-CD 56 antibody and application thereof.

Background

Among malignant tumors, the incidence and mortality of lung cancer are high in leaders and leaders. When lung cancer patients come to hospital for treatment, more than 80% of patients lose the best time for surgical operation and multidisciplinary combined radical treatment. Though dozens of years of efforts of related experts and doctors, the total 5-year survival rate of lung cancer patients in China is still lower than 15%. Lung Cancer can be divided into Non-Small Cell Lung Cancer (NSCLC), which accounts for about 85% and Small Cell Lung Cancer (SCLC), which accounts for about 13-15%. SCLC originates from neuroendocrine precursor cells, is a highly invasive, undifferentiated tumor, and has the characteristics of rapid proliferation speed and early metastasis. Although SCLC patients respond well initially to radiation and chemotherapy, the likelihood of relapse is extremely high and resistance is likely to develop, leading to insensitivity to further treatment.

In recent years, with the deep understanding of tumor pathogenesis at the level of genes and signal pathways, targeted therapy has made a breakthrough progress, representing the latest development direction of tumor therapy. The target therapy is to use monoclonal antibody and small molecule medicine to block the key growth factor/receptor, gene, regulation molecule, etc. as target spots in the process of generating and developing tumor, so as to achieve the purpose of treating tumor. The application of targeted therapeutic drugs such as Rituximab (Rituximab, CD20 antibody drug) and Imatinib (Imatinib, Gleevec, small molecule tyrosine kinase inhibitor) has revolutionized the treatment of lymphoma, chronic myelogenous leukemia, and gastrointestinal stromal tumor. The targeted therapy of NSCLC in lung cancer is also greatly improved, the antibody targeted therapy of SCLC is slow in progress, and the development of targeted therapeutic drugs for lung cancer has great clinical significance.

The occurrence and development of the small cell lung cancer are a complex process with multiple factors, multiple steps and multiple genes involved, and have multiple changes of heredity, epigenetics and the like on a molecular level, so that cancer cells are subjected to unlimited proliferation, angiogenesis and immune escape. A number of oncogenes (e.g., c-myc) and tumor suppressor genes (P53, RB1) are involved in the development of small cell lung cancer; oncogenic signaling pathways such as receptor tyrosine kinase, PI3Ks/AKT/mTOR, Notch, Wnt, etc. are abnormally activated in small cell lung cancer; growth factors and receptor families such as c-Kit, EGFR, IGF-1R, VEGF/VEGFR, MET and the like, functional proteins such as heat shock protein 90, Bcl-2 family, CD56, DLL3 and the like, immunoregulation molecules PD-1, PD-L1 and the like are also involved in processes of apoptosis inhibition, proliferation promotion, cycle regulation, small cell lung cancer invasion and migration, angiogenesis, immune escape and the like. In recent years, with the deep understanding of the genomic and molecular mechanisms of SCLC, researchers have explored various therapeutic approaches to target SCLC, including targeting Receptor Tyrosine Kinases (RTKs) and their downstream signaling mediators such as Ras and PI3K/mTOR, and also targeting angiogenesis, apoptosis, and epigenetics and immunotherapy of small cell lung cancer, but with minimal efficacy, and thus new therapeutic approaches are urgently needed.

CD56, also known as Neural Cell addition Molecule 1(NCAM1), is a membrane glycoprotein in the immunoglobulin (Ig) superfamily, and is also one of the Neural Cell Adhesion molecules. It plays an important role in the growth and development of the nervous system, is highly expressed in cancer cells, participates in cell migration and invasion and influences the metastatic spread of tumors. CD56 is an important marker and a potential target of lung cancer, and CD56 is specifically and highly expressed on the cell membrane surface of almost most small cell lung cancers, so that the CD56 is an ideal target for antibody therapy and antibody-conjugated drug therapy of the lung cancers.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an anti-CD 56 antibody and application thereof.

The present invention provides an anti-CD 56 antibody, comprising: comprises a heavy chain variable domain, a light chain variable domain, a constant region; the heavy chain variable domain is the same domain as the heavy chain complementarity determining region of the antibody, and the light chain variable domain is the same domain as the light chain complementarity determining region of the antibody.

In the anti-CD 56 antibody, the amino acid sequence of the heavy chain variable domain is any one of Seq ID NO. 1, Seq ID NO. 2, Seq ID NO. 3, Seq ID NO. 4, Seq ID NO. 5 or Seq ID NO. 6.

Seq ID NO 1 anti-CD 56 antibody heavy chain variable Domain 1

Seq ID NO 2 anti-CD 56 antibody heavy chain variable Domain 2

Seq ID NO 3 anti-CD 56 antibody heavy chain variable Domain 3

Seq ID NO 4 anti-CD 56 antibody heavy chain variable Domain 4

Seq ID NO 5 anti-CD 56 antibody heavy chain variable Domain 5

Seq ID NO 6 anti-CD 56 antibody heavy chain variable Domain 6

In the anti-CD 56 antibody, the light chain variable domain has an amino acid sequence of any one of Seq ID NO. 7, Seq ID NO. 8, Seq ID NO. 9 or Seq ID NO. 10.

7 anti-CD 56 antibody light chain variable Domain 1

Seq ID NO 8 anti-CD 56 antibody light chain variable Domain 2

Seq ID NO 9 anti-CD 56 antibody light chain variable Domain 3

Seq ID NO 10 anti-CD 56 antibody light chain variable Domain 4

In the anti-CD 56 antibody, the constant region is a natural antibody constant region or a genetically engineered antibody constant region. The natural antibody is IgG1, IgG2, IgG3, IgG4 or the like.

The invention also provides a gene encoding the anti-CD 56 antibody.

Wherein the gene encoding the anti-CD 56 antibody comprises a gene encoding a heavy chain variable domain, and the nucleotide sequence is shown as Seq ID NO. 11, Seq ID NO. 12, Seq ID NO. 13, Seq ID NO. 14, Seq ID NO. 15 or Seq ID NO. 16.

Seq ID No. 11 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 1:

GAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGGTATCCTGCAAGGCTTCTGGTTATGCGTTCACTAACTACAACATGTACTGGATGAAACAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTGATCCTTACAATGGTGGTACTAGGTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGCATCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGAGGATAGTACCGGCTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG

seq ID No. 12 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 2:

CAGATCCAGTTGGTGCAGTCTGGACCTGAACTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGTAAGGCTTCTGGATATACCTTCACAAACTATGGAATGAACTGGGTGAAGCAGACTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTATACTGGAGAGTCAACATATACTGATGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAGACCTCTACCAGCACCGCCTATTTGCAGATCAACAACATCAGAAATGAGGACACGGCTACATATTTCTGTGCAAGATCCCCTTATTACTACGGTAGTCAACGGGGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACC

seq ID No. 13 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 3:

AAACGGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGTTCCAGGGAAGGGGCCTGAGTGGATTGCATTCATTAGTAATTTGGCATATAGTATCTACTATATAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATATACTACTGTGCAAGGGTTTCTGGGACCTGGCTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG

seq ID No. 14 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 4:

TGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTCCGGAATGGCGTGGGTTCGACAGGCTCCAGGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGCAAGGATCTCCTATGATTACATTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG

seq ID No. 15 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 5:

GACGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGTTCCAGGGAAGGGGCCTGAGTGGATTGCATTCATTAGTAATTTGGCATATAGTATCTACTATATAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATATACTACTGTGCAAGGGTTTCTGGGACCTGGCTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCG

seq ID No. 16 nucleotide sequence encoding anti-CD 56 antibody heavy chain variable domain 6:

GGTCCAGCTGCAACAGTCTGGACCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACTACATGCACTGGGTGAAGCAAAGCCATGTAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGCTACTACCTACAACCAGAATTTCAAGGACAAGGCCAGTTTGACTGTAGATAAGTCCTCCAGCACAGTCTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATACCCTTTGTTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG

further, the above-mentioned gene encoding the anti-CD 56 antibody also includes a gene encoding a light chain variable domain, and the nucleotide sequence is represented by Seq ID NO 17, Seq ID NO 18, Seq ID NO 19 or Seq ID NO 20.

Seq ID No. 17 nucleotide sequence encoding anti-CD 56 antibody light chain variable domain 1:

GATGTTTTGCTGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAATATTTTACATAGTAATGGCAACACCTATTTCGAATGGTACCTGCAGAAACCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGTTCCGTTCACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC

seq ID No. 18 nucleotide sequence encoding anti-CD 56 antibody light chain variable domain 2:

GACATTATTATATCTCGTTCTCCAGCCACCCTGTCTGTGACTCCAGGAGATAGAGTCTCTCTTTCCTGCAGGGCCAGTCTGATTATTACCGACTACTTACACTGGTATCAACAACCATCAAATGAATCTCCAAGGCTTCTCATCAGATATGTTTGCCTGGCCATCTCTGGGATCCCCTCCTCCTTCGCTGACAGTGGATCACGGACAGATTTCCCTCTCTGTATCAACAGTGTGAAACCTGAACATGTTGGAGTGTATTACTGTCAAAATGGTCACACCTTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAAGTGAAAC

seq ID No. 19 nucleotide sequence encoding anti-CD 56 antibody light chain variable domain 3:

GACATCTTGCTGACTCAGTCTCCAGCCATCCTGTCTGTGAGTCCAGGAGAAAGAGTCAGTTTCTCCTGCAGGGCCAGTGAGAACATTGGCACAAGCATGCACTGGTATCAGCAAAGAACAAATGGTTCTCCAAGGCTTCTCATAAAGTATGCTTCTGAGTCTATCTCTGGGATCCCTTCCAGGTTTAGTGGCAGTGGATCAGGGACAGATTTTACTCTTAGCATCAACAGTGTGGAGTCTGAAGATATTGCAGATTATTACTGTCAACAAACTAATAGCTGGCCGTACACGTTCGGAGGGGGGACCAACCTGGAAATAAAAC

seq ID No. 20 nucleotide sequence encoding anti-CD 56 antibody light chain variable domain 4:

GACGTTGTGGTAACTCAGTTTCCAGACACCCTGTCTGTGACTCCAGGAGATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAGTATTCGTAACAACCTACACTGGTATCAACAACAATCACATGAGTCTCCAAGGCTTCTCATCAAGTATGCTTCCCAGTCCATCTCTGGGATCCCCTCCAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACTCTCAGTATCAACAGTGTGGAGACTGAAGATTTTGGAATGTATTTCTGTCAACAGAGTAACAACTGGCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC

the invention also provides a Vector containing the anti-CD 56 antibody encoding gene, wherein the Vector is an Expression Vector, preferably at least one of pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCL, pAZ-V5-hCL, pTT5 or pCEP4 Mammalian Expression Vector.

The invention also provides a host cell of the vector.

In addition, the invention also provides the application of the anti-CD 56 antibody, genes for encoding the heavy chain variable domain and the light chain variable domain of the antibody, a vector containing the genes and a host cell in preparing a medicament for diagnosing and treating tumor, immune system or nervous system diseases; in particular for the preparation of antibody complexes.

Further, in the application of the anti-CD 56 antibody in preparing an antibody complex, the antibody complex is an antibody complex coupled with at least one of a fluorescent molecule, a cytotoxic molecule, an antibody or a polypeptide.

The invention also provides an antibody compound which is prepared by coupling the anti-CD 56 antibody with a fluorescent molecule, a cytotoxic molecule, an antibody or a polypeptide.

In addition, the invention also provides the application of the antibody compound in preparing a medicine for diagnosing and treating tumor, immune system or nervous system diseases.

The invention has the beneficial effects that: the invention provides an anti-CD 56 antibody having 6 selectable heavy chain variable domains and 4 selectable light chain variable domains, optionally in combination with any one or more of the heavy chain variable domains and light chain variable domains, resulting in different titers of anti-CD 56 antibodies. The anti-CD 56 antibody has high affinity, high internalization efficiency and good specificity, and the affinity of the antibody for binding CD56 is 10^-9To 10^-14M, the anti-CD 56 antibody can be effectively used for preparing medicaments for diagnosing and treating tumor, immune system and nervous system diseases, and simultaneously can be combined with other antibodies, functional molecules, medicaments and clinical treatment means to be applied to the diagnosis and treatment of tumor, immune system and nervous system diseases, thereby having good application prospect.

Drawings

FIG. 1 shows SDS-PAGE electrophoresis and Western-Blot detection of Promizimab purity, molecular weight, target recognition and antibody specificity

FIG. A, M is Marker, and lanes 1 to 6 are the extracellular end of human CD56 (CD56ECD), the cell line of small cell lung cancer NCI-H526, NCI-H524, NCI-H69, NCI-H128, and the expression of NCI-H446 in the non-reduced state in the cell lysate, and the corresponding sample in the reduced state in the cell lysate; b, M is Marker, 1-4 are respectively CD56 extracellular end non-reduction sample loading, CD56 extracellular end sugar removal non-reduction sample loading, CD56 extracellular end reduction sample loading, and CD56 extracellular end sugar removal reduction sample loading; C. the plot shows Promiximab cross-reactivity with CD56ECD as control, Promiximab cross-reactivity with human spleen cell lysate, NK cell lysate, and mouse spleen cell lysis (corresponding to lanes 1-4); and tested for tissue specificity in comparison to and commercial anti-CD 56 antibody 123C 3.

FIG. 2 detection of PI value of Promiximab by capillary isopoint focusing method

The capillary isoelectric focusing method is used for detecting the PI value of the Promiximab, and the detected isoelectric point of the Promiximab which is expressed and purified by eukaryotic cells is 7.89.

FIG. 3 shows the Western-Blot detection of the binding of the CD56 antibody to the lysis of CD56 positive cells

The Western-Blot detection results of CD56 antibodies 1-24 and CD56 positive cells NCI-H526 and NCI-H446(CD56 weak positive) show that the anti-CD 56 antibody can recognize other antibodies except that the CD56 linear epitope cannot be recognized by No. 2 antibody, wherein the first lane corresponding to each antibody is NCI-H526 lysate, and the second lane is NCI-H446 cell lysate.

FIGS. 4-9 show the CD56 antibody affinity detection

The affinity of the 24 anti-CD 56 antibodies to the extracellular domain of human CD56 was analyzed using the Biolayer interferometry technique.

FIG. 10 shows the Promiximab affinity assay

Analysis by the Biolayer interference technique showed that the affinity of promiximab to CD56ECD was 0.78pmol (k)_a(1/Ms)＝1.27E+05,k_d(1/s)<1.0E-07,K_D<7.8E-13)。

FIG. 11 is a graph showing the detection of internalization by flow cytometry of the binding of the Promiximab targeting property of the anti-CD 56 antibody to CD56

FIG. A, Promiximab binding to CD56, cell membrane antigen of small cell lung carcinoma cell line, and incubation of small cell lung carcinoma with PBS (black part) and Promiximab (open line); FIG. B, Promizimab internalization efficiency assay, small cell lung carcinoma cell group with PBS (black area, 4 ℃,3h), Promiximab (solid line, 4 ℃,3h), Promiximab (dotted line, 37 ℃,3h), respectively; promizimab has better targeting in NCI-H526, NCI-H524 and NCI-H69 cell lines, and the internalization efficiency is 68.19%, 53.14% and 64.97% respectively. In conclusion, the prepared novel targeting CD56 antibody promiximab has specific binding capacity, higher affinity and effective internalization efficiency.

FIG. 12 is a graph showing the examination of the in vitro activity of the anti-CD 56 antibody Promiximab with CCK-8

CCK-8 antiproliferative experimental results show that the IC50 of the Promiximab antibody on CD56 positive cell NCI-H69 is 968.54 +/-34.76 nM; the IC50 of the anti-CD 56 antibody against NCI-H526, a CD56 positive cell, was 792.24. + -. 41.21 nM.

FIG. 13 shows the in vivo anti-tumor activity of Promiximab.

A CD56 positive human small cell lung cancer NCI-H526 nude mouse subcutaneous tumor model is established, and the in vivo anti-tumor activity of promiximab is researched. The administration mode is tail vein, and the administration is once every two days and three times continuously. The results showed that the promiximab (10mg/kg) dose group showed significant in vivo activity of inhibiting tumor growth on day 24 in the NCI-H526 subcutaneous model. The observation of body weight shows that there is no significant difference in body weight between the control and the administered animals, which preliminarily indicates that toxicity of promiximab is small.

FIG. 14 shows toxicity analysis of Promizimab on heart, liver, spleen, lung and kidney

General status evaluation of mice was divided into body weight and pathological changes of major organs. On the 20 th day after tail vein administration, the heart, liver, spleen, lung and kidney of nude mice of each experimental group were taken and stained by H & E, and the results showed that the organs in the Chinese medicinal composition did not show obvious tissue lesion compared with the normal organs of the control group, indicating no obvious toxic or side effect.

Detailed Description

The invention provides an anti-CD 56 antibody, comprising: comprises a heavy chain variable domain, a light chain variable domain, a constant region; the heavy chain variable domain is the same domain as the heavy chain complementarity determining region of the antibody, and the light chain variable domain is the same domain as the light chain complementarity determining region of the antibody.

In the anti-CD 56 antibody, the constant region is a natural antibody constant region or a genetically engineered antibody constant region, and the natural antibody comprises antibodies such as IgG1, IgG2, IgG3 or IgG 4.

Natural antibodies in humans are composed of heavy and light chains, where the heavy and light chain variable region structures are particularly important for antigen binding. The invention identifies the sequences of the heavy chain variable region and the light chain variable region of the antibody, and combines the natural antibody constant region or the antibody constant region after genetic engineering modification to obtain the anti-CD 56 antibody capable of targeting CD56 cells, the antibody has good targeting property and high affinity, can be used for carrying small molecule drugs to target CD56 cells, and improves the utilization efficiency and the treatment effect of the drugs.

The anti-CD 56 antibody of the present invention can be obtained by conventional hybridoma cell secretion, or can be constructed by conventional gene recombination techniques. The resulting genes encoding the heavy and light chain variable domains of the CD56 antibody are cloned into Expression vectors with antibody constant region genes, including pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCL, pAZ-V5-hCL, pTT5, pCEP4 Mammalian Expression Vector, etc., expressed by eukaryotic cell Expression systems such as CHO and 293, etc., and CD56 antibody is obtained by protein purification methods.

The anti-CD 56 antibody can be coupled with fluorescent molecules, cytotoxic molecules, antibodies or polypeptides to form an antibody compound, and plays a role in preparing medicines for diagnosing and treating tumors, immune system diseases or nervous system diseases.

The antibody of the present invention can also be prepared into various forms of pharmaceutical preparations, preferably injections, more preferably lyophilized injections, according to pharmaceutically conventional techniques.

The antibodies of the invention can be combined with other drugs to form pharmaceutical compositions that can be used to treat diseases in conjunction with other therapeutic methods, including chemotherapy, radiation therapy, biological therapy.

The following examples further illustrate specific embodiments of the present invention, but are not intended to limit the scope of the present invention to the examples.

The specific experimental procedures are described in molecular cloning, third edition (Joseph Sambrook, science Press) and similar laboratory manuals.

Example 1 preparation of anti-CD 56 antibody hybridoma cell line by hybridoma technique and sequencing and identification of light and heavy chain variable region genes thereof

1. Animal immunization

Selecting Balb/c healthy female mice homologous with the myeloma cells to be used, wherein the age of the mice is 8-12 weeks. The antigen adopts expression and purification of CD56 extracellular domain (CD56ECD) protein, the antigen is diluted into 4mg/mL, 2mg/mL, 1mg/mL and 0.5mg/mL by using physiological saline, 50 mu L of the antigen with each concentration is taken for primary immunization, and the antigen and an immunologic adjuvant Quick Antibody-Mouse 5W are fully and uniformly mixed according to the volume ratio of 1:1 to obtain the adjuvant. Mice were immunized by intramuscular injection of 100 μ L each into the hind leg and calf, labeled after immunization, and boosted one needle on day 21 in the same manner. And (3) collecting tail blood on the 35 th day for ELISA determination, wherein the antibody titer is in the range of 1: 10000-1: 10000000, and then performing antigen shock immunization by intravenous injection of the same dose of CD56 extracellular domain (CD56ECD) protein.

2. Feeder cell preparation

The Balb/c mice are killed by pulling neck and dislocating, soaked in 75% alcohol for 5 minutes, and then placed in an ultra-clean workbench, and placed in a plate with the abdomen facing upwards or fixed on a dissection plate. The skin of the abdomen of the mouse is clamped by an ophthalmic forceps, a small opening is cut by scissors, and the peritoneum is not cut by the scissors so as to avoid the outflow of the abdominal cavity fluid. Then blunt dissection was performed up and down with scissors to fully expose the peritoneum. Wiping peritoneum with alcohol cotton ball for sterilization. 5mL of RPMI-1640 basic culture solution is sucked by a syringe, injected into the abdominal cavity of the mouse, kept still by the syringe, and shaken or repeatedly sucked for several times. The liquid in the abdominal cavity is pumped back by the original syringe and is injected into the centrifuge tube. The operation is repeated for 3-4 times. Centrifuge at 1000rpm for 10min and discard the supernatant. Resuspending the cells with 20-50 mL of complete culture medium, adding 100 μ L/well dropwise to the culture plate, and placing in an incubator for later use. The growth state of the feeder cells is observed, and generally the well-grown feeder cells and macrophages are fusiform or polygonal, and the cells are transparent and have strong refractivity.

3. Cell fusion

Preparation of splenocytes: taking one boosting immune mouse, taking a blood sample from an orbit, dislocating and killing the mouse, taking a spleen after disinfecting the spleen in 75% alcohol, removing connective tissues, preparing a spleen cell suspension, transferring the spleen cell suspension into a 50mL centrifuge tube, adding RPMI1640 to 30mL, centrifuging the spleen cell suspension at 1500-2000 rpm for 5 minutes, removing supernatant, adding RPMI1640 to 30mL, diluting the leukocyte diluent by 20 times, counting the number of the leukocyte, taking 1 multiplied by 10 to obtain the supernatant, and taking the supernatant⁸And (4) preparing the cells for later use.

Myeloma cell preparation: taking 3 bottles of myeloma cells with good growth state (viable cell number > 95%), completely blowing down the myeloma cells, transferring the myeloma cells into a 50mL centrifuge tube, adding RPMI1640 to 30mL, centrifuging at 1500-2000 rpm for 5 minutes, discarding the supernatant, adding RPMI1640 to 30mL, diluting RPMI1640 by 10 times, counting, taking 2 × 10⁷And (4) preparing the cells for later use.

Cell mixing: spleen cells and myeloma cells were mixed at cell number 5: 1, and centrifuged at 1500-2000 rpm for 5 minutes.

Cell fusion: the supernatant was decanted off, the pellet was made into a paste, placed in a 37 ℃ water bath, 1mL of the fusogenic agent was added over 1 minute with agitation of the cells, placed in a 37 ℃ water bath for 45 seconds, 1mL of 1640 was added over 1 minute with agitation of the cells, 5mL of 1640 was added over 2 minutes with agitation of the cells to terminate the fusogenic action, 10mL of 1640 was added over 2 minutes with agitation of the cells for 7 minutes at 500rpm, and the supernatant was discarded. 10mL1640 was added over 2 minutes and the cells were stirred.

Cell culture: gently homogenize the cells, slowly add HAT medium to the desired volume, resuspend the cells, gently mix them, and add to a pre-prepared feeder cell plate. 1 drop (prepared with 8 mL/plate) is dripped into a 10mL suction pipe, 80-100 microliter (prepared with 10 mL/plate) is dripped into a row gun, the temperature is 37 ℃, and CO is added₂Culturing in an incubator and observing.

Cell culture and liquid change: starting the day after cell fusion, the cells were carefully observed, and the growth state of the cells, the number of hybridomas per well, the number of blocks, the presence or absence of contamination in the culture medium, and the state of feeder cells were recorded. And (3) changing the HAT culture solution once after 3-5 days of culture, changing the HT culture solution after 10 days of culture to 20 days, and changing the 1640 complete culture solution.

4. Cloning culture

The monoclonal culture is to obtain a hybridoma cell strain which has clonogenic property and secretes antibody. Early fusion hybrid cells are unstable and lose the ability to secrete antibodies, so they grow early in cloning culture (cells grow to about 1/4-1/3 of the area of the bottom of the well). Usually, the hybrid cells are cultured for 2-3 times of cloning to stabilize. In order to prevent the hybrid cells from being mutated or contaminated, the hybrid cells are frozen and preserved to prevent seed loss during cloning. Subclone Medium RPMI1640+ 20% FBS + double antibody + growth factor (1X) A96-well plate (2.5X 104 cells/0.1 mL/well) with feeder cells was prepared. The positive well hybrid cells were counted to make a cell suspension. The cell suspension was diluted into 4 groups of solutions by fold ratio, each group containing 10, 5cells per mL, and plated at 0.1 mL/well. About 10 days or so, a single well is selected, and antibodies are detected, if positive, and then cloned until 100% of the wells secrete antibodies. At this time, the clone with strong antibody positive and good cell growth is selected, and is subjected to amplification culture, system establishment and storage.

5. Elisa method for screening anti-human CD56 positive clones

A1. mu.g/mL Recombinant Human NCAM-1/CD56120isoform or extracellular fragment expressing purified CD56 was prepared using 10mM 1 XPBS using the conventional Elisa method, and 50. mu.l of each well was coated with a 96-well plate, suspended and filled in the bottom of the well, placed horizontally, sealed with a sealing film, and left overnight at 4 ℃. The overnight coated Elisa plates were washed 3 times with wash solution and blocked with 2% BSA. Hybridoma culture supernatants were added to an Elisa assay plate and incubated at 37 ℃ for 2 hours. After washing the plate 3 times, add the detection secondary antibody and incubate for 1 hour at 37 ℃. After washing the plate for 3 times, TMB is added for color development, and an OD value is read by an enzyme-linked immunosorbent assay. Positive clones were screened.

6. Heavy and light chain variable region gene sequence of CD56 antibody cloned from positive hybridoma monoclonal cell strain

Collecting positive monoclonal hybridoma cell strain in logarithmic growth phase, cracking cell with Trizol, extracting mRNA of monoclonal hybridoma cell strain, obtaining cDNA through reverse transcription PCR, obtaining antibody variable region segment through conventional PCR, and obtaining antibody heavy chain variable region and light chain variable region gene sequence through gene sequencing.

Example 2 preparation of anti-CD 56 antibody by eukaryotic expression System

1. Construction of anti-CD 56 antibody expression vector

And obtaining the light-heavy chain variable region amino acid sequence of the candidate clone through sequencing and sequence analysis, and selecting the sequence corresponding to each clone to construct a chimeric expression vector for the modification of the human-mouse chimeric antibody. The light chain variable region gene with the amino acid sequence shown as Seq ID NO:7 is constructed on a pTT5 expression vector, EcoR I-Kozak sequence-signal peptide-VH-constant region-stop codon-Hind III, and the light chain constant region gene sequence is as follows: NCBI Reference Sequence NG-000834.1, EcoRI-signal peptide-VL-Ig kappa chain C region-Hind III. Cloning the heavy chain variable region gene with the amino acid sequence shown as Seq ID NO:1 into an expression vector pTT 5/anti-CD 56 antibody-VH, wherein the expression vector consists of EcoR I-signal peptide-VH-Iggamma-1 chain C region-Hind III, and the heavy chain constant region sequence is as follows: NCBI Reference Sequence NG _ 001019.6. Carrying out codon optimization according to a mammalian cell expression system and synthesizing related gene segments. The antibody constructed by the above was named: anti-CD 56 antibody Promiximab.

2. Extraction of anti-CD 56 antibody heavy and light chain bacterial expression plasmids

The constructed anti-CD 56 antibody light chain and heavy chain expression plasmid bacterial liquid was taken out, respectively, and inoculated into 15mL of LB liquid medium containing 100. mu.g/mL ampicillin at a ratio of 1: 100. Placing in a shaking table for bacteria at 37 ℃, and carrying out shaking culture at 225rpm/min overnight; and (3) carrying out enlarged culture of bacteria: the overnight-cultured broth was inoculated into LB liquid medium containing 100. mu.g/mL ampicillin at a ratio of 1: 100. Placing in a shaking table for bacteria at 37 ℃, and carrying out shaking culture at 225rpm/min overnight; using PureYield^TMPlasmid Maxiprep System Plasmid extraction, the operation method is as follows: centrifuging at 5,000g for 30min at room temperature to collect bacteria, and discarding the supernatant; adding 12mL of Cell Resuspension Solution (Cell Resuspension Solution), and blowing and beating the resuspended bacteria by using a gun head; adding 12mL of Cell lysate (Cell Lysis Solution), reversing for 3-5 times, mixing, and incubating for 3 minutes at room temperature; adding 12mL of neutralizing Solution (Neutralization Solution), reversing for 10-15 times and mixing uniformly;

centrifuge using an angle rotor centrifuge at 14,000g for 20min at room temperature. Mixing blue PureYield^TMThe clean Column is placed in white PureYield^TMOn a Maxi Binding Column, the supernatant was poured into a blue purification Column after assembly on a vacuum manifold. Opening the vacuum device until the liquid completely flows through the two purification columns; removing the blue purification column, leaving the white binding column on the vacuum multi-connector, adding 5mL of endotoxin removing washing liquor into the binding column, and keeping the vacuum state until the liquid flows through the binding column; add 20mL of PureYield to the binding column^TMPurifying the column washing solution, keeping the vacuum state until the liquid flows through the binding column, and vacuumizing until the membrane of the binding column is dried, wherein about 5min is needed; a1.5 mL EP tube, vacuum elution apparatus base (Eluator) was assembled as described^TMVacuum ablation Device) and binding columns. Placing it on a vacuum manifold; add 1mL nuclease-free water to the binding column binding membrane and let stand for 1 min. Vacuum was applied until all liquid flowed through the binding column. Repeating the operation once; a1.5 mL EP tube was removed to obtain a plasmid.

3. HEK293F transient expression anti-CD 56 antibody

HEK293F cell culture protocol, 24h before transfection, cell count, 80-90X 105cells/mL density passage; during transfection, the cells are counted, and the cell activity is more than 90%. Diluting the cells to 1.5-2.0 × 106 cells/mL; the final concentration of the heavy chain and the light chain are both 0.5 mug/mL, the total dosage of DNA (heavy chain and light chain) is 1 mug/mL, the final concentration of PEI is 3.25 mug/mL, and the system ratio is 1:1, the mixed solution system accounts for 10 percent of the total transfection system, and the DNA/PEI mixed solution is placed in a warm room for 10 min; dripping the DNA/PEI mixed solution into the cell suspension, and continuing suspension culture of the transfected cells at 130 rpm/min; the plasmid for the first transfection was subjected to a protein expression time gradient assay, starting 24h after transfection, and cell number and cell viability were determined. Cell supernatant test protein was collected 48h after transfection. The optimal time to harvest the recombinant protein was determined up to 6d after transfection. The recombinant protein is later recovered at this time point.

4. anti-CD 56 antibody purification

Collecting the cell suspension of 6d after transfection, centrifuging at 3000rpm/min for 5 minutes, and removing cell debris; the concentration treatment of the expression supernatant is the same as before; before purification, it is necessary to check whether the respective interface connections are tight. Opening the UNICON 6.3 software and AKTA Purifier 100 protein purification system; column assembling: the HiTratpTM protein A FF (5mL) column was removed, the tube was connected and the column was fixed, and the column was washed with deionized water at a flow rate of 1mL/min until the conductivity was balanced. The pressure protection of the chromatographic column is set to be 0.3 Mpa; balancing and loading, balancing buffer solution, balancing affinity chromatography column, the flow rate is 2mL/min, 20 column volumes of processed samples are loaded on the column, the flow rate is 1.5 mL/min; protein washing and elution: the column was washed with equilibration buffer and the contaminating proteins eluted until the effluent approached the UV value of the buffer. Collecting the effluent, performing SDS-PAGE detection, passing the eluate through a column at a flow rate of 1.5mL/min, collecting the eluate when the UV value rises, and stopping collecting until the UV values of the effluent and the eluate are close. Detecting the protein concentration and SDS-PAGE of the eluate; and (3) cleaning and storing the column: washing the column with an equilibrium buffer solution until the conductance is balanced, washing the chromatographic column with a 15mM NaOH solution at a flow rate of 2mL/min for 5-10 column volumes; washing the chromatographic column with ultrapure water at a flow rate of 2mL/min until the conductance is less than 0.1mSc/cm and the UV value approaches 0, washing the chromatographic column with 20% ethanol at a flow rate of 2mL/min for 20 column volumes, removing the column, and storing at 4 ℃. Shutting down the UNICON 6.3 software and the purification system; treatment of the purified sample, before use, a 30kDa Millipore ultrafiltration tube (30mL standard) was rinsed with ultrapure water and then twice with replacement buffer PBS (pH6.0 or 7.0); adding the collected eluent into the rinsed ultrafiltration tube, centrifuging at 4000rpm/min for 15-20min, pouring out the lower liquid layer of the ultrafiltration tube, adding new replacement buffer solution into the upper tube, fully and uniformly mixing the protein sample in the inner tube, repeating the steps for 3-4 times, replacing the buffer solution of the protein sample with corresponding preservation solution, and preserving at-80 ℃.

Example 3 determination of the Properties of anti-CD 56 antibodies

Using the procedure of example 2, 24 anti-CD 56 antibodies, numbered antibodies 1 to 24, were obtained by combining two of the 6 heavy chain variable region sequences Seq ID NO:1 to Seq ID NO:6 and the light chain variable region sequences Seq ID NO:7 to Seq ID NO:10, respectively, of the CD56 antibody. Wherein the antibody Promiximab shown in example 2 is an antibody having the amino acid sequence of the heavy chain variable domain shown as Seq ID NO:1 in combination with the amino acid sequence of the light chain variable domain shown as Seq ID NO:7, which is numbered 17 and has the clone number of G22-1-D11. The above antibodies were detected by SDS-PAGE, Western-Blot, flow cytometry and Biacore affinity against the anti-CD 56 antibody Promiximab, with the following results:

1. SDS-PAGE electrophoresis and Western-Blot detection of purity, molecular weight, target recognition and antibody specificity of Promiximab

Preparing a cell sample, collecting a small cell lung cancer cell line, resuspending with PBS, 3500rpm, centrifuging for 5min, washing for three times, adding a proper amount of cell lysate (containing protease inhibitor) according to the number of cells, fully and uniformly mixing, placing on ice for 30-60min, centrifuging for 10min at 4 ℃, 10000 ℃14000g, taking supernatant, subpackaging, labeling, storing at-20 ℃ for later use, wherein the pure protein sample addition concentration for SDS-PAGE is 3 mu g/hole, the sample addition system is 10 mu L, and the protein sample addition concentration is 0.1-100 ng/hole when the protein sample addition system is used for Wertern Blot detection. Mixing cell lysate (or protein sample) with 5 Xdenatured reducing sample buffer solution and 5 Xnon-denatured non-reducing sample buffer solution, mixing with denatured reducing sample buffer solution, standing at 100 deg.C for 5min, centrifuging at 10000rpm for 1min, and preparing electrophoresis sample. According to the size of the antigen molecular weight, the concentration of the separation gel is 8%, the concentration of the concentrated gel is 5%, gel is prepared, an electrophoresis system is installed, electrode buffer solution is added, sample loading is carried out, the voltage is stabilized to be 200V, the electrophoresis time is judged according to the position and the experiment purpose of bromophenol blue, after the electrophoresis is finished, a glass plate is detached, the gel is stripped, Coomassie brilliant blue is used for dyeing overnight, and after decoloration is carried out by adopting decoloration liquid, the SDS-PAGE electrophoresis result is analyzed. After performing the SDS-PAGE experiments according to the experimental procedure, one gel was analyzed by Coomassie blue staining and one gel was ready for use. Western-Blot membrane transfer according to the protocol, incubation antibody exposure.

The Promiximab is detected to have typical IgG structural domain characteristics, and the purity of the purified Promiximab is 96% through SDS-PAGE detection, and the Promiximab has typical light heavy chain structural domain (shown in figure 1A). The Western-Blot assay result shows (as shown in FIG. 1B) that Promiximab can be combined with pure CD56 and also can be combined with protein after CD56 positive cell lysis, and the antibody specificity experiment proves (as shown in FIG. 1C) that Promiximab has better specificity compared with the commercial antibody 123C 3.

The Western-Blot detection results of the antibodies and CD56 positive cells NCI-H526 and NCI-H446(CD56 weak positive) are shown in FIG. 3, the first lane corresponding to each antibody is NCI-H526 lysate, the second lane is NCI-H446 cell lysate, and the result shows that the anti-CD 56 antibody can recognize other antibodies except that the No. 2 antibody cannot recognize the CD56 linear epitope.

2. BIACORE T200 avidity detection of avidity of anti-CD 56 antibodies

The affinity detection antigen is recombined Human NCAM-1/CD56120isoform with molecular weight of 120kD, and is coupled to CM5(BIACORE X100) or sCM5(BIACORE T200) through amino group by direct method; according to the Rmax (MWanalyte/MWligand) multiplied by RL multiplied by Sm, the actual coupling amount is 1.5 times of RL. Calculating the coupling amount of the antigen suitable for detection at the same time to be 120 Ru; coupling operation: the coupling buffer was 1 XHBS-EP buffer, 50mM NaOH as wash. The antigen was formulated to 10. mu.g/mL using a sodium acetate solution of pH 4.5. Selecting amino coupling, inputting 120Ru into Target level, and mixing the antigen sample, NaOH, ethanolamine and EDC. Placing the NSH and the empty test tube into the corresponding position in the sample tray according to the prompt; the regeneration condition is groped, and glycine hydrochloric acid with the pH of 1.7 is finally selected for regeneration for 10 s; all samples are provided with multiple holes; setting a program, and selecting 2-1 by Flow pat in a Kinetics option; regeneration selection 2; contact time is 180 s; dissociation time was set to 5600 s; regeneration conditions are as follows: gly 1.7, 10 s; the samples tested in duplicate were spaced apart and three 0 concentrations and 3 start ups were set. The kinetic analysis was performed using a 1:1 computational model for fitting as shown in FIG. 4. The results showed that the affinity of Promiximab for CD56ECD was 0.78pmol (k)_a(1/Ms)＝1.27E+05,k_d(1/s)<1.0E-07,K_D<7.8E-13, as shown in FIG. 10), is a high affinity antibody. Other antibodies also showed stronger affinity.

3. Detection of isoelectric point of Promiximab by capillary isoelectric focusing electrophoresis

Capillary electrophoresis isoelectric focusing is a method for performing analytical separation of samples according to the difference of pI values of the samples. The ampholyte is capable of forming a pH gradient within the capillary under the influence of a DC voltage across the two terminals. The samples with the amphiphatic groups migrate at different rates in the opposite direction to their charge. When the pH value of the sample is shifted to a pI value, the net charge of the sample is zero, and the movement is stopped. According to the principle, the aim of analyzing the pI value can be achieved.

To an EP tube was added 17.5. mu.L of 1% MC (final concentration of 0.35%), 2. mu.L of ampholyte pH 3-10 (final concentration of 4%), the corresponding volume of protein sample (final concentration of 0.2mg/ml) was added and 50. mu.L was made up with ultrapure water, vortexed with a vortex mixer for 30s, and centrifuged at 13,000rpm/min for 5min in a 4 ℃ centrifuge. The samples were added to a visual Insert Pack and centrifuged for 1min at 13,000rpm/min in a 4 ℃ centrifuge. Placing the visual Insert Pack into the visual Pack and then into a sample pan on the machine; operating according to the operating rules; focus Period 1 was set to 1500V,1min, FocusProperty 2 was set to 3000V,8 min. Carrier Amphibiytes: 4% pH 3-10, Additives: 0.35% MC, Concentration:0.2 mg/ml. Promiximab expressed and purified by eukaryotic cells was determined to have an isoelectric point of 7.89 (shown in fig. 2).

4. Detection of anti-CD 56 antibody Promiximab targeting by flow cytometry

Culturing CD56 positive tumor cell line, collecting cancer cells in logarithmic growth phase, dividing the cells into several groups with 1 × 10 cells in each group⁶(ii) a Grouping cells: negative control group (PBS group) and experimental group; resuspending each group of cells with PBS buffer salt, centrifuging at 4 deg.C and 3500rmp for 3min, and sucking the supernatant with the tip of a gun; incubating the primary antibody, adding 100 μ L PBS to the negative control group, adding 100 μ L antibody (10 μ g/mL) to the experimental group, resuspending, and incubating at 4 deg.C for 30 min; centrifuging each group of cells at 3500rpm for 3min, removing supernatant, adding 300 μ L PBS buffer salt into each group, resuspending and blowing the cells twice, centrifuging each group of cells at 3500rmp for 3min, removing supernatant, and repeating the steps for 2 times; incubating the secondary antibody, adding goat anti-human IgG/FITC labeled 50-100 μ L (dilution ratio of 1:200) into each group of cells, re-suspending and mixing, and incubating the cells at 4 ℃ for 30 min; after incubation at 4 ℃ for 30min is finished, adding 300 mu L PBS buffer salt into each group, resuspending and blowing the cells twice, centrifuging each group of cells at 3500rpm for 3min, sucking out supernatant, and repeating the steps for 2-3 times; adding 400 mu L PBS buffer solution to resuspend each group of cells for detection; on a flow cytometer, various parameters are set, cells of a control group are used for debugging and are used as negative control, and then cell samples of various groups are sequentially measured. The experimental results showed that Promiximab could better recognize and target the CD 56-positive small cell lung cancer cell lines NCI-H526, NCI-H524, and NCI-H69 (as shown in FIG. 11).

5. Flow cytometry for detecting internalization effect of anti-CD 56 antibody Promiximab after binding to CD56

Culturing CD56 positive lung cancer cell line, collecting cells in logarithmic growth phase, dividing the cells into several groups with 1 × 10 cells in each group⁶Grouping cells: the negative control group (PBS group) and experimental group were resuspended in PBS buffer salt, centrifuged at 4 ℃ at 3500rmp for 3min, and the supernatant was aspirated by the tip of a gun. Dividing cells combined with antibody into two groups during internalization, resuspending the cells with 500 μ LPBS, standing one group at 4 deg.C for 3h, internalizing the other group at 37 deg.C for 3h, centrifuging at 4 deg.C and 3500RMP for 3min, sucking supernatant with gun tip, adding 300 μ L of 50mM PBS buffer salt, cell resuspension and air blow two times, then the cell in each group in 3500RMP speed for 3 minutes, suction supernatant. Repeating the previous step, adding goat anti-mouse IgG/FITC labeled secondary antibody (the dilution ratio is 1:200) to each group of cells, re-suspending and uniformly mixing, incubating the cells at 4 ℃ for 30min, injecting the primary antibody of promiximab, labeling the secondary antibody of goat anti-human IgG/FITC, adding 300 mu L of PBS buffer solution to each group, re-suspending and blowing the cells twice, centrifuging each group of cells at the rotation speed of 3500rpm for 3min, and sucking out the supernatant; repeating the steps for 2 times, adding 400 mu L PBS buffer solution to resuspend each group of cells for detection, setting each parameter on a flow cytometer, debugging the cells of a control group and taking the cells as negative control, and then sequentially measuring each group of cell samples. The experimental results showed that the silencing of internalization mediated by Promiximab binding to CD56 was 68.19%, 53.14% and 64.97% in NCI-H526, NCI-H524 and NCI-H69 cell lines, respectively. This result suggests that Promiximab has better CD56 targeting and at the same time has the ability to deliver drugs into CD56 positive cells (as shown in fig. 11).

6. Activity assay of anti-CD 56 antibody Promiximab

(1) Examination of the in vitro Activity of the anti-CD 56 antibody Promiximab with CCK-8

Culturing human small cell lung cancer cells NCI-H526 and NCI-H69 in RPMI1640 culture medium containing 20% fetal calf serum, and culturing in 5% CO2 at 37 deg.C constant temperature cell culture box; collecting CD56 positive lung cancer cells in logarithmic growth phase, counting and adjusting cell density; laying 96-well plates, wherein the cell density of NCI-H526 and NCI-H69 is 10000/well and the volume is 100 mu L/well according to the growth speed of different cells; the cells were cultured in an incubator for 24 hours and then treated with chemicals. Diluting the antibody Promiximab with 20% fetal calf serum RPMI1640 culture medium to initial concentration of 2.4 μ M, filtering with 0.22 μ M filter, and storing at 4 deg.C; add the gradient diluted sample to the 96-well plate plated with cells. 8 concentration gradients were designed for each drug, 3 duplicate wells were set for each concentration gradient, resulting in final antibody concentration gradients of 1.2. mu.M, 300nM, 75nM, 18.75nM, 4.69nM, 1.17nM, 0.29nM, 0.07nM, 0.02nM, and a dosing regime of 100. mu.L/well. The sample was added and gently tapped at the edge of the well plate and mixed, and the mixture was cultured in a 5% CO2 cell incubator at 37 ℃ for 72 hours. Observing the growth condition of the cells under a microscope every 24 hours; a96-well plate was filled with 20. mu.L/well of CCK-8 reagent (Dojindo) filtered through a 0.22 μm filter; incubating at 37 ℃ for 1-3h in the dark; the well plate was placed at 450nm in an enzyme linked immunosorbent assay, the OD of each well was measured and the average value for each group was calculated. The inhibition ratio (%) (control group-administered group)/control group × 100%. IC50 was calculated using GraphPad Prism 6.0. The experimental results showed (as shown in fig. 12) that the IC50 of the anti-CD 56 antibody against CD56 positive cells NCI-H69 was 968.54 ± 34.76 nM; the IC50 of the anti-CD 56 antibody against NCI-H526, a CD56 positive cell, was 792.24. + -. 41.21 nM.

(2) Promiximab in vivo antitumor Activity

The cells for cell culture and inoculation are cultured by using an RPMI1640 culture medium containing 20% fetal calf serum to human CD56 positive lung cancer cell NCI-H526 and are placed in a 5% CO2 constant-temperature cell culture box for culture at 37 ℃; changing the liquid once 24 hours before inoculation; cells in the logarithmic growth phase were collected, washed twice with serum-free and antibiotic-free RPMI1640 medium, and counted. Cell density was adjusted to 10 using serum-free, antibiotic-free RPMI1640 medium and matrigel (final concentration > 4mg/mL)⁸Viable cells/ml.

The experimental animal is a BALB/c athymic nude mouse (nude mouse, Beijing Huafukang for short), the mouse is 5-6 weeks old, and the weight is 16-18 g; experimental animal feeding management: the breeding feed, drinking water, bedding and cages were changed once a week while observing the physiological state of the animals.

Cell inoculation: the inoculation amount is more than 1-2 multiplied by 10⁷Each cell, the inoculation volume is 100-; the tumor volume of the nude mice was observed every 3 days 7-15 days after the tumor cells were inoculated. When the tumor volume reaches 150mm3, grouping and administration can be carried out; nude mice with uniform tumor size were picked and randomly grouped according to experimental purpose, and the groups of in vivo anti-tumor experiments in NCI-H526 subcutaneous model are shown in table 1 below:

TABLE 1 NCI-H526 subcutaneous model grouping

NCI-H526 subcutaneous model grouping	Number (only)
		Control	6
Promiximab(10mg/kg)	6

Weighing the weight of each group of nude mice, measuring the tumor volume, and starting to administer the drug in a tail vein injection mode; the medicine is taken once every three days and is continuously taken for 3 times; monitoring the growth condition of the tumor of the nude mice: from the start of administration, the tumor length and length were measured every three days using a vernier caliper in mm, and the tumor volume was calculated as V ═ length × length/2. The experimental results show that Promiximab has certain activity against CD56 positive tumors in vivo (as shown in FIG. 13).

(3) Pathologically detecting toxicity of Promiximab in vivo

Tissue samples of heart, liver, spleen, lung and kidney of control and antibody s drug-treated groups of nude mice were fixed in 4% phosphate-buffered formaldehyde and paraffin-embedded according to a conventional method. Tissue sections were stained with hematoxylin and eosin (H & E) and analyzed under the mirror to assess their destruction of normal tissues. The experimental results showed that no significant tissue lesions were observed in each organ of the Promiximab antibody group compared to the normal organs of the control group, indicating no significant toxic side effects (as shown in fig. 14).

From the results of the examples, it can be seen that: the invention provides an anti-CD 56 antibody, which has high affinity, high internalization efficiency and good specificity, can be effectively applied to the preparation of medicaments for diagnosing and treating diseases of anti-tumor, immune system and nervous system, and has wide application prospect.

Sequence listing

<110> Sichuan university

<120> anti-CD 56 antibodies and uses thereof

<130>A170803K

<141>2017-09-15

<160>20

<170>SIPOSequenceListing 1.0

<210>1

<211>115

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ala Phe Thr Asn Tyr

20 25 30

Asn Met Tyr Trp Met Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asp Pro Tyr Asn Gly Gly Thr Arg Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met His Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Asp Ser Thr Gly Tyr Trp Gly Gln Gly Thr Thr Leu Thr

100 105 110

Val Ser Ser

115

<210>2

<211>120

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr

20 25 30

Gly Met Asn Trp Val Lys Gln Thr Pro Gly Lys Gly Leu Lys Trp Met

35 40 45

Gly Trp Ile Asn Thr Tyr Thr Gly Glu Ser Thr Tyr Thr Asp Asp Phe

50 55 60

Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Asn Asn Ile Arg Asn Glu Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser Pro Tyr Tyr Tyr Gly Ser Gln Arg Gly Tyr Phe Asp Val

100 105 110

Trp Gly Ala Gly Thr Thr Val Thr

115120

<210>3

<211>115

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Lys Arg Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Arg

1 5 10 15

Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Gly Met

20 25 30

Ala Trp Val Arg Gln Val Pro Gly Lys Gly Pro Glu Trp Ile Ala Phe

35 40 45

Ile Ser Asn Leu Ala Tyr Ser Ile Tyr Tyr Ile Asp Thr Val Thr Gly

50 55 60

Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr Leu Glu

65 70 75 80

Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Ile Tyr Tyr Cys Ala Arg

85 90 95

Val Ser Gly Thr Trp Leu Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr

100 105 110

Val Ser Ala

115

<210>4

<211>112

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Arg Lys Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ser Gly Met Ala Trp Val

20 25 30

Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val Ala Phe Ile Ser Asn

35 40 45

Leu Ala Tyr Ser Ile Tyr Tyr Ala Asp Thr Val Thr Gly Arg Phe Thr

50 55 60

Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr Leu Glu Met Ser Ser

65 70 75 80

Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg Ile Ser Tyr

85 90 95

Asp Tyr Ile Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

100 105 110

<210>5

<211>117

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Asp Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 510 15

Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr

20 25 30

Gly Met Ala Trp Val Arg Gln Val Pro Gly Lys Gly Pro Glu Trp Ile

35 40 45

Ala Phe Ile Ser Asn Leu Ala Tyr Ser Ile Tyr Tyr Ile Asp Thr Val

50 55 60

Thr Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Val Ser Gly Thr Trp Leu Gly Tyr Trp Gly Gln Gly Thr Leu

100 105 110

Val Thr Val Ser Ala

115

<210>6

<211>114

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Tyr Tyr

20 25 30

Met His Trp Val Lys Gln Ser His Val Lys Ser Leu Glu Trp Ile Gly

35 40 45

Arg Ile Asn Pro Tyr Asn Gly Ala Thr Thr Tyr Asn Gln Asn Phe Lys

50 55 60

Asp Lys Ala Ser Leu Thr Val Asp Lys Ser Ser Ser Thr Val Tyr Met

65 70 75 80

Glu Leu His Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Tyr Pro Leu Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val

100 105 110

Ser Ala

<210>7

<211>112

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Asp Val Leu Leu Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Ile Leu His Ser

20 25 30

Asn Gly Asn Thr Tyr Phe Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly

85 90 95

Ser His Val Pro Phe Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210>8

<211>107

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Asp Ile Ile Ile Ser Arg Ser Pro Ala Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Arg Val Ser Leu Ser Cys Arg Ala Ser Leu Ile Ile Thr Asp Tyr

20 25 30

Leu His Trp Tyr Gln Gln Pro Ser Asn Glu Ser Pro Arg Leu Leu Ile

35 40 45

Arg Tyr Val Cys Leu Ala Ile Ser Gly Ile Pro Ser Ser Phe Ala Asp

50 55 60

Ser Gly Ser Arg Thr Asp Phe Pro Leu Cys Ile Asn Ser Val Lys Pro

65 70 75 80

Glu His Val Gly Val Tyr Tyr Cys Gln Asn Gly His Thr Phe Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Val Lys

100 105

<210>9

<211>107

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Asp Ile Leu Leu Thr Gln Ser Pro Ala Ile Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Val Ser Phe Ser Cys Arg Ala Ser Glu Asn Ile Gly Thr Ser

20 25 30

Met His Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser

65 70 75 80

Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Thr Asn Ser Trp Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Asn Leu Glu Ile Lys

100 105

<210>10

<211>107

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Asp Ile Val Val Thr Gln Phe Pro Asp Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Ser Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Ile Arg Asn Asn

20 25 30

Leu His Trp Tyr Gln Gln Gln Ser His Glu Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Thr

65 70 75 80

Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser Asn Asn Trp Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210>11

<211>346

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gagatccagc tgcagcagtc tggacctgag ctggtgaagc ctggggcttc agtgaaggta 60

tcctgcaagg cttctggtta tgcgttcact aactacaaca tgtactggat gaaacagagc 120

catggaaaga gccttgagtg gattggatat attgatcctt acaatggtgg tactaggtac 180

aaccagaagt tcaagggcaa ggccacattg actgttgaca agtcctccag cacagcctac 240

atgcatctca acagcctgac atctgaggac tctgcagtct attactgtgc aagagaggat 300

agtaccggct actggggcca aggcaccact ctcacagtct cctcag 346

<210>12

<211>360

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cagatccagt tggtgcagtc tggacctgaa ctgaagaagc ctggagagac agtcaagatc 60

tcctgtaagg cttctggata taccttcaca aactatggaa tgaactgggt gaagcagact 120

ccaggaaagg gtttaaagtg gatgggctgg ataaacacct atactggaga gtcaacatat 180

actgatgact tcaagggacg gtttgccttt tctttggaga cctctaccag caccgcctat 240

ttgcagatca acaacatcag aaatgaggac acggctacat atttctgtgc aagatcccct 300

tattactacg gtagtcaacg ggggtacttc gatgtctggg gcgcagggac cacggtcacc 360

<210>13

<211>346

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

aaacgggtgg agtctggggg aggcttagtg cagcctggag ggtcccggaa actctcctgt 60

gcagcctctg gattcacttt cagtgactac ggaatggcgt gggttcgaca ggttccaggg 120

aaggggcctg agtggattgc attcattagt aatttggcat atagtatcta ctatatagac 180

actgtgacgg gccgattcac catctctaga gagaatgcca agaacaccct gtacctggaa 240

atgagcagtc tgaggtctga ggacacagcc atatactact gtgcaagggt ttctgggacc 300

tggcttggtt actggggcca agggactctg gtcactgtct ctgcag 346

<210>14

<211>339

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

tggagtctgg gggaggctta gtgcagcctg gagggtcccg gaaactctcc tgtgcagcct 60

ctggattcac tttcagtgac tccggaatgg cgtgggttcg acaggctcca gggaaggggc 120

ctgagtgggt agcattcatt agtaatttgg catatagtat ctactatgca gacactgtga 180

cgggccgatt caccatctct agagagaatg ccaagaacac cctgtacctg gaaatgagca 240

gtctgaggtc tgaggacaca gccatgtact actgtgcaag gatctcctat gattacattg 300

actactgggg ccaaggcacc actctcacag tctcctcag 339

<210>15

<211>351

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gacgtgatgc tggtggagtc tgggggaggc ttagtgcagc ctggagggtc ccggaaactc60

tcctgtgcag cctctggatt cactttcagt gactacggaa tggcgtgggt tcgacaggtt 120

ccagggaagg ggcctgagtg gattgcattc attagtaatt tggcatatag tatctactat 180

atagacactg tgacgggccg attcaccatc tctagagaga atgccaagaa caccctgtac 240

ctggaaatga gcagtctgag gtctgaggac acagccatat actactgtgc aagggtttct 300

gggacctggc ttggttactg gggccaaggg actctggtca ctgtctctgc g 351

<210>16

<211>344

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ggtccagctg caacagtctg gacctgaact ggtgaagcct ggggcttcag tgaagatatc 60

ctgcaaggct tctggttact cattcactga ctactacatg cactgggtga agcaaagcca 120

tgtaaagagc cttgagtgga ttggacgtat taatccttac aatggtgcta ctacctacaa 180

ccagaatttc aaggacaagg ccagtttgac tgtagataag tcctccagca cagtctacat 240

ggagctccac agcctgacat ctgaggactc tgcagtctat tactgtgcaa gatacccttt 300

gtttggttac tggggccaag ggactctggt cactgtctct gcag 344

<210>17

<211>337

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gatgttttgc tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60

atctcttgca gatctagtca gaatatttta catagtaatg gcaacaccta tttcgaatgg 120

tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300

ttcacgttcg gaggggggac caagctggaa ataaaac 337

<210>18

<211>322

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gacattatta tatctcgttc tccagccacc ctgtctgtga ctccaggaga tagagtctct 60

ctttcctgca gggccagtct gattattacc gactacttac actggtatca acaaccatca 120

aatgaatctc caaggcttct catcagatat gtttgcctgg ccatctctgg gatcccctcc 180

tccttcgctg acagtggatc acggacagat ttccctctct gtatcaacag tgtgaaacct 240

gaacatgttg gagtgtatta ctgtcaaaat ggtcacacct ttccgctcac gttcggtgct 300

gggaccaagc tggaagtgaa ac 322

<210>19

<211>322

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gacatcttgc tgactcagtc tccagccatc ctgtctgtga gtccaggaga aagagtcagt 60

ttctcctgca gggccagtga gaacattggc acaagcatgc actggtatca gcaaagaaca 120

aatggttctc caaggcttct cataaagtat gcttctgagt ctatctctgg gatcccttcc 180

aggtttagtg gcagtggatc agggacagat tttactctta gcatcaacag tgtggagtct 240

gaagatattg cagattatta ctgtcaacaa actaatagct ggccgtacac gttcggaggg 300

gggaccaacc tggaaataaa ac 322

<210>20

<211>322

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gacgttgtgg taactcagtt tccagacacc ctgtctgtga ctccaggaga tagcgtcagt 60

ctttcctgca gggccagcca aagtattcgt aacaacctac actggtatca acaacaatca 120

catgagtctc caaggcttct catcaagtat gcttcccagt ccatctctgg gatcccctcc 180

aggttcagtg gcagtggatc agggacagat ttcactctca gtatcaacag tgtggagact 240

gaagattttg gaatgtattt ctgtcaacag agtaacaact ggccgtacac gttcggaggg 300

gggaccaagc tggaaataaa ac 322

Claims

1. An anti-CD 56 antibody characterized by: comprises a heavy chain variable domain, a light chain variable domain, a constant region; the amino acid sequence of the heavy chain variable domain is Seq ID NO 1; the amino acid sequence of the light chain variable domain is SeqID NO. 7.

2. The anti-CD 56 antibody according to claim 1, wherein: the constant region is a natural antibody constant region or an antibody constant region after genetic engineering.

3. A gene encoding the anti-CD 56 antibody of claim 1 or 2.

4. The gene encoding anti-CD 56 antibody according to claim 3, wherein: including the gene encoding the variable domain of the heavy chain, the nucleotide sequence is shown in Seq ID NO: 11.

5. The gene encoding an anti-CD 56 antibody according to claim 3 or 4, wherein: also included are genes encoding light chain variable domains, such as the sequence ID NO 17.

6. A vector comprising the gene according to any one of claims 3 to 5.

7. The vector of claim 6, wherein the vector is an expression vector.

8. The vector according to claim 6 or 7, wherein the vector is: at least one of pAZ-V5-hCH, pAZ-V5-hCL, pTT5 or pCEP4 Mammalian Expression Vector.

9. A host cell comprising the vector of any one of claims 6 to 8.

10. Use of the anti-CD 56 antibody of claim 1 or 2, the gene of any one of claims 3-5, the vector of any one of claims 6-8, or the host cell of claim 9 for the preparation of a medicament for the diagnostic treatment of small cell lung cancer.

11. Use of the anti-CD 56 antibody of claim 1 or 2 in the preparation of an antibody complex.

12. Use of an anti-CD 56 antibody according to claim 11 for the preparation of an antibody complex, characterized in that: the antibody complex is coupled with at least one of a fluorescent molecule, a cytotoxic molecule, an antibody or a polypeptide.

13. An antibody complex prepared by coupling the anti-CD 56 antibody of claim 1 or 2 to a fluorescent molecule, cytotoxic molecule, antibody or polypeptide.

14. Use of an antibody complex according to claim 13 for the preparation of a medicament for the diagnostic treatment of small cell lung cancer.