CN107488231A - Anti- CD56 antibody and application thereof - Google Patents

Abstract

The invention belongs to antibody production techniques field, and in particular to a kind of anti-CD56 antibody and application thereof.The present invention provides a kind of anti-CD56 antibody, and the antibody includes：Including heavy-chain variable domains, light variable domains, constant region；The heavy-chain variable domains are the heavy chain complementarity-determining region identical domain with the antibody, and the light variable domains are to determine area's identical domain with the light chain complementarity of the antibody.The present invention can in the heavy-chain variable domains of 6 kinds of different aminoacids sequences and the light variable domains of 4 kinds of amino acid sequences random combine two-by-two, obtain the anti-CD56 antibody of different potency.The anti-CD56 affinity of antibodies of the present invention are high, internalization efficiency is fast and specificity is good, and antibody binding CD56 affinity is 10^‑9To 10^‑14Between M, it can be effectively used for preparing diagnosis and the medicine of antitumor, immune system and the nervous system disease.

Description

Anti-CD56 antibodies and uses thereof

technical field

The invention belongs to the technical field of antibody preparation, and in particular relates to an anti-CD56 antibody and its application.

Background technique

Among malignant tumors, lung cancer has the highest morbidity and mortality. When lung cancer patients go to the hospital for treatment, more than 80% have lost the best time for surgical operation and multidisciplinary combined radical cure. Despite decades of efforts by relevant experts and doctors, the overall 5-year survival rate of lung cancer patients in my country is still lower than 15%. Lung cancer can be divided into non-small cell lung cancer (Non-Small Cell Lung Cancer, NSCLC) and small cell lung cancer (Small Cell Lung Cancer, SCLC), the former accounts for about 85%, and the latter accounts for about 13-15%. Originating from neuroendocrine precursor cells, SCLC is a highly aggressive, undifferentiated tumor characterized by rapid proliferation and early metastasis. Although SCLC patients initially respond well to radiotherapy and chemotherapy, the possibility of recurrence is extremely high and drug resistance is prone to occur, resulting in insensitivity to further treatment.

In recent years, with the in-depth understanding of tumor pathogenesis at the level of genes and signaling pathways, targeted therapy has made breakthroughs, representing the latest development direction of tumor treatment. Targeted therapy is aimed at key growth factors/receptors, genes, regulatory molecules, etc. in the process of tumor development, using monoclonal antibodies and small molecule drugs to block it, so as to achieve the purpose of treating tumors. The application of targeted therapy drugs such as MabThera (Rituximab, CD20 antibody drug) and imatinib (Imatinib, Gleevec, small molecule tyrosine kinase inhibitor) has made lymphoma, chronic myeloid leukemia and gastrointestinal diseases Revolutionary changes have taken place in the treatment of tumors and the like. The targeted therapy of NSCLC in lung cancer has also made great progress, while the progress of antibody-targeted therapy for SCLC is slow, and the development of targeted therapy drugs for lung cancer has great clinical significance.

The occurrence and development of small cell lung cancer is a complex process involving multiple factors, multiple steps, and multiple genes. There are genetic and epigenetic changes at the molecular level, which eventually lead to unrestricted proliferation, angiogenesis, and immune escape of cancer cells. Many oncogenes (such as c-myc) and tumor suppressor genes (P53, RB1) are involved in the occurrence and development of small cell lung cancer; oncogenic signaling pathways such as receptor tyrosine kinases, PI3Ks/AKT/mTOR, Notch, Wnt, etc. Abnormal activation in cell lung cancer; c-Kit, EGFR, IGF-1R, VEGF/VEGFR, MET and other growth factors and receptor families, heat shock protein 90, Bcl-2 family, CD56, DLL3 and other functional proteins, immune regulatory molecules PD-1, PD-L1, etc. are also involved in the inhibition of apoptosis, promotion of proliferation, cycle regulation, invasion and migration, angiogenesis, immune escape and other processes of small cell lung cancer. In recent years, with the in-depth understanding of the genome and molecular mechanism of SCLC, researchers have explored a variety of therapeutic approaches targeting SCLC, including targeting receptor tyrosine kinases (RTKs) and their downstream signaling mediators such as Ras and PI3K /mTOR, as well as angiogenesis, apoptosis, epigenetics and immunotherapy targeting small cell lung cancer, have little effect, so new treatments are urgently needed.

CD56, also known as Neural Cell Adhesion Molecule 1 (NCAM1), is a membrane glycoprotein in the immunoglobulin (Ig) superfamily and one of the nerve cell adhesion molecules. It plays an important role in the growth and development of the nervous system, is highly expressed in cancer cells, participates in cell migration and invasion, and affects the metastatic spread of tumors. CD56 is an important marker and potential target of lung cancer. CD56 is specifically and highly expressed on the surface of almost most small cell lung cancer cell membranes. It is an ideal target for lung cancer antibody therapy and antibody-drug conjugate therapy.

Contents of the invention

The technical problem to be solved by the present invention is to provide an anti-CD56 antibody and its application.

The present invention provides an anti-CD56 antibody, which includes: a heavy chain variable domain, a light chain variable domain, and a constant region; the heavy chain variable domain is a complementarity determining region with the heavy chain of the antibody The same domain, the light chain variable domain is the same domain as the light chain complementarity determining region of the antibody.

Wherein, in the above-mentioned anti-CD56 antibody, the amino acid sequence of the heavy chain variable domain is Seq ID NO:1, Seq ID NO:2, Seq ID NO:3, Seq ID NO:4, Seq ID NO:5 Or any one of Seq ID NO:6.

Seq ID NO: 1 anti-CD56 antibody heavy chain variable domain 1

Seq ID NO: 2 anti-CD56 antibody heavy chain variable domain 2

Seq ID NO: 3 anti-CD56 antibody heavy chain variable domain 3

Seq ID NO: 4 Anti-CD56 antibody heavy chain variable domain 4

Seq ID NO:5 anti-CD56 antibody heavy chain variable domain 5

Seq ID NO:6 Anti-CD56 antibody heavy chain variable domain 6

Wherein, in the above-mentioned anti-CD56 antibody, the amino acid sequence of the light chain variable domain is any one of Seq ID NO:7, Seq ID NO:8, Seq ID NO:9 or Seq ID NO:10.

Seq ID NO: 7 anti-CD56 antibody light chain variable domain 1

Seq ID NO:8 anti-CD56 antibody light chain variable domain 2

Seq ID NO: 9 anti-CD56 antibody light chain variable domain 3

Seq ID NO: 10 Anti-CD56 antibody light chain variable domain 4

Wherein, in the above-mentioned anti-CD56 antibody, the constant region is any one of a natural antibody constant region or a genetically engineered antibody constant region. The natural antibody is IgG1, IgG2, IgG3 or IgG4, etc.

The present invention also provides a gene encoding the above-mentioned anti-CD56 antibody.

Wherein, the gene encoding the anti-CD56 antibody includes the gene encoding the variable domain of the heavy chain, and the nucleotide sequences are such as Seq ID NO: 11, Seq ID NO: 12, Seq ID NO: 13, Seq ID NO: 14, Shown in Seq ID NO:15 or Seq ID NO:16.

Seq ID NO: 11 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 1:

GAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGGTATCCTGCAAGGCTTCTGGTTATGCGTTCACTAACTACAACATGTACTGGATGAAACAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTGATCCTTACAATGGTGGTACTAGGTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGCATCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGAGGATAGTACCGGCTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG

Seq ID NO:12 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 2:

CAGATCCAGTTGGTGCAGTCTGGACCTGAACTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGTAAGGCTTCTGGATATACCTTCACAAACTATGGAATGAACTGGGTGAAGCAGACTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTATACTGGAGAGTCAACATATACTGATGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAGACCTCTACCAGCACCGCCTATTTGCAGATCAACAACATCAGAAATGAGGACACGGCTACATATTTCTGTGCAAGATCCCCTTATTACTACGGTAGTCAACGGGGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACC

Seq ID NO:13 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 3:

AAACGGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGTTCCAGGGAAGGGGCCTGAGTGGATTGCATTCATTAGTAATTTGGCATATAGTATCTACTATATAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATATACTACTGTGCAAGGGTTTCTGGGACCTGGCTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG

Seq ID NO:14 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 4:

TGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTCCGGAATGGCGTGGGTTCGACAGGCTCCAGGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGCAAGGATCTCCTATGATTACATTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG

Seq ID NO:15 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 5:

GACGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGTTCCAGGGAAGGGGCCTGAGTGGATTGCATTCATTAGTAATTTGGCATATAGTATCTACTATATAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATATACTACTGTGCAAGGGTTTCTGGGACCTGGCTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCG

Seq ID NO:16 encodes the nucleotide sequence of anti-CD56 antibody heavy chain variable domain 6:

GGTCCAGCTGCAACAGTCTGGACCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACTACATGCACTGGGTGAAGCAAAGCCATGTAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGCTACTACCTACAACCAGAATTTCAAGGACAAGGCCAGTTTGACTGTAGATAAGTCCTCCAGCACAGTCTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATACCCTTTGTTTGGTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG

Further, the gene encoding the anti-CD56 antibody also includes the gene encoding the variable domain of the light chain, and the nucleotide sequence is such as Seq ID NO: 17, Seq ID NO: 18, Seq ID NO: 19 or Seq ID NO: 20 shown.

Seq ID NO:17 encodes the nucleotide sequence of anti-CD56 antibody light chain variable domain 1:

GATGTTTTGCTGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAATATTTTACATAGTAATGGCAACACCTATTTCGAATGGTACCTGCAGAAACCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGTTCCGTTCACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC

Seq ID NO:18 encodes the nucleotide sequence of anti-CD56 antibody light chain variable domain 2:

GACATTATTATATCTCGTTCTCCAGCCACCCTGTCTGTGACTCCAGGAGATAGAGTCTCTCTTTCCTGCAGGGCCAGTCTGATTATTACCGACTACTTACACTGGTATCAACAACCATCAAATGAATCTCCAAGGCTTCTCATCAGATATGTTTGCCTGGCCATCTCTGGGATCCCCTCCTCCTTCGCTGACAGTGGATCACGGACAGATTTCCCTCTCTGTATCAACAGTGTGAAACCTGAACATGTTGGAGTGTATTACTGTCAAAATGGTCACACCTTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAAGTGAAAC

Seq ID NO:19 encodes the nucleotide sequence of anti-CD56 antibody light chain variable domain 3:

GACATCTTGCTGACTCAGTCTCCAGCCATCCTGTCTGTGAGTCCAGGAGAAAGAGTCAGTTTCTCCTGCAGGGCCAGTGAGAACATTGGCACAAGCATGCACTGGTATCAGCAAAGAACAAATGGTTCTCCAAGGCTTCTCATAAAGTATGCTTCTGAGTCTATCTCTGGGATCCCTTCCAGGTTTAGTGGCAGTGGATCAGGGACAGATTTTACTCTTAGCATCAACAGTGTGGAGTCTGAAGATATTGCAGATTATTACTGTCAACAAACTAATAGCTGGCCGTACACGTTCGGAGGGGGGACCAACCTGGAAATAAAAC

Seq ID NO:20 encodes the nucleotide sequence of anti-CD56 antibody light chain variable domain 4:

GACGTTGTGGTAACTCAGTTTCCAGACACCCTGTCTGTGACTCCAGGAGATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAGTATTCGTAACAACCTACACTGGTATCAACAACAATCACATGAGTCTCCAAGGCTTCTCATCAAGTATGCTTCCCAGTCCATCTCTGGGATCCCCTCCAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACTCTCAGTATCAACAGTGTGGAGACTGAAGATTTTGGAATGTATTTCTGTCAACAGAGTAACAACTGGCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC

The present invention also provides a vector containing the above anti-CD56 antibody coding gene, the vector is an expression vector, preferably pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ- At least one of V5-hCL, pAZ-V5-hCL, pTT5 or pCEP4 Mammalian Expression Vector.

The present invention also provides a host cell of the above-mentioned vector.

In addition, the present invention also provides the above-mentioned anti-CD56 antibody, the gene encoding the variable domain of the heavy chain and the variable domain of the light chain of the antibody, the vector containing the gene and the host cell used in the preparation of diagnosis and treatment of tumors, immune system or Use in medicine for nervous system diseases; especially use in preparing antibody complexes.

Further, in the use of the above-mentioned anti-CD56 antibody in preparing an antibody complex, the antibody complex is an antibody complex coupled with at least one of fluorescent molecules, cytotoxic molecules, antibodies or polypeptides.

The present invention also provides an antibody complex, which is prepared by coupling the above-mentioned anti-CD56 antibody to a fluorescent molecule, a cytotoxic molecule, an antibody or a polypeptide.

Moreover, the present invention also provides the use of the antibody complex in the preparation of drugs for the diagnosis and treatment of tumors, immune system or nervous system diseases.

The beneficial effects of the present invention are: the present invention provides an anti-CD56 antibody, which has 6 optional heavy chain variable domains and 4 optional light chain variable domains, any one or any number of which can be selected The heavy chain variable domains and light chain variable domains were combined to obtain anti-CD56 antibodies with different titers. The anti-CD56 antibody of the present invention has high affinity, fast internalization efficiency and good specificity, and the binding affinity of the antibody to CD56 is between 10 ^-9 and 10 ^-14 M, and can be effectively used for preparing anti-tumor, immune system and nervous system diseases Diagnosis and treatment drugs, and the anti-CD56 antibody of the present invention can also be used in combination with other antibodies, functional molecules, drugs and clinical treatment methods for the diagnosis and treatment of tumors, immune system and nervous system diseases, and has a good application prospect.

Description of drawings

Figure 1 shows the purity, molecular weight, target recognition and antibody specificity of Promiximab (Promiximab) detected by SDS-PAGE electrophoresis and Western-Blot

Figures A and M are Markers, lanes 1 to 6 are human CD56 extracellular end (CD56ECD), small cell lung cancer cell lines NCI-H526, NCI-H524, NCI-H69, NCI-H128, NCI-H446 cell lysates The expression in the non-reduced state, the bottom is the sample in the reduced state of the corresponding sample; B, M are Markers, 1-4 are the non-reduced loading of the extracellular end of CD56, the non-reducing loading of the extracellular end of CD56, and the non-reducing loading of the CD56 extracellular end. The extracellular end was reduced and loaded, and the CD56 extracellular end was desugared and reduced; C, the picture shows the cross-reactivity of Promiximab, using CD56ECD as a control, promiximab cross-reacts with human spleen cell lysate, NK cell lysate, and mouse spleen cell lysate (corresponding to swimming lanes 1-4); and compared with commercialized anti-CD56 antibody 123C3 to detect its tissue specificity.

Figure 2 Detection of PI value of Promiximab by capillary isopoint focusing method

The capillary isopoint focusing method is used to detect the PI value of Promiximab, and the isoelectric point of Promiximab expressed and purified by eukaryotic cells is 7.89.

Figure 3 shows the combination of CD56 antibody and CD56 positive cell lysate detected by Western-Blot

Western-Blot detection results of CD56 antibody 1-24 and CD56 positive cells NCI-H526 and NCI-H446 (CD56 weak positive), the first lane corresponding to each antibody is NCI-H526 lysate, the second lane is NCI-H446 Cell lysate, the results showed that the anti-CD56 antibody could recognize CD56 linear epitope except No. 2.

Figure 4-9 shows CD56 antibody affinity detection

The affinity of 24 kinds of anti-CD56 antibodies to human CD56 ectodomain was analyzed by Biolayer interferometry technology.

Figure 10 shows Promiximab affinity detection

Analysis by Biolayer interferometry showed that the affinity between promiximab and CD56ECD was 0.78pmol (k _a (1/Ms)=1.27E+05, k _d (1/s)<1.0E-07, K _D <7.8E-13).

Figure 11 shows the detection of the internalization effect after the targeting of the anti-CD56 antibody Promiximab combined with CD56 by flow cytometry

Figure A, the combination of Promiximab and small cell lung cancer cell line membrane antigen CD56, small cell lung cancer was incubated with PBS (black part), promiximab (hollow line) respectively; Figure B, the internalization efficiency of Promiximab was measured, the small cell lung cancer cell group was incubated with PBS (black area, 4°C, 3h), promiximab (solid line, 4°C, 3h), promiximab (dashed line, 37°C, 3h); targets of Promiximab in NCI-H526, NCI-H524 and NCI-H69 cell lines The tropism is better, and the internalization efficiency is 68.19%, 53.14% and 64.97%, respectively. In conclusion, the newly prepared CD56-targeting antibody promiximab has specific binding ability, high affinity and effective internalization efficiency.

Figure 12 shows the in vitro activity of the anti-CD56 antibody Promiximab checked with CCK-8

The results of CCK-8 anti-proliferation assay showed that the IC50 of Promiximab antibody against CD56 positive cell NCI-H69 was 968.54±34.76nM; the IC50 of anti-CD56 antibody against CD56 positive cell NCI-H526 was 792.24±41.21nM.

Figure 13 shows the anti-tumor activity of Promiximab in vivo.

To establish the subcutaneous tumor model of CD56-positive human small cell lung cancer NCI-H526 in nude mice, and study the antitumor activity of promiximab in vivo. The way of administration is the tail vein, once every two days, for three consecutive administrations. The results showed that in the NCI-H526 subcutaneous model, the promiximab (10mg/kg) dose group showed significant in vivo activity of inhibiting tumor growth on day 24. The results of body weight observation showed that there was no significant difference in body weight between the control group and the administration group, which preliminarily indicated that the toxicity of promiximab was very small.

Figure 14 shows the toxicity analysis of Promiximab on heart, liver, spleen, lung and kidney

The general condition evaluation of the mice was divided into body weight and pathological changes of major organs. On the 20th day after tail vein administration, the hearts, livers, spleens, lungs, and kidneys of nude mice in each experimental group were taken, and stained with H&E. The results showed that Promiximab was compared with normal organs in the control group, and no organs were found in the drug group. Obvious tissue lesions indicate no obvious side effects.

detailed description

The present invention provides an anti-CD56 antibody, which comprises: a heavy chain variable domain, a light chain variable domain, and a constant region; the heavy chain variable domain is determined by the complementarity with the heavy chain of the antibody The light chain variable domain is the same domain as the light chain complementarity determining region of the antibody.

Wherein, in the above-mentioned anti-CD56 antibody, the amino acid sequence of the heavy chain variable domain is Seq ID NO:1, Seq ID NO:2, Seq ID NO:3, Seq ID NO:4, Seq ID NO:5 Or any one of Seq ID NO:6.

Wherein, in the above-mentioned anti-CD56 antibody, the amino acid sequence of the light chain variable domain is any one of Seq ID NO:7, Seq ID NO:8, Seq ID NO:9 or Seq ID NO:10.

Wherein, in the above-mentioned anti-CD56 antibody, the constant region is a natural antibody constant region or a genetically engineered antibody constant region, and the natural antibody includes IgG1, IgG2, IgG3 or IgG4 antibodies.

Natural antibodies in the human body are composed of heavy chains and light chains, in which the structures of the variable region of the heavy chain and the variable region of the light chain are particularly important for the binding of antigens. The present invention has identified the sequences of the heavy chain variable region and the light chain variable region of the antibody, combined with the natural antibody constant region or the genetically engineered antibody constant region, to obtain an anti-CD56 antibody that can target CD56 cells, The antibody has good targeting and high affinity, and can be used to carry small molecule drugs to target CD56 cells, so as to improve the utilization efficiency and therapeutic effect of drugs.

The anti-CD56 antibody of the present invention can be secreted by conventional hybridoma cells, and can also be constructed by conventional gene recombination techniques. Cloning the resulting gene capable of encoding the CD56 antibody heavy chain variable domain and light chain variable domain into an expression vector with an antibody constant region gene, the vector comprising pAZ-V5-hCH, pAZ-V5-hCH , pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCL, pAZ-V5-hCL, pTT5, pCEP4 Mammalian Expression Vector, etc., expressed through eukaryotic cell expression systems, such as CHO and 293, etc., and then expressed by Protein purification method to obtain CD56 antibody.

The anti-CD56 antibody of the present invention can be coupled with fluorescent molecules, cytotoxic molecules, antibodies or polypeptides to form antibody complexes, and play a role in the preparation of drugs for the diagnosis and treatment of tumors, immune system or nervous system diseases.

The antibody of the present invention can also be prepared into various forms of pharmaceutical preparations according to conventional techniques of pharmacy, preferably injections, more preferably freeze-dried injections.

The antibody of the present invention can form a pharmaceutical composition with other drugs, and the composition can treat diseases together with other treatment methods, and the other treatment methods include chemotherapy, radiation therapy, and biological therapy.

The specific implementation of the present invention will be further explained through the following examples, but it does not mean that the protection scope of the present invention is limited to the scope described in the examples.

For specific experimental procedures, refer to the third edition of "Molecular Cloning" (Joseph Sambrook, Science Press) and similar experimental manuals.

Example 1 Preparation of anti-CD56 antibody hybridoma cell line by hybridoma technology and sequencing and identification of its light and heavy chain variable region genes

1. Animal immunity

Select healthy Balb/c female mice homologous to the myeloma cells used, and the age of the mice is 8-12 weeks. The antigen was expressed and purified CD56 extracellular segment (CD56 ECD) protein, diluted with normal saline to 4 mg/mL, 2 mg/mL, 1 mg/mL, 0.5 mg/mL, and 50 μL of the above-mentioned antigens of each concentration were taken for the initial immunization, and mixed with The immune adjuvant Quick Antibody-Mouse 5W is 1:1 by volume, and mixed thoroughly to obtain the adjuvant. The mice were immunized by injection into the calf muscles of the hind legs, each mouse was injected with 100 μL, and marked after immunization, and a booster immunization was given in the same way on the 21st day. On the 35th day, the tail blood was collected for ELISA determination, and the antibody titer was in the range of 1:10000-1:10000000, and then the same dose of CD56 extracellular fragment (CD56 ECD) protein was injected intravenously for antigen impulse immunization.

2. Preparation of feeder cells

The Balb/c mice were killed by cervical dislocation, soaked in 75% alcohol for 5 minutes, then placed in the ultra-clean workbench, placed on the flat plate or fixed on the dissecting board with the abdomen facing up. Use ophthalmic tweezers to pick up the abdominal skin of the mouse, and cut a small mouth with scissors. Be careful not to cut the peritoneum to prevent peritoneal fluid from leaking out. Then use scissors to bluntly dissect the upper and lower sides to fully expose the peritoneum. Wipe the peritoneum with an alcohol swab to disinfect. Draw 5mL of RPMI-1640 basal culture solution with a syringe and inject it into the abdominal cavity of the mouse. The syringe stays still, and the mouse is shaken or sucked repeatedly several times. Withdraw the intraperitoneal fluid with the original syringe and inject it into the centrifuge tube. Repeat this operation 3 to 4 times. Centrifuge at 1000rpm for 10min, discard the supernatant. Resuspend the cells with 20-50 mL of complete culture medium, add 100 μL/well dropwise to the culture plate, and place in the incubator for later use. Observe the growth state of the feeder cells. Generally, the well-grown feeder cells and macrophages are spindle-shaped or polygonal, with translucent cells and strong refraction.

3. Cell Fusion

Preparation of splenocytes: take a booster immunized mouse, dislocate and kill it after blood collection from the orbit, take the spleen after disinfection in 75% alcohol, remove connective tissue, prepare splenocyte suspension, transfer to a 50mL centrifuge tube, add RPMI1640 to 30mL, Centrifuge at 1500-2000rpm for 5 minutes, discard the supernatant, add RPMI1640 to 30mL, dilute the white blood cell diluent 20 times, count, and take 1× ¹⁰⁸ cells for use.

Preparation of myeloma cells: Take 3 bottles of myeloma cells in good growth state (the number of viable cells > 95%), blow them down completely, transfer them to a 50mL centrifuge tube, add RPMI1640 to 30mL, centrifuge at 1500-2000rpm for 5 minutes, discard Add RPMI1640 to the supernatant to 30 mL, dilute 10 times with RPMI1640, count, and take 2×10 ⁷ cells for use.

Cell mixing: according to the number of cells, spleen cells: myeloma = 5:1, centrifuged at 1500-2000rpm for 5 minutes.

Cell fusion: Drain the centrifuged supernatant, pop the precipitated cell mass into a paste, place in a 37°C water bath, add 1mL fusion agent within 1 minute, and stir the cells, place in a 37°C water bath for 45 seconds, add 1mL within 1 minute 1640 and stir the cells, add 5mL1640 within 2 minutes and stir the cells to terminate the fusion of the fusion agent, add 10mL 1640 within 2 minutes and stir the cells and centrifuge at 500rpm for 7 minutes, discard the supernatant. Add 10 mL of 1640 over 2 minutes and stir the cells.

Cell culture: Gently flick the cells evenly, slowly add HAT medium to the required volume, resuspend the cells, mix gently, and add to the pre-prepared feeder cell plate. Add 1 drop with a 10mL pipette (8mL/plate), add 80-100 microliters with a discharge gun (10mL/plate), cultivate and observe in a _CO2 incubator at 37°C.

Cell culture and medium replacement: From the first day after cell fusion, carefully observe the cells, record the growth status of the cells, the number of hybrid cell tumors per well, the number of blocks, whether the culture medium is polluted, and the status of the feeder cells. After 3 to 5 days of cultivation, the HAT culture medium was changed once, and after 10 days, the HT culture medium was changed to 20 days, and the 1640 complete culture medium was changed.

4. Cloning culture

Monoclonal culture is to obtain a hybridoma cell line that is both clonogenic and secretes antibodies. The hybrid cells in the early stage of fusion are very unstable and easily lose the ability to secrete antibodies, so they should be cloned and cultured as soon as possible (cell growth accounts for about 1/4-1/3 of the bottom area of the well). Usually after 2-3 times of cloning and culturing hybrid cells can be stabilized. In order to prevent hybrid cell variation or contamination, etc., it should be frozen and stored at the same time as cloning to prevent loss of species. Subcloning medium: RPMI1640+20%FBS+double antibody+growth factor (1×) Prepare a 96-well plate with feeder cells (2.5×104 cells/0.1mL/well). The hybridized cells of the positive wells were counted to make a cell suspension. Dilute the cell suspension into 4 groups of solutions according to the doubling method, that is, each group contains 10.5 cells per milliliter, and culture at 0.1 mL/well. About 10 days or so, select monoclonal wells and detect antibodies. If positive, clone again until 100% of the wells secrete antibodies. At this time, clones with strong antibody positive and good cell growth were selected for expanded culture, line establishment, and preservation.

5. Elisa method to screen anti-human CD56 positive clones

Using the conventional Elisa method, use 10mM 1×PBS to configure 1μg/mL Recombinant Human NCAM-1/CD56120isoform or express and purify the extracellular segment of CD56, use a 96-well plate, each well has a coating volume of 50μl, add it in the air and confluent At the bottom of the well, place it horizontally, seal it with plate sealing film, and place it overnight at 4°C. The overnight coated Elisa plate was washed 3 times with washing solution, and the Elisa plate was blocked with 2% BSA. The hybridoma culture supernatant was added to the Elisa detection plate and incubated at 37°C for 2 hours. After washing the plate 3 times, the detection secondary antibody was added and incubated at 37°C for 1 hour. After the plate was washed 3 times, TMB was added for color development, and the OD value was read with a microplate reader. Screen positive clones.

6. Cloning the heavy and light chain variable region gene sequence of CD56 antibody from the positive hybridoma monoclonal cell line

Collect positive monoclonal hybridoma cell lines in the logarithmic growth phase, lyse the cells with Trizol, extract the mRNA of the monoclonal hybridoma cell line, obtain cDNA by reverse transcription PCR, and obtain antibody variable region fragments by conventional PCR, and obtain them by gene sequencing Antibody heavy chain variable region and light chain variable region gene sequences.

Example 2 Preparation of Anti-CD56 Antibodies by Eukaryotic Expression System

1. Construction of anti-CD56 antibody expression vector

Through sequencing and sequence analysis, the amino acid sequences of the light and heavy chain variable regions of the candidate clones were obtained, and the corresponding sequences of each clone were selected to construct chimeric expression vectors for human-mouse chimeric antibody transformation. The light chain variable region gene whose amino acid sequence is shown in Seq ID NO:7 is constructed on the pTT5 expression vector, EcoR I-Kozak sequence-signal peptide-VH-constant region-stop codon-Hind III, light chain constant region The gene sequence is: NCBI Reference Sequence: NG_000834.1, EcoRI-signal peptide-VL-Ig kappa chain C region-Hind III. The heavy chain variable region gene whose amino acid sequence is shown in Seq ID NO:1 is cloned into the expression vector pTT5/anti-CD56 antibody-VH, composed of EcoR I-signal peptide-VH-Iggamma-1chain C region-Hind III, The sequence of the heavy chain constant region is: NCBI Reference Sequence: NG_001019.6. According to the expression system of mammalian cells, the codons were optimized and related gene fragments were synthesized. The antibody constructed above was named: anti-CD56 antibody Promiximab.

2. Extraction of anti-CD56 antibody heavy chain and light chain bacterial expression plasmids

Take out the constructed anti-CD56 antibody light chain and heavy chain expression plasmid bacteria solution, and inoculate 15 mL of LB liquid medium containing 100 μg/mL ampicillin at a ratio of 1:100. Place in a shaker for bacteria at 37°C, and shake at 225rpm/min overnight; Bacterial expansion culture: inoculate the overnight cultured bacterial solution in LB liquid medium containing 100 μg/mL ampicillin at a ratio of 1:100. Place in a shaker for bacteria at 37°C, shake and culture at 225rpm/min overnight; use PureYield ^TM Plasmid Maxiprep System to extract plasmids, the operation method is as follows: collect bacteria by centrifugation at 5,000g for 30 minutes at room temperature, discard the supernatant; add 12mL cell suspension (Cell Resuspension Solution), resuspend bacteria by pipetting with a pipette tip; add 12mL cell lysate solution (Cell Lysis Solution), invert 3-5 times to mix, incubate at room temperature for 3 minutes; add 12mL neutralization solution (Neutralization Solution), invert 10 - 15 times of mixing;

Centrifuge at 14,000 g for 20 min at room temperature using an angle rotor centrifuge. Put the blue PureYield ^TM Clearing Column on top of the white PureYield ^TM Maxi Binding Column, put it on the vacuum manifold after assembly, and pour the supernatant into the blue purification column. Turn on the vacuum device until the liquid has completely flowed through the two purification columns; remove the blue purification column, leave the white binding column on the vacuum manifold, add 5 mL of endotoxin-free washing solution to the binding column, and keep vacuuming, Until the liquid flows through the binding column; add 20mL PureYield ^TM purification column washing solution to the binding column, and keep vacuuming until the liquid flows through the binding column, and vacuumize until the binding column membrane is dry, about 5min; assemble 1.5mL according to the instructions EP tube, vacuum elutor base (Eluator ^™ Vacuum Elution Device) and binding column. Place it on the vacuum manifold; add 1 mL of nuclease-free water to the membrane of the binding column and let it stand for 1 minute. Apply vacuum until all liquid flows through the binding column. Repeat this operation once; take out the 1.5mL EP tube to obtain the plasmid.

3. Transient expression of anti-CD56 antibody in HEK293F

HEK293F cell culture operation steps, 24 hours before transfection, count the cells, and passage at a density of 80-90×105 cells/mL; when transfecting, count the cells, and the cell viability should reach more than 90%. Dilute the cells to 1.5-2.0×106 cells/mL; the final concentration of heavy chain and light chain is 0.5 μg/mL, the total amount of DNA (heavy chain and light chain) is 1 μg/mL, and the final concentration of PEI is 3.25 μg/mL mL, the system ratio is 1:1, the mixed solution system accounts for 10% of the total transfection system, and the DNA/PEI mixed solution is placed at room temperature for 10 minutes; the DNA/PEI mixed solution is added to the cell suspension, and the cells continue to be suspended after transfection Cultivate at 130rpm/min; the first transfected plasmid should be subjected to protein expression time gradient experiment, starting 24h after transfection, the cell number and cell viability should be detected. Cell supernatants were collected 48 h after transfection to detect proteins. Until 6 days after transfection, the best time to collect recombinant protein was determined. In the future, the recombinant protein will be harvested according to this time point.

4. Anti-CD56 antibody purification

Collect the cell suspension 6 days after transfection, centrifuge at 3000rpm/min for 5 minutes to remove cell debris; the concentration of the expression supernatant is the same as before; before purification, it is necessary to check whether the connections of each interface are tight. Open the UNICORN6.3 software and the AKTA Purifier 100 protein purification system; pack the column: take out the HiTrapTM protein A FF (5mL) chromatography column, connect the tube and fix the column, rinse the column with deionized water at a flow rate of 1mL/min until the conductance is balanced. The pressure protection of the chromatography column is set to 0.3Mpa; equilibration and loading, equilibration buffer, equilibration affinity chromatography column, flow rate 2mL/min, 20 column volumes of processed samples on the column, flow rate 1.5mL/min; protein washing And elution: wash the column with equilibration buffer, and elute the impurity protein until the UV value of the effluent is close to that of the buffer. Collect the flow-through, conduct SDS-PAGE detection, pass the eluent through the column at a flow rate of 1.5mL/min, collect the eluate when the UV value rises, and stop collecting until the UV value of the effluent is close to that of the eluent. The eluate was detected by protein concentration and SDS-PAGE; column cleaning and storage: wash the column with equilibration buffer until the conductance reached equilibrium, then rinse the chromatography column with NaOH solution with a concentration of 15mM at a flow rate of 2mL/min for a total of 5 washes. -10 column volumes; wash the chromatography column with ultrapure water at a flow rate of 2mL/min until the conductance is <0.1mSc/cm and the UV value tends to 0, then wash the chromatography column with 20% ethanol at a flow rate of 2mL/min for 20 column volume, remove the column and store at 4°C. Close the UNICORN6.3 software and the purification system; for the treatment of purified samples, wash the 30kDa Millipore ultrafiltration tube (30mL size) with ultrapure water before use, and rinse twice with replacement buffer PBS (pH6.0 or 7.0) ; Add the collected eluent to the rinsed ultrafiltration tube, centrifuge at 4000rpm/min for 15-20min, pour off the liquid in the lower layer of the ultrafiltration tube, add new replacement buffer to the upper layer tube, and mix the inner tube thoroughly For the protein sample in the sample, repeat the above steps 3-4 times, replace the buffer of the protein sample with the corresponding preservation solution and store it at -80°C.

The performance measurement of embodiment 3 anti-CD56 antibodies

Using the steps in Example 2, the six heavy chain variable region sequences Seq ID NO: 1 to Seq ID NO: 6 of the CD56 antibody and the light chain variable region sequences Seq ID NO: 7 to Seq ID NO: 10 were combined in pairs , obtained 24 kinds of anti-CD56 antibodies, respectively numbered as antibodies 1-24. Wherein the antibody Promiximab given in Example 2 is an antibody formed by combining the amino acid sequence Seq ID NO: 1 of the variable domain of the heavy chain and the amino acid sequence of the variable domain of the light chain such as Seq ID NO: 7, The number is 17, and the clone number is G22-1-D11. The above antibodies were detected by SDS-PAGE electrophoresis, Western-Blot, flow cytometry and Biacore affinity anti-CD56 antibody Promiximab, and the following results were obtained:

1. SDS-PAGE electrophoresis and Western-Blot to detect the purity, molecular weight, target recognition and antibody specificity of Promiximab

Cell sample preparation: collect small cell lung cancer cell lines, resuspend in PBS, centrifuge at 3500rpm for 5min, wash three times, add appropriate amount of cell lysate (containing protease inhibitors) according to the number of cells, mix well, place on ice for 30 -60min, put it on ice for 30-60min, centrifuge at 10000-14000g at 4°C for 10min, take the supernatant and aliquot it, mark it and store it at -20°C for later use, the concentration of pure protein for SDS-PAGE is 3μg/ well, the sample loading system is 10 μL, and when used for Wertern Blot detection, the protein sample concentration is 0.1-100ng/well. Cell lysate (or protein sample) was mixed with 5× denatured reducing sample buffer and 5× non-denatured non-reduced sample buffer respectively, mixed with denatured and reduced sample buffer, placed at 100°C for 5 minutes, then centrifuged at 10,000 rpm for 1 minute, Prepare samples for electrophoresis. According to the molecular weight of the antigen, the concentration of the separating gel is 8%, and the concentration of the stacking gel is 5%. Prepare the gel, install the electrophoresis system, add the electrode buffer, load the sample, and stabilize the voltage at 200V. According to the position of bromophenol blue and the purpose of the experiment , to judge the electrophoresis time, after the electrophoresis, remove the glass plate, peel off the gel, stain with Coomassie brilliant blue overnight, decolorize with decolorizing solution, and analyze the SDS-PAGE electrophoresis results. After performing the SDS-PAGE experiment according to the experimental procedure, one gel was used for Coomassie brilliant blue staining analysis, and one gel was used for spare use. Western-Blot was transferred to the membrane according to the operating procedures, and incubated for antibody exposure.

After testing, Promiximab has typical IgG domain characteristics, and the purity of purified Promiximab detected by SDS-PAGE is 96%, and it has typical light and heavy chain domains (as shown in FIG. 1A ). The results of Western-Blot detection (as shown in Figure 1B) show that Promiximab can bind to pure CD56, and can also bind to the protein after lysis of CD56-positive cells, as confirmed by antibody specificity experiments (as shown in Figure 1C). Antibody 123c3 has better specificity.

The Western-Blot detection results of antibodies and CD56 positive cells NCI-H526 and NCI-H446 (CD56 weakly positive) are shown in Figure 3. The first lane corresponding to each antibody is NCI-H526 lysate, and the second lane is NCI-H526 lysate. H446 cell lysate, the results showed that the anti-CD56 antibody could recognize CD56 linear epitope except No. 2.

2. BIACORE T200 affinity detection for the affinity of anti-CD56 antibody

The affinity detection antigen is Recombinant Human NCAM-1/CD56 120isoform, the molecular weight is 120kD, and the antigen is coupled to CM5 (BIACORE X100) or sCM5 (BIACORE T200) through the direct method; according to Rmax=(MWanalyte/MWligand)× RL×Sm, the actual coupling amount is 1.5 times of RL. Calculate the coupling amount suitable for detection of antigen at the same time as 120Ru; coupling operation: coupling buffer is 1×HBS-EP buffer, 50mM NaOH is used as cleaning solution. Reconstitute antigen to 10 μg/mL using sodium acetate solution at pH 4.5. Select amino coupling, enter 120Ru in the Target level, put the antigen sample, NaOH, ethanolamine, EDC, NSH, and empty test tubes into the corresponding positions in the sample tray according to the prompts; explore the regeneration conditions, and finally choose pH 1.7 glycine hydrochloric acid regeneration for 10s; All samples are set to duplicate wells; program settings, Flow pat selection 2-1 in the Kinetics/Affinity option; Regeneration selection 2; Contact time is 180s; Dissociation time is set to 5600s; Regeneration conditions: Gly 1.7, 10s; Samples are spaced apart and set up with three zero concentrations and three start ups. The 1:1 calculation model is used for fitting, and the kinetic analysis is shown in Figure 4. The results show that the affinity between Promiximab and CD56ECD is 0.78pmol (k _a (1/Ms)=1.27E+05, k _d (1/s)<1.0E-07, K _D <7.8E-13, as shown in Figure 10) , is a high-affinity antibody. Other antibodies also showed stronger affinity.

3. Detection of the isoelectric point of Promiximab by capillary isoelectric focusing electrophoresis

Capillary electrophoresis isoelectric focusing is a method for analyzing and separating samples according to the pI value of the samples. The ampholyte can form a pH gradient inside the capillary under the action of a DC voltage across the two terminals. Samples with amphoteric groups migrate toward the opposite direction of their charge at different speeds. When it migrates to the pH value of pI, its own net charge is zero and stops moving. According to this principle, the purpose of analyzing pI value can be achieved.

Add 17.5 μL 1% MC (final concentration 0.35%), 2 μL pH 3-10 ampholyte (final concentration 4%), add corresponding volume of protein sample (final concentration 0.2mg/ml) and use Make up 50 μL of ultrapure water, vortex with a vortex mixer for 30 s, and centrifuge at 13,000 rpm/min for 5 min in a 4°C centrifuge. Add the sample to the Vial Insert Pack and centrifuge at 13,000 rpm/min for 1 min in a centrifuge at 4°C. Put the Vial Insert Pack into the Vial Pack, and then put it into the sample tray on the machine; operate according to the operating procedures; Focus Period 1 is set to 1500V, 1min, and FocusPeriod 2 is set to 3000V, 8min. Carrier Amphplytes: 4% pH 3-10, Additives: 0.35% MC, Concentration: 0.2mg/ml for detection. The isoelectric point of Promiximab expressed and purified by eukaryotic cells is 7.89 (as shown in FIG. 2 ).

4. Detection of targeting of anti-CD56 antibody Promiximab by flow cytometry

CD56-positive tumor cell lines were cultured, and cancer cells in logarithmic growth phase were collected, and then the cells were evenly divided into several groups, with the number of cells in each group being 1×10 ⁶ ; cell grouping: negative control group (PBS group) and experimental group; Resuspend the cells in PBS buffer salt, centrifuge at 3500rmp for 3min at 4°C, absorb the supernatant with a gun tip; incubate the primary antibody, add 100μL PBS to the negative control group, and add 100μL antibody (concentration: 10μg/mL) to the experimental group ), after resuspension, incubate at 4°C for 30 minutes; centrifuge the cells of each group at 3500 rpm for 3 minutes, suck off the supernatant, add 300 μL PBS buffer salt to each group, resuspend the cells twice, and then separate the cells of each group Centrifuge at 3500rmp for 3 minutes, suck off the supernatant, and repeat this twice; incubate the secondary antibody, add 50-100 μL of goat anti-human IgG/FITC to each group of cells (the dilution ratio is 1:200), and resuspend Mix well, and incubate the cells at 4°C for 30 minutes; after incubation at 4°C for 30 minutes, add 300 μL PBS buffer salt to each group, resuspend the cells by blowing twice, then centrifuge the cells at 3500 rpm for 3 minutes, and aspirate the supernatant. Supernatant, repeat this 2-3 times; add 400 μL of PBS buffer to resuspend the cells of each group for detection; on the flow cytometer, set the parameters, use the cells of the control group to debug and serve as a negative control, and then sequentially measure Cell samples were taken from each group. The experimental results show that Promiximab can better recognize and target CD56-positive small cell lung cancer cell lines NCI-H526, NCI-H524 and NCI-H69 (as shown in Figure 11).

5. Flow cytometry detection of the internalization effect of the anti-CD56 antibody Promiximab combined with CD56

Culture the CD56-positive lung cancer cell line, collect the cells in the logarithmic growth phase, and then divide the cells into several groups on average, and the number of cells in each group is 1×10 ⁶ cells: the negative control group (PBS group) and the experimental group use PBS buffer salt Suspend the cells of each group, centrifuge at 3500rmp for 3min at 4°C, and absorb the supernatant with the tip of a gun. During internalization, the cells bound to the antibody were divided into two groups. After the cells were resuspended with 500 μL PBS, one group was placed at 4°C for 3 hours, and the other group was internalized at 37°C for 3 hours. After internalization, centrifuge at 3500 RMP for 3 minutes at 4°C. , suck the supernatant with the tip of a gun, add 300 μL of 50 mM PBS buffer salt to each group, resuspend the cells twice, then centrifuge the cells of each group at 3500 RMP for 3 minutes, and suck off the supernatant. Repeat the previous step, add goat anti-mouse IgG/FITC-labeled secondary antibody (1:200 dilution ratio) to each group of cells, resuspend and mix well, and incubate the cells at 4°C for 30 min, note that the primary antibody is promiximab, and the secondary antibody is promiximab. The anti-goat anti-human IgG/FITC was labeled, and 300 μL of PBS buffer was added to each group, the cells were resuspended and blown twice, and then the cells of each group were centrifuged at 3500 rpm for 3 minutes, and the supernatant was sucked off; repeat 2 times. The second time, add 400 μL of PBS buffer to resuspend the cells of each group for detection. On the flow cytometer, set various parameters, use the cells of the control group to debug and serve as a negative control, and then sequentially measure the cell samples of each group. The experimental results showed that the combination of Promiximab and CD56 mediated silencing of internalization was 68.19%, 53.14% and 64.97% in NCI-H526, NCI-H524 and NCI-H69 cell lines, respectively. The results suggest that Promiximab has good CD56 targeting, and at the same time has the ability to deliver drugs into CD56 positive cells (as shown in Figure 11).

6. Activity detection of anti-CD56 antibody Promiximab

(1), check the in vitro activity of anti-CD56 antibody Promiximab with CCK-8

Human small cell lung cancer cells NCI-H526 and NCI-H69 were cultured in RPMI 1640 medium containing 20% fetal bovine serum, and cultured in a 5% CO2, 37°C constant temperature cell incubator; CD56-positive lung cancer cells in the logarithmic growth phase were collected , count and adjust the cell density; pave a 96-well plate, according to the growth rate of different cells, the density of NCI-H526 and NCI-H69 cells is 10,000/well, and the volume is 100 μL/well; the cells are placed in an incubator for 24 hours, Dosing treatment. Antibody Promiximab was diluted with RPMI 1640 medium containing 20% fetal bovine serum to an initial concentration of 2.4 μM, filtered through a 0.22 μm filter, and stored at 4°C; the samples of gradient dilution were added to the 96-well plate covered with cells. Design 8 concentration gradients for each drug, and set 3 replicate wells for each concentration gradient, so that the final concentration gradient of the antibody is 1.2μM, 300nM, 75nM, 18.75nM, 4.69nM, 1.17nM, 0.29nM, 0.07nM, 0.02nM , the dosing system is 100 μL/well. Add the sample and gently tap the edge of the well plate to mix well, and place it in a 5% CO2, 37°C constant temperature cell culture incubator for 72 hours. Place the cell growth under the microscope every 24 hours; add CCK-8 reagent (Dojindo Company) filtered by a 0.22 μm filter membrane to the 96-well plate, 20 μL/well; incubate at 37°C for 1-3 hours in the dark; The OD value of each well was measured at 450 nm in the immunoassay instrument, and the average value of each group was calculated. Inhibition rate (%)=(control group-administration group)/control group×100%. IC50 was calculated with GraphPad Prism 6.0. The experimental results showed (as shown in FIG. 12 ), the IC50 of the anti-CD56 antibody against the CD56-positive cell NCI-H69 was 968.54±34.76nM; the IC50 of the anti-CD56 antibody against the CD56-positive cell NCI-H526 was 792.24±41.21nM.

(2), Promiximab anti-tumor activity in vivo

Cells for cell culture and inoculation Use RPMI 1640 medium containing 20% fetal bovine serum to cultivate human CD56-positive lung cancer cells NCI-H526, and place them in a 5% CO2, 37°C constant temperature cell incubator; change the medium 24 hours before inoculation ; Collect the cells in the logarithmic growth phase, wash the cells twice with serum-free and antibiotic-free RPMI 1640 medium, and perform cell counting. Adjust the cell density to 10 ⁸ viable cells/ml with serum-free, antibiotic-free RPMI 1640 medium and Matrigel (final concentration greater than 4 mg/mL).

The experimental animals are BALB/c athymic nude mice (nude mice for short, Beijing Huafukang), 5-6 weeks old, weighing 16-18 grams; the feeding and management of experimental animals: the breeding feed, drinking water, and bedding are replaced once a week. Materials and cages, while observing the physiological state of animals.

Cell inoculation: the inoculation volume is greater than 1-2×10 ⁷ cells/mouse, the inoculation volume is 100-150 μL/mouse, and the inoculation site is subcutaneous on the back of the right upper limb of nude mice; 7-15 days after nude mice are inoculated with tumor cells, every 3 days Observe the tumor volume once. When the tumor volume reaches 150mm3, grouping and administration can be carried out; nude mice with uniform tumor size are selected and randomly grouped according to the purpose of the experiment. The anti-tumor experiment groups in vivo in the NCI-H526 subcutaneous model are shown in Table 1 below:

Table 1 NCI-H526 subcutaneous model grouping

NCI-H526 subcutaneous model grouping number (only) control 6 Promiximab (10mg/kg) 6

Weigh the body weight of nude mice in each group, measure the tumor volume, and start administration by tail vein injection; administer once every three days, and administer three times in a row; monitor the growth of nude mice: from the beginning of administration, every three days Use a vernier caliper to measure the long and short diameter of the tumor, the unit is mm, and calculate the tumor volume. The calculation formula is V=long diameter×short diameter×short diameter/2. The experimental results show that Promiximab has certain anti-CD56 positive tumor activity in vivo (as shown in Figure 13).

(3), Pathological detection of the toxicity of Promiximab in vivo

Tissue samples of heart, liver, spleen, lung and kidney from nude mice in control group and antibody group s drug-treated group were fixed in 4% phosphate-buffered formaldehyde, and embedded in paraffin according to conventional methods. Tissue sections were stained with hematoxylin and eosin (H&E) and analyzed under a microscope to evaluate the damage to normal tissues. The experimental results showed that compared with the normal organs in the control group, no obvious tissue lesions were found in each organ in the Promiximab antibody group, indicating that there were no obvious toxic and side effects (as shown in Figure 14).

From the results of the examples, it can be known that the present invention provides an anti-CD56 antibody with high affinity, fast internalization efficiency and good specificity, which can be effectively applied to the preparation of anti-tumor, immune system and nervous system diseases. Diagnosis and treatment drugs have Broad application prospects.

sequence listing

<110> Sichuan University

<120> Anti-CD56 antibody and use thereof

<130> A170803K

<141> 2017-09-15

<160> 20

<170> SIP Sequence Listing 1.0

<210> 1

<211> 115

<212> PRT

<213> Artificial Sequence

<400> 1

Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ala Phe Thr Asn Tyr

20 25 30

Asn Met Tyr Trp Met Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asp Pro Tyr Asn Gly Gly Thr Arg Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met His Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Asp Ser Thr Gly Tyr Trp Gly Gln Gly Thr Thr Leu Thr

100 105 110

Val Ser Ser

115

<210> 2

<211> 120

<212> PRT

<213> Artificial Sequence

<400> 2

Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr

20 25 30

Gly Met Asn Trp Val Lys Gln Thr Pro Gly Lys Gly Leu Lys Trp Met

35 40 45

Gly Trp Ile Asn Thr Tyr Thr Gly Glu Ser Thr Tyr Thr Asp Asp Phe

50 55 60

Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Asn Asn Ile Arg Asn Glu Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser Pro Tyr Tyr Tyr Gly Ser Gln Arg Gly Tyr Phe Asp Val

100 105 110

Trp Gly Ala Gly Thr Thr Val Thr

115 120

<210> 3

<211> 115

<212> PRT

<213> Artificial Sequence

<400> 3

Lys Arg Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Arg

1 5 10 15

Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Gly Met

20 25 30

Ala Trp Val Arg Gln Val Pro Gly Lys Gly Pro Glu Trp Ile Ala Phe

35 40 45

Ile Ser Asn Leu Ala Tyr Ser Ile Tyr Tyr Ile Asp Thr Val Thr Gly

50 55 60

Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr Leu Glu

65 70 75 80

Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Ile Tyr Tyr Cys Ala Arg

85 90 95

Val Ser Gly Thr Trp Leu Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr

100 105 110

Val Ser Ala

115

<210> 4

<211> 112

<212> PRT

<213> Artificial Sequence

<400> 4

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Arg Lys Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ser Gly Met Ala Trp Val

20 25 30

Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val Ala Phe Ile Ser Asn

35 40 45

Leu Ala Tyr Ser Ile Tyr Tyr Ala Asp Thr Val Thr Gly Arg Phe Thr

50 55 60

Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr Leu Glu Met Ser Ser

65 70 75 80

Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg Ile Ser Tyr

85 90 95

Asp Tyr Ile Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

100 105 110

<210> 5

<211> 117

<212> PRT

<213> Artificial Sequence

<400> 5

Asp Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr

20 25 30

Gly Met Ala Trp Val Arg Gln Val Pro Gly Lys Gly Pro Glu Trp Ile

35 40 45

Ala Phe Ile Ser Asn Leu Ala Tyr Ser Ile Tyr Tyr Ile Asp Thr Val

50 55 60

Thr Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Val Ser Gly Thr Trp Leu Gly Tyr Trp Gly Gln Gly Thr Leu

100 105 110

Val Thr Val Ser Ala

115

<210> 6

<211> 114

<212> PRT

<213> Artificial Sequence

<400> 6

Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Tyr Tyr

20 25 30

Met His Trp Val Lys Gln Ser His Val Lys Ser Leu Glu Trp Ile Gly

35 40 45

Arg Ile Asn Pro Tyr Asn Gly Ala Thr Thr Tyr Asn Gln Asn Phe Lys

50 55 60

Asp Lys Ala Ser Leu Thr Val Asp Lys Ser Ser Ser Thr Val Tyr Met

65 70 75 80

Glu Leu His Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Tyr Pro Leu Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val

100 105 110

Ser Ala

<210> 7

<211> 112

<212> PRT

<213> Artificial Sequence

<400> 7

Asp Val Leu Leu Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Ile Leu His Ser

20 25 30

Asn Gly Asn Thr Tyr Phe Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly

85 90 95

Ser His Val Pro Phe Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 8

<211> 107

<212> PRT

<213> Artificial Sequence

<400> 8

Asp Ile Ile Ile Ser Arg Ser Pro Ala Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Arg Val Ser Leu Ser Cys Arg Ala Ser Leu Ile Ile Thr Asp Tyr

20 25 30

Leu His Trp Tyr Gln Gln Pro Ser Asn Glu Ser Pro Arg Leu Leu Ile

35 40 45

Arg Tyr Val Cys Leu Ala Ile Ser Gly Ile Pro Ser Ser Phe Ala Asp

50 55 60

Ser Gly Ser Arg Thr Asp Phe Pro Leu Cys Ile Asn Ser Val Lys Pro

65 70 75 80

Glu His Val Gly Val Tyr Tyr Cys Gln Asn Gly His Thr Phe Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Val Lys

100 105

<210> 9

<211> 107

<212> PRT

<213> Artificial Sequence

<400> 9

Asp Ile Leu Leu Thr Gln Ser Pro Ala Ile Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Val Ser Phe Ser Cys Arg Ala Ser Glu Asn Ile Gly Thr Ser

20 25 30

Met His Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser

65 70 75 80

Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Thr Asn Ser Trp Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Asn Leu Glu Ile Lys

100 105

<210> 10

<211> 107

<212> PRT

<213> Artificial Sequence

<400> 10

Asp Ile Val Val Thr Gln Phe Pro Asp Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Ser Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Ile Arg Asn Asn

20 25 30

Leu His Trp Tyr Gln Gln Gln Ser His Glu Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Thr

65 70 75 80

Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser Asn Asn Trp Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 11

<211> 346

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagatccagc tgcagcagtc tggacctgag ctggtgaagc ctggggcttc agtgaaggta 60

tcctgcaagg cttctggtta tgcgttcact aactacaaca tgtactggat gaaacagagc 120

catggaaaga gccttgagtg gattggatat attgatcctt acaatggtgg tactaggtac 180

aaccagaagt tcaagggcaa ggccacattg actgttgaca agtcctccag cacagcctac 240

atgcatctca acagcctgac atctgaggac tctgcagtct attackgtgc aagagaggat 300

agtaccggct actggggcca aggcaccact ctcacagtct cctcag 346

<210> 12

<211> 360

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cagatccagt tggtgcagtc tggacctgaa ctgaagaagc ctggagagac agtcaagatc 60

tcctgtaagg cttctggata taccttcaca aactatggaa tgaactgggt gaagcagact 120

ccaggaaagg gtttaaagtg gatgggctgg ataaacacct atactggaga gtcaacatat 180

actgatgact tcaagggacg gtttgccttt tctttggaga cctctaccag caccgcctat 240

ttgcagatca acaacatcag aaatgaggac acggctacat atttctgtgc aagatcccct 300

tattactacg gtagtcaacgggggtacttc gatgtctggg gcgcagggac cacggtcacc 360

<210> 13

<211> 346

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aaacgggtgg agtctggggg aggcttagtg cagcctggag ggtcccggaa actctcctgt 60

gcagcctctg gattcacttt cagtgactac ggaatggcgt gggttcgaca ggttccaggg 120

aaggggcctg agtggattgc attcattagt aatttggcat atagtatcta ctatatagac 180

actgtgacgg gccgattcac catctctaga gagaatgcca agaacaccct gtacctggaa 240

atgagcagtc tgaggtctga ggacacagcc atatactact gtgcaagggt ttctgggacc 300

tggcttggtt actggggcca agggactctg gtcactgtct ctgcag 346

<210> 14

<211> 339

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tggagtctgg gggaggctta gtgcagcctg gagggtcccg gaaactctcc tgtgcagcct 60

ctggattcac tttcagtgac tccggaatgg cgtgggttcg acaggctcca gggaaggggc 120

ctgagtgggt agcattcatt agtaatttgg catatagtat ctactatgca gacactgtga 180

cgggccgatt caccatctct agagagaatg ccaagaacac cctgtacctg gaaatgagca 240

gtctgaggtc tgaggacaca gccatgtact actgtgcaag gatctcctat gattacattg 300

actactgggg ccaaggcacc actctcacag tctcctcag 339

<210> 15

<211> 351

<212>DNA

<213> Artificial Sequence

<400> 15

gacgtgatgc tggtggagtc tgggggaggc ttagtgcagc ctggagggtc ccggaaactc 60

tcctgtgcag cctctggatt cactttcagt gactacggaa tggcgtgggt tcgacaggtt 120

ccagggaagg ggcctgagtg gattgcattc attagtaatt tggcatatag tatctactat 180

atagacactg tgacgggccg attcaccatc tctagagaga atgccaagaa caccctgtac 240

ctggaaatga gcagtctgag gtctgaggac acagccatat actactgtgc aagggtttct 300

gggacctggc ttggttactg gggccaaggg actctggtca ctgtctctgc g 351

<210> 16

<211> 344

<212>DNA

<213> Artificial Sequence

<400> 16

ggtccagctg caacagtctg gacctgaact ggtgaagcct ggggcttcag tgaagatatc 60

ctgcaaggct tctggttact cattcactga ctactacatg cactgggtga agcaaagcca 120

tgtaaagagc cttgagtgga ttggacgtat taatccttac aatggtgcta ctacctacaa 180

ccagaatttc aaggacaagg ccagtttgac tgtagataag tcctccagca cagtctacat 240

ggagctccac agcctgacat ctgaggactc tgcagtctat tactgtgcaa gatacccttt 300

gtttggttac tggggccaag ggactctggt cactgtctct gcag 344

<210> 17

<211> 337

<212>DNA

<213> Artificial Sequence

<400> 17

gatgttttgc tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60

atctcttgca gatctagtca gaatatttta catagtaatg gcaacaccta tttcgaatgg 120

tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300

ttcacgttcg gaggggggac caagctggaa ataaaac 337

<210> 18

<211> 322

<212>DNA

<213> Artificial Sequence

<400> 18

gacatttatta tatctcgttc tccagccacc ctgtctgtga ctccaggaga tagagtctct 60

ctttcctgca gggccagtct gattattacc gactacttac actggtatca acaaccatca 120

aatgaatctc caaggcttct catcagatat gtttgcctgg ccatctctgg gatcccctcc 180

tccttcgctg acagtggatc acggacagat ttccctctct gtatcaacag tgtgaaacct 240

gaacatgttg gagtgtatta ctgtcaaaat ggtcacacct ttccgctcac gttcggtgct 300

gggaccaagc tggaagtgaa ac 322

<210> 19

<211> 322

<212>DNA

<213> Artificial Sequence

<400> 19

gacatcttgc tgactcagtc tccagccatc ctgtctgtga gtccaggaga aagagtcagt 60

ttctcctgca gggccagtga gaacattggc acaagcatgc actggtatca gcaaagaaca 120

aatggttctc caaggcttct cataaagtat gcttctgagt ctatctctgg gatcccttcc 180

aggtttagtg gcagtggatc agggacagat tttactctta gcatcaacag tgtggagtct 240

gaagatattg cagattatta ctgtcaacaa actaatagct ggccgtacac gttcggaggg 300

gggaccaacc tggaaataaa ac 322

<210> 20

<211> 322

<212>DNA

<213> Artificial Sequence

<400> 20

gacgttgtgg taactcagtt tccagacacc ctgtctgtga ctccaggaga tagcgtcagt 60

ctttcctgca gggccagcca aagtattcgt aacaacctac actggtatca acaacaatca 120

catgagtctc caaggcttct catcaagtat gcttcccagt ccatctctgg gatcccctcc 180

aggttcagtg gcagtggatc agggacagat ttcactctca gtatcaacag tgtggagact 240

gaagattttg gaatgtattt ctgtcaacag agtaacaact ggccgtacac gttcggaggg 300

gggaccaagc tggaaataaa ac 322

Claims (16)

1. Anti-CD56 antibody, characterized in that: it comprises a heavy chain variable domain, a light chain variable domain, and a constant region; the heavy chain variable domain is the same structure as the heavy chain complementarity determining region of the antibody domain, the light chain variable domain is the same domain as the light chain complementarity determining region of the antibody. 2. The anti-CD56 antibody according to claim 1, wherein the amino acid sequence of the heavy chain variable domain is Seq ID NO:1, Seq ID NO:2, Seq ID NO:3, Seq ID Any one of NO:4, Seq ID NO:5 or Seq ID NO:6. 3. The anti-CD56 antibody according to claim 1 or 2, characterized in that: the amino acid sequence of the light chain variable domain is Seq ID NO:7, Seq ID NO:8, Seq ID NO:9 or Any one of Seq ID NO:10. 4. The anti-CD56 antibody according to any one of claims 1-3, wherein the constant region is a natural antibody constant region or a genetically engineered antibody constant region. 5. A gene encoding the anti-CD56 antibody according to any one of claims 1-4. 6. The gene encoding the anti-CD56 antibody according to claim 5, characterized in that: comprising the gene encoding the variable domain of the heavy chain, the nucleotide sequence is such as Seq ID NO: 11, Seq ID NO: 12, Seq ID NO:13, Seq ID NO:14, SeqID NO:15 or Seq ID NO:16. 7. The gene encoding the anti-CD56 antibody according to claim 5 or 6, characterized in that: it also includes the gene encoding the variable domain of the light chain, and the nucleotide sequence is such as Seq ID NO: 17, Seq ID NO: 18 , Seq ID NO:19 or Seq ID NO:20. 8. A vector containing the gene according to any one of claims 5-7. 9. The vector according to claim 8, wherein the vector is an expression vector. 10. The vector according to claim 8 or 9, wherein the expression vector is: pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5-hCH, pAZ-V5 - at least one of hCL, pAZ-V5-hCL, pTT5 or pCEP4 MammalianExpression Vector. 11. A host cell containing the vector according to any one of claims 8-10. 12. The anti-CD56 antibody according to any one of claims 1-4, the gene according to any one of claims 5-7, the vector according to any one of claims 8-10, and the host according to claim 11 The use of cells in the preparation of drugs for the diagnosis and treatment of tumors, immune system or nervous system diseases. 13. Use of the anti-CD56 antibody according to any one of claims 1 to 4 in the preparation of antibody complexes. 14. The use of the anti-CD56 antibody according to claim 13 in the preparation of antibody complexes, characterized in that: the antibody complexes are coupled with at least one of fluorescent molecules, cytotoxic molecules, antibodies or polypeptides antibody complex. 15. The antibody complex, prepared by coupling the anti-CD56 antibody described in any one of claims 1 to 4 with fluorescent molecules, cytotoxic molecules, antibodies or polypeptides. 16. The use of the antibody complex according to claim 15 in the preparation of medicines for the diagnosis and treatment of tumors, immune system or nervous system diseases.