CN109735650A - Four kinds of Gummy Stem Blight Resistance in Melon molecular labelings and purposes based on single nucleotide polymorphism - Google Patents
Four kinds of Gummy Stem Blight Resistance in Melon molecular labelings and purposes based on single nucleotide polymorphism Download PDFInfo
- Publication number
- CN109735650A CN109735650A CN201910109657.4A CN201910109657A CN109735650A CN 109735650 A CN109735650 A CN 109735650A CN 201910109657 A CN201910109657 A CN 201910109657A CN 109735650 A CN109735650 A CN 109735650A
- Authority
- CN
- China
- Prior art keywords
- melon
- primer
- genotype
- muskmelon
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses four kinds of molecular labelings for gummy stem blight of melon Resistance Identification based on the chain single nucleotide polymorphism exploitation of anti didymella, it is any one in molecular labeling CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4 using muskmelon as species.The invention also discloses the purposes of molecular labeling, for identifying the assisted selection of Gummy Stem Blight Resistance in Melon germplasm or its offspring.When screening anti didymella muskmelon idioplasm, select germplasm when genotype is consistent with disease-resistant muskmelon flower skin tip melon genotype in germplasm or has colored skin tip melon and potherb mustard genotype simultaneously for breeding.
Description
Technical field
The invention belongs to vegetable disease-resistant molecular markers development and technical field of molecular marker-assisted breeding, and in particular to a kind of
Gummy Stem Blight Resistance in Melon molecular markers development and its application provide for the high flux screening identification and back cross breeding of Gummy Stem Blight Resistance in Melon
A kind of New molecular marker and assisted selection method.
Background technique
Blight dis-ease (Gummy stem blight, Gsb) is a kind of fungoid soil-borne disease, by melon black rotten small spherical shell bacterium
(Dudymella bryoniae), which infects, to be caused, and is belonged to often downright bad nutritious fungus, is to endanger one of Major Diseases of muskmelon, especially
It is occurred seriously in Zhejiang Province and southeastern coastal areas facility cultivation high temperature and humidity condition, and the disease incidence in crop field is up to 20%-
30%, continuous cropping and greenhouse be up to 80%, the disease serious time often results in the crushing underproduction.
Both at home and abroad to Gummy Stem Blight Resistance in Melon Germplasm Identification, genetics of resistance rule, resistant gene linkage molecule label etc.
Research achieve serial progress.By blight dis-ease pathogen inoculated identification, series mainly is identified from the wild material of muskmelon
Anti didymella muskmelon idioplasm, mainly include PI140471, PI157082, PI511890, PI482398, PI482399 and
PI420145.Genetic analysis shows that in addition to PI482399 shows as recessive resistance, remaining PI germplasm shows as dominant resistance,
Respectively these resistant genes name for Gsb-1, Gsb-2, Gsb-3, Gsb-4, Gsb-5 and Gsb-6 (Frantz et al.,
2004；McGrath et al.,1993；Wolukau et al.,2007,2009；Zuniga et al.,1999).These are excellent
Different germ plasm resource provides important genetic resources for Gummy Stem Blight Resistance in Melon breeding.
Early stage research uses conventional molecular labeling method, has found some molecular labelings relevant to Gummy Stem Blight Resistance in Melon,
Such as with the chain SSR marker CMCT505 (Liu Wenrui, 2009) from for 5.2cM of anti didymella gene Gsb-1, with anti didymella
The ISSR that gene Gsb-2 linkage distance is 11.3cM is marked, and is named as ISSR-5760 (Zhang Yongbing etc., 2011), with anti didymella
The ISSR that gene Gsb-3 linkage distance is 8.3cM is marked, and is named as ISSR-100 (Zhang Xuejun etc., 2013), with anti didymella base
Because of the SSR marker (Wang Hongying etc., 2012) that the genetic linkage distance of Gsb-4 is 5.14cM.With the something lost of anti didymella gene Gsb-6
It passes the AFLP that linkage distance is 2cM to mark, and is named as E-TG/M-CTC200 (Wolukau et al., 2009).But due to dividing
Son is marked genetic distance between disease-resistant gene farther out, and is traditional random dna molecular labeling, influences Gummy Stem Blight Resistance in Melon
High flux screening identification.
Bibliography involved in above is as follows:
1. the molecular labeling of Liu Wenrui, Zhang Yongbing, Zhou Xiaohui, Chen Jingfeng Gummy Stem Blight Resistance in Melon gene Gsb-1 and its with it is anti-
The relationship China melon dish of disease-resistant gene, 2009,22 (5): 1-4 in the PI420145 of source.
2. Wang Hongying, Qian Chuntao, Lou Lina, Lou Qunfeng, Zhang Yongbing, Yi Hongping, Wu Mingzhu, Chen Jingfeng muskmelon resist climing withered
The molecular labeling gardening journal of sick Gsb-4,2012,39 (3): 574-580.
3. the ISSR molecule of Zhang Yongbing, Chen Jingfeng, Yi Hongping, Qian Chuntao, Wu Mingzhu Gummy Stem Blight Resistance in Melon gene Gsb-2
Mark Journal of Fruit Science, 2011,28 (2): 296-300.
4. it learns military affairs, Zhang Yongbing, KUNG, Wang Dengming, the ISSR molecule mark of Yi Hongping Gummy Stem Blight Resistance in Melon gene Gsb-3
Remember the northwest Botany Gazette, 2013,33 (2): 261-265.
5.Frantz,J.D.and M.M.Jahn.Five independent loci each control
monogenic resistance to gummy stem blight in melon(Cucumis meloL.)
.Theoretical and Applied Genetics,2004,108:1033-1038(Frantz,J.D.and M.M.Jahn.
5 single-gene blight dis-ease resistance locus of muskmelon.Theoretical and Applied Genetics,2004,108:1033-
1038)。
6.Mcgrath D J,Vawdrey L,Walker I O.Resistance to Gummy Stem Blight in
Muskmelon.Hortscience, 1993,28 (9) (Mcgrath D J, Vawdrey L, Walker I O. gummy stem blight of melon
Resistance .Hortscience, 1993,28 (9)).
7.Wolukau JN,Zhou X,Chen J.Identification of amplified fragment
length polymorphism markers linked to gummy stem blight(Didymella bryoniae)
resistance in melon(Cucumis melo L.)PI420145.Hortscience,2009,1(24):1189-90.
It (is marked in Wolukau JN, Zhou X, Chen J. muskmelon PI420145 with the chain AFLP of blight dis-ease resistance
.Hortscience,2009,1(24):1189-90)。
8.Wolukau JN,Zhou X,Li Y,Zhang Y,Chen J.Resistance to gummy stem
blight in melon(Cucumis melo.L)germplasm and inheritance of resistance from
Plant Introduction 157076,420145and 323498.Hortscience,2007,42(2):215-221.
(Wolukau JN, Zhou X, Li Y, Zhang Y, Chen J. muskmelon PI157076, PI420145 and PI323498 blight dis-ease
Resistance Identification and genetics of resistance, Hortscience, 2007,42 (2): 215-221.).
9.Zuniga TL,Jantz JP,Zitter TA,Jahn MK.Monogenic dominant resistance
to gummy stem blight in two melon(Cucumis melo)accessions.Plant Disease,1999,
(Zuniga TL, Jantz JP, Zitter TA, Jahn two gummy stem blight of melon single gene dominants of MK. are anti-by 83:1105-1107.
Property .Plant Disease, 1999,83:1105-1107.).
Summary of the invention
The technical problem to be solved by the present invention is to find the single nucleotide polymorphism chain with gummy stem blight of melon, provide
It is a kind of it is related with gummy stem blight of melon resistance be based on single nucleotide polymorphism (Single Nucleotide Polymorphism,
SNP) molecular labeling and its development approach and purposes.Present invention molecular labeling CmGsbRS1 obtained is gummy stem blight of melon resistance
Label, can be used for the assisted selection of gummy stem blight of melon resistance.
In order to solve the above technical problem, the present invention provides four kinds of single nucleotide polymorphism chain based on anti didymella
(SNP) develop the molecular labeling for gummy stem blight of melon Resistance Identification, using muskmelon as species, for molecular labeling CmGsbRS1,
Any one in CmGsbRS2, CmGsbRS3, CmGsbRS4；The following primer pair that molecular labeling primer uses, core therein
Nucleotide sequence is 5 ' -3 ':
CmGsbRS1: equipotential primer 1:GAATCTACCAAAAGTATCAGTAGAAAGAG
Equipotential primer 2: GAATCTACCAAAAGTATCAGTAGAAAGAC
Universal primer: CTCAGAAAAGGATAAACCTTTGGAGGAA
CmGsbRS2: equipotential primer 1:AATAAGGCTTTGTTATACTTACTGAGAAA
Equipotential primer 2: AAGGCTTTGTTATACTTACTGAGAAG
Universal primer: CTCCACGGGTTCCTTCTACTCA；
CmGsbRS3: equipotential primer 1:ATTTGTGGGAATCTCCCCCTGGT
Equipotential primer 2: ATTTGTGGGAATCTCCCCCTGGA
Universal primer: CCCATCTTCCATTTGAATGGTAAAGGAA；
CmGsbRS4: equipotential primer 1:CTTCCAGGTATAGGTTTGAATGTAGAA
Equipotential primer 2: TTCCAGGTATAGGTTTGAATGTAGAC
Universal primer: TCAAGCATGTTGATGGTTTGTCGTT.
Corresponding marker site is described in table 1 below.
Table 1
The present invention also provides the chain single nucleotide polymorphism identification methods of gummy stem blight of melon resistance, including following step
It is rapid:
1) -- spending skin tip melon and sense blight dis-ease muskmelon --, with anti didymella muskmelon, potherb mustard is that parent hybridizes, then
Selfing, to obtain as F2Anti-/susceptible isolated single plant in generation；
2), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonnium Bromide)
Method extracts muskmelon Parent Seedling and filial generation seedling genomic DNA；
3), based on Illumina high-flux sequence platform (HiSeq2500) to F2In generation, 150 individuals carried out genome covering
2 times of degree resurveys sequence；
4) region relevant to anti didymella or gene, are positioned using gene linkage map and association analysis method；
5) mononucleotide polymorphism sequence chain with Gummy Stem Blight Resistance in Melon, is identified.
The present invention also provides the development approaches of above-mentioned molecular labeling, comprising the following steps:
1), hybridized with anti didymella muskmelon flower skin tip melon with sense blight dis-ease muskmelon potherb mustard, be then selfed, obtained and be used as F2
For group, the heredity of the mononucleotide polymorphism sequence chain with Gummy Stem Blight Resistance in Melon is separated and is verified；
2) it, is carried out using anti didymella muskmelon flower skin tip melon as disease-resistant gene donor parents and sense blight dis-ease muskmelon potherb mustard
Hybridization and backcrossing, to obtain the disease-resistant muskmelon single plant as offspring；
3), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonnium Bromide)
Method extracts muskmelon Parent Seedling and filial generation seedling genomic DNA；
4), using KASP (competitive allele-specific polymerase chain reaction, Kompetitive Allele
Specific Polymerase Chain Reaction) method carry out anti didymella label exploitation；
5) 4 Gummy Stem Blight Resistance in Melon molecular labelings based on single nucleotide polymorphism, are developed, be respectively CmGsbRS1,
CmGsbRS2、CmGsbRS3、CmGsbRS4。
The present invention also provides the purposes of above-mentioned molecular labeling: for identifying that Gummy Stem Blight Resistance in Melon germplasm or its offspring's is auxiliary
Help selection and use.That is, being used for Gummy Stem Blight Resistance in Melon strain or its offspring's assisted selection.
When screening hybridization and the backcross progeny of flower skin tip melon and potherb mustard, genotype and disease-resistant muskmelon flower in offspring are selected
Single plant when skin tip melon genotype is consistent or has colored skin tip melon and potherb mustard genotype simultaneously is for breeding.
Note: the resistance is dominant resistance, therefore has the genotype of flower skin tip melon or have colored skin tip melon and snow simultaneously
In red genotype single plant it is all resistant.
When screening anti didymella muskmelon idioplasm, select genotype in germplasm consistent with disease-resistant muskmelon flower skin tip melon genotype
Or have germplasm when colored skin tip melon and potherb mustard genotype for breeding simultaneously.
Molecular labeling related with Gummy Stem Blight Resistance in Melon is specifically obtained using following methods:
1), compare anti didymella muskmelon flower skin tip melon and feel the genome of blight dis-ease muskmelon potherb mustard and resistance desmic region
Sequence, identifies anti didymella muskmelon flower skin tip melon and sense blight dis-ease muskmelon potherb mustard and resistance linked gene group region exists
SNP variation, that is, detected in two parents inside resistance linked gene group region in the segment that molecular labeling limits by being sequenced
It has differences；
2) it, is made a variation based on the SNP in anti-/ sense blight dis-ease muskmelon with resistance linked gene group region, design primer；
3) muskmelon Parent Seedling and filial generation seedling genomic DNA, are extracted with CTAB method；
4) screening of anti didymella label, is carried out using KASP method；
5) 4 KASP label CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4, are developed, through correlation detection,
It was found that it is chain with gummy stem blight of melon resistance, can be used to identify gummy stem blight of melon resistance using the label.
It is specifically using the method that above-mentioned label carries out gummy stem blight of melon resistance screening:
(1) molecular labeling resists/feels the polymorphism analysis of flower skin tip melon and potherb mustard in blight dis-ease:
Molecular labeling is designed and developed, each molecular labeling is made of equipotential primer 1, equipotential primer 2, universal primer；For
Detect the polymorphism of blight dis-ease resistance between flower skin tip melon and potherb mustard.Remarks explanation: primer (molecular labeling) can entrust Ai Ji
Scientific and technological 's synthesis is analysed, is expanded in ABI Setp One PCR instrument.
PCR reaction system are as follows: 5.0 μ l, KASP Master mix of 20-50ng/ μ l muskmelon genomic DNA 5.0 μ l, KASP
Assay Mix (10ng/ μ l FAM primer 1,10ng/ μ l HEX primer 2,10ug/ μ l universal primer, the volume ratio of three kinds of primers
For 0.14 μ l of 12:12:30), total volume is 10.14 μ l.
Note: FAM primer 1 is equipotential primer 1, and HEX primer 2 is equipotential primer 2.
After amplification, detects fluorescence signal and check Genotyping situation.
(2) SNP difference of the molecular labeling between the flower skin tip melon of different resistances and potherb mustard:
According to the molecular labeling of acquisition, for detecting the SNP between the flower skin tip melon of different blight dis-ease resistances and potherb mustard, root
According to the difference of fluorescence signal, the genotype of SNP is judged.
(3) carry out Gummy Stem Blight Resistance in Melon assisted selection using molecular labeling:
Anti didymella muskmelon donor flower skin tip melon is hybridized with susceptible muskmelon potherb mustard, then using potherb mustard as circulation parent
The disease-resistant gene of flower skin tip melon is imported into potherb mustard by this by backcrossing, selfing binding marker assisted Selection, selection separation group
Genotype and the flower consistent single plant of skin tip melon genotype are used for breeding improvement in body, obtain containing for several pieces potherb mustard background
The material of flower skin tip melon disease-resistant gene, is inoculated with by blight dis-ease germ source, it is found that its disease resistance dramatically increases.
Anti didymella is the important character of muskmelon, is the important component of high yield.The present invention uses molecular genetics side
Method develops the molecule that can improve blight dis-ease resistance new, that stability is good using the flower skin tip melon containing disease-resistant gene as material
Label and its method are used for Gummy Stem Blight Resistance in Melon assisted selection.Since the material disease-resistant gene for studying used can improve sweet tea
Melon anti didymella ability has generality to China's Gummy Stem Blight Resistance in Melon Molecular design breeding.
Four KASP label of the invention Gummy Stem Blight Resistance in Melon gene linkage.In this way, not only overcome
The disadvantages of period required for conventional breeding methods is long, anti-disease enzyme stability is poor, can targetedly will flower skin tip melon it is anti-
Ospc gene selects to obtain in laboratory, and purposefully carries out the polymerization of multiple disease-resistant genes, and more with resisting from cultivating
The New melon variety of kind disease.In the present invention, when detecting in Progeny plants has flower skin tip melon genotype or simultaneously
There is flower skin tip melon and when potherb mustard genotype, we determine that it belongs to anti didymella muskmelon, when detecting tool in Progeny plants
There is the genotype of potherb mustard, we determine that it belongs to susceptible muskmelon.
It present invention can be suitably applied to the label selection of most Gummy Stem Blight Resistance in Melon.
Therefore, result of the present invention is of great significance in Gummy Stem Blight Resistance in Melon breeding practice；Its advantage is specifically concluded such as
Under:
(1) of the invention to be able to achieve Gummy Stem Blight Resistance in Melon molecular labeling, it is by the muskmelon flower skin tip containing disease-resistant gene
Melon and susceptible muskmelon potherb mustard heredity segregating population obtain, and apply in screening in hybridization, backcrossing and selfing, can significantly improve
Blight dis-ease resistance, and stablize heredity, it can be used for the assisted selection of blight dis-ease resistance.
(2) present invention is based on and the exploitation of the nucleotide sequence of Gummy Stem Blight Resistance in Melon gene close linkage
KASP label, greatly improves the efficiency and effect of auxiliary choosing.
Detailed description of the invention
Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.
Fig. 1 is that disease-resistant muskmelon flower skin tip melon, susceptible muskmelon potherb mustard, flower skin tip melon and the climing hybridization F1 blight dis-ease of potherb mustard are invaded
Susceptible symptom after dye；
Fig. 2 is the positioning of the disease-resistant gene based on single nucleotide polymorphism on chromosome.
Fig. 3-1 is genotype figure of the KASP label CmGsbRS1 in flower skin tip melon, potherb mustard and F1, wherein spending skin tip melon
Disease-resistant gene type is CC, the susceptible genotype of potherb mustard be GG, F1 genotype is CG.
Fig. 3-2 is genetic analysis of the KASP label CmGsbRS1 in flower skin tip melon and potherb mustard F2 group, wherein disease-resistant
Genotype is CC, susceptible genotype is GG, heterozygous genotypes CG, NO CALL indicates that sample does not have fluorescence signal.
According to the Fig. 3-2, we can be learnt: KASP label CmGsbRS1 is separated in F2 group, and segregation ratio
The law of segregation for meeting single-gene recessive character 3:1 shows that KASP label CmGsbRS1 and blight dis-ease resistance are chain.
Fig. 3-3 is using KASP label CmGsbRS1 in flower skin tip melon and potherb mustard hybridization and resistant gene in backcross progeny
Type identification, wherein disease-resistant gene type is CC, susceptible genotype is GG, heterozygous genotypes CG.
Fig. 4-1 is genotype figure of the KASP label CmGsbRS2 in flower skin tip melon, potherb mustard and F1, wherein spending skin tip melon
Disease-resistant gene type is TT, the susceptible genotype of potherb mustard be CC, F1 genotype is TC.
Fig. 4-2 is genetic analysis of the KASP label CmGsbRS2 in flower skin tip melon and potherb mustard F2 group, wherein disease-resistant
Genotype is TT, susceptible genotype is CC, heterozygous genotypes TC, NO CALL indicates that sample does not have fluorescence signal.
According to the Fig. 4-2, we can be learnt: KASP label CmGsbRS2 is separated in F2 group, and segregation ratio
The law of segregation for meeting single-gene recessive character 3:1 shows that KASP label CmGsbRS2 and blight dis-ease resistance are chain.
Fig. 4-3 is using KASP label CmGsbRS2 in flower skin tip melon and potherb mustard hybridization and resistant gene in backcross progeny
Type identification, wherein disease-resistant gene type is TT, susceptible genotype is CC, heterozygous genotypes TC.
Fig. 5-1 is genotype figure of the KASP label CmGsbRS3 in flower skin tip melon, potherb mustard and F1, wherein spending skin tip melon
Disease-resistant gene type is TT, the susceptible genotype of potherb mustard be AA, F1 genotype is TA.
Fig. 5-2 is genetic analysis of the KASP label CmGsbRS3 in flower skin tip melon and potherb mustard F2 group, wherein disease-resistant
Genotype is TT, susceptible genotype is AA, heterozygous genotypes TA, NO CALL indicates that sample does not have fluorescence signal.
According to the Fig. 5-2, we can be learnt: KASP label CmGsbRS3 is separated in F2 group, and segregation ratio
The law of segregation for meeting single-gene recessive character 3:1 shows that KASP label CmGsbRS3 and blight dis-ease resistance are chain.
Fig. 5-3 is using KASP label CmGsbRS3 in flower skin tip melon and potherb mustard hybridization and resistant gene in backcross progeny
Type identification, wherein disease-resistant gene type is TT, susceptible genotype is AA, heterozygous genotypes TA.
Fig. 6-1 is genotype figure of the KASP label CmGsbRS4 in flower skin tip melon, potherb mustard and F1, wherein spending skin tip melon
Disease-resistant gene type is CC, the susceptible genotype of potherb mustard be AA, F1 genotype is AC.
Fig. 6-2 is genetic analysis of the KASP label CmGsbRS4 in flower skin tip melon and potherb mustard F2 group, wherein disease-resistant
Genotype is CC, susceptible genotype is AA, heterozygous genotypes AC, NO CALL indicates that sample does not have fluorescence signal.
According to the Fig. 6-2, we can be learnt: KASP label CmGsbRS4 is separated in F2 group, and segregation ratio
The law of segregation for meeting single-gene recessive character 3:1 shows that KASP label CmGsbRS4 and blight dis-ease resistance are chain.
Fig. 6-3 is using KASP label CmGsbRS4 in flower skin tip melon and potherb mustard hybridization and resistant gene in backcross progeny
Type identification, wherein disease-resistant gene type is CC, susceptible genotype is AA, heterozygous genotypes AC.
Specific embodiment
Embodiment 1, flower skin tip melon and potherb mustard blight dis-ease Resistance Identification
Muskmelon material is chosen from the germplasm resource bank of laboratory --- flower skin tip melon, potherb mustard and flower skin tip melon and Xue Li
Red hybridization F1 offspring, the inoculation of Muskmelon Gummy Stem Blight Pathogen bacterium determine resistance using plant phenotype symptom.Such as Fig. 1.
One, Muskmelon Gummy Stem Blight Pathogen bacterium is inoculated with:
1), blight dis-ease Bacteria culturing
The configuration of PDA culture medium: dehydrated potato powder 6.0g, glucose 20.0g, agar powder 20.0g, ammonium dihydrogen phosphate are taken
2.0g, chloramphenicol 0.1g.Mentioned component distilled water is dissolved and pH to 1L, and with NaOH or HCl is transferred to 6 by constant volume, high temperature
High pressure sterilization 20min.
The activation of didymella bryoniae: the bacterial strain saved in glycerol is taken out from ultra low temperature freezer, on superclean bench
It in strain inoculated to PDA culture medium, will be placed in 25 DEG C of incubator and cultivated one week under dark condition.
The expansion of blight dis-ease bacterial strain is numerous: the pocket knife after the culture medium for covering with didymella bryoniae sterilizing being cut into small pieces, is then used
Fritter is inoculated on new culture medium by the tweezers after sterilizing, is then placed on dark culturing one week in 25 DEG C of incubator, is realized
The expansion of didymella bryoniae is numerous.
The conidial induction of blight dis-ease: culture of one week gummy stem blight of melon germ at 25 DEG C will be cultivated under dark condition
It is handled 4 days under 12h ultraviolet lamp/12h dark cycle in case, just has a large amount of conidiums and generate.
2), blight dis-ease pathogen is inoculated with muskmelon
Preparation before inoculation: the sterile water of conidial blight dis-ease culture medium addition 5-10ml will be covered with, then with dry
The surface of the scraping culture medium of net spoon gently, and liquid imported in the aseptic plastic pipe of 50ml, and it adds a small amount of
Distilled water is rinsed.And the liquid is filtered with filter paper, what is obtained after filtering is that gummy stem blight of melon conidium is outstanding
Supernatant liquid.Conidial concentration in suspension is calculated using blood counting chamber, and conidial suspension is diluted to 500000
A spore/ml.PH value is adjusted to 4 with lactic acid, and adds 20 drop (about 1ml) surface active agent tweens 20 in every liter of suspension,
Polysorbas20 is a kind of surfactant, and blight dis-ease conidium can be helped preferably to infect Muskmelon Plants.
Seedling Inoculation: being inoculated with it when muskmelon seedling grows to 4-6 piece true leaf, is sprayed with blade of the sprayer to muskmelon
Conidial suspension is sprayed onto until muskmelon blade starts to drip.Plant is humidified with humidifier after inoculation, and uses plastics
Covering carrys out moisturizing.Keep air humidity 90% or more in three days after inoculation, temperature is at 25 degree or so.Two to three week after inoculation
Investigation statistics are carried out according to Gummy Stem Blight Resistance in Melon grading standard come the disease-resistant grade to Muskmelon Plants.
Two, plant disease symptom is observed
The disease-resistant grade of Muskmelon Plants is investigated according to Gummy Stem Blight Resistance in Melon grading standard within 21 days after inoculation
Statistics.
Stem's incidence is as follows:
0 grade: fanout free region；
1 grade: the single long 1-10mm of scab or multiple scab overall length 1-20mm, but do not have ring stem one week；
2 grades: the long 21-80mm of scab or ring stem 1 week；
3 grades: plant is wilted；
4 grades: plant is dead.
0 grade and 1 grade of stem's disease grade to be disease-resistant, 2-4 grade are susceptible.
According to Fig. 1, after blight dis-ease pathogen is inoculated with 21 days, flower skin tip melon hardly fall ill or blade on only have and sporadicly put
Scab shows have very strong resistance to blight dis-ease, and potherb mustard plant is all wilted or even death, shows to blight dis-ease height
Degree is sensitive；Simultaneously in flower skin tip melon and potherb mustard first familiar generation, almost no morbidity or blade do not only have fragmentary point scab to F1 plant,
Show have good resistance to blight dis-ease, which shows as dominant inheritance.
Embodiment 2, gummy stem blight of melon resistant analysis and the assignment of genes gene mapping:
Muskmelon material is chosen from the germplasm resource bank of laboratory --- flower skin tip melon, potherb mustard, flower skin tip melon and potherb mustard are miscellaneous
The F2 group for handing over F1 offspring and F1 selfing to obtain, the inoculation of Muskmelon Gummy Stem Blight Pathogen bacterium determine resistance using plant phenotype symptom,
Carry out disease resistance genetic analysis.It is then based on high-throughput weight sequencing approach and carries out localization of disease resistance genes, such as Fig. 2.
Resistant analysis: being inoculated with using 219 single plants of the blight dis-ease inoculation method in embodiment 1 to F2 group,
Resistance situation is determined according to phenotype, F2 group can separate the disease resistance of gummy stem blight of melon, wherein 165 plants of disease-resistant plants,
54 plants of disease plant, disease-resistant plant number: muskmelon disease plant number=3:1 shows that the anti didymella character of the muskmelon is by dominant
Dominant gene.
Resistant gene positioning:
One, DNA is extracted
1), DNA is extracted
DNA extracts the plant genomic DNA extracts kit that TIANGEN Biotech's production may be selected
(TIANamp Genomic DNA Kit)。
1., weigh the above-mentioned muskmelon blade liquid nitrogen grinding powdering of 0.1g, referring next to DNA extraction kit provide behaviour
Make step and extracts total DNA.
2., detect above-mentioned resulting DNA sample concentration using Nanodrop2000 ultramicrospectrophotometer, 0.7%
The integrality of agarose gel electrophoresis detection DNA.
Two, F2 group Weight per plant is sequenced
Using 2500 high-flux sequence platform of Illumina HiSeq to flower 150 skin tip melon, potherb mustard and F2 group lists
Strain carries out resurveying sequence according to standard method, and 150 flower skin tip melon, potherb mustard and F2 group single plants (are chosen at random from F2 group
Choosing) altogether obtain 12.94Gbp, 13.14Gbp and 217.70Gbp sequencing data, flower skin tip melon and potherb mustard sequencing quantity covering
Genome 26 ×, chromosome coverage be 96.96% and 97.68%, F2 group single plant mean depth be 2 ×, chromosome covering
Degree is 84.48%.
The SNP in sample is detected using GATK software tool pack (Depristo et al., 2011), is obtained high
Single nucleotide polymorphism (SNP) label 1,188,159 of quality, by calculating MLOD value between label two-by-two, by label point
For 12 linkage groups.
Three, resistant gene positions
The phenotypic data of 150 plants of F2 group anti didymellas of muskmelon is combined with 12 linkage group maps and typing data,
The association analysis for carrying out qualitative character, positions gummy stem blight of melon resistant gene.Interval mapping is used using software rQTL
Method, any point QTL that may be present carries out Likelihood ration test in the section constituted using maximum likelihood method to adjacent marker, into
And obtain the Maximum-likelihood estimation of its effect.The region that maximum likelihood number is estimated to exceed certain threshold value is target area.It obtains altogether
Obtain 1 associated region relevant to gummy stem blight of melon resistance.The region is located at No. 4 chromosome CM3.5_ of muskmelon
It, can according to annotation of gene function of the muskmelon genome database to the associated region on the section of scaffold00018 about 106kb
Knowing the associated region altogether includes 8 genes.This 8 genes according to genome annotation be respectively MELO3C012986,
MELO3C012987、MELO3C012988、MELO3C012989、MELO3C012990、MELO3C012991、
MELO3C012991, MELO3C012993, the corresponding gene of 4 molecular labelings of the invention is MELO3C012993.
Embodiment 3, the exploitation and verifying marked with KASP
Specific practice is: muskmelon material is chosen from the germplasm resource bank of laboratory --- flower skin tip melon, potherb mustard, the flower skin tip
The F2 group that melon and potherb mustard hybridization F1 offspring and F1 selfing obtain, converts KASP label for SNP first, utilizes primer
KASP marks CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4 amplification to identify its genotype and inheritance.
1, KASP marks the exploitation of CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4:
One, SNP information extraction:
According to the assignment of genes gene mapping in embodiment 2 as a result, extracting the SNP information with disease-resistant gene close linkage.
Two, DNA is extracted
It extracts flower skin tip melon, potherb mustard, flower skin tip melon and potherb mustard and hybridizes F1 offspring genomic DNA, the same embodiment of method
2。
Three, PCR amplification
1), reaction system
Primer sequence is following any:
CmGsbRS1: equipotential primer 1:GAATCTACCAAAAGTATCAGTAGAAAGAG
Equipotential primer 2: GAATCTACCAAAAGTATCAGTAGAAAGAC
Universal primer: CTCAGAAAAGGATAAACCTTTGGAGGAA；
CmGsbRS2: equipotential primer 1:AATAAGGCTTTGTTATACTTACTGAGAAA
Equipotential primer 2: AAGGCTTTGTTATACTTACTGAGAAG
Universal primer: CTCCACGGGTTCCTTCTACTCA；
CmGsbRS3: equipotential primer 1:ATTTGTGGGAATCTCCCCCTGGT
Equipotential primer 2: ATTTGTGGGAATCTCCCCCTGGA
Universal primer: CCCATCTTCCATTTGAATGGTAAAGGAA；
CmGsbRS4: equipotential primer 1:CTTCCAGGTATAGGTTTGAATGTAGAA
Equipotential primer 2: TTCCAGGTATAGGTTTGAATGTAGAC
Universal primer: TCAAGCATGTTGATGGTTTGTCGTT.
PCR reaction system are as follows: 5.0 μ l, KASP Master mix of 20-50ng/ μ l muskmelon genomic DNA 5.0 μ l, KASP
Assay Mix (10ng/ μ l FAM primer 1,10ng/ μ l HEX primer 2,10ug/ μ l universal primer, the volume ratio of three kinds of primers
For 0.14 μ l of 12:12:30), total volume is 10.14 μ l.
2), response procedures
94 DEG C of initial denaturations, 15 minutes；94 DEG C, 20 seconds -55 DEG C of (denaturation) -61 DEG C, (renaturation & extends within 1 minute；With touch
Down program expands 10 circulations, and every circulation reduces by 0.6 DEG C；94 DEG C, 20 seconds (denaturation), 55 DEG C 60 seconds, continue amplification 26 follow
Ring.After amplification, detects fluorescence signal and check Genotyping situation.
PCR reaction is carried out directly on ABI Step One fluorescence quantitative PCR instrument, the PCR instrument connects ABI Step
One software, to directly obtain analysis result, that is, software will test sample automatically and be divided into homozygous resist according to different genotype
Sick type, homozygous susceptible type and the disease-resistant type of heterozygosis.
Respective fluorescent linker (for different colours) is respectively set before equipotential primer 1, equipotential primer 2, if the material of detection
When material is homozygous, amplification when can only select wherein a corresponding primer amplification (for example, flower skin tip melon can only draw with equipotential
1 primer of object reacts), according to the difference of fluorescence, telling measured and monitored the growth of standing timber material is homozygous disease-resistant type or homozygous susceptible type, if
The material of detection is heterozygous, and 2 primers can be all used when amplification, and the fluorescence of generation is different from homozygous material, from
And it realizes and distinguishes heterozygous.
According to Fig. 3-1, we conclude that using CmGsbRS1 primer pair respectively from flower skin tip melon and potherb mustard genome
In detect genotype be CC and GG, flower skin tip melon and potherb mustard hybridization F1 offspring in detect genotype be CG.Thus table
Bright, KASP molecular labeling CmGsbRS1 can be used to spend between skin tip melon and potherb mustard and its genotype identification of offspring.
According to Fig. 4-1, we conclude that using CmGsbRS2 primer pair respectively from flower skin tip melon and potherb mustard genome
In detect genotype be TT and CC, flower skin tip melon and potherb mustard hybridization F1 offspring in detect genotype be TC.Thus table
Bright, KASP molecular labeling CmGsbRS2 can be used to spend between skin tip melon and potherb mustard and its genotype identification of offspring.
According to Fig. 5-1, we conclude that using CmGsbRS3 primer pair respectively from flower skin tip melon and potherb mustard genome
In detect genotype be TT and AA, flower skin tip melon and potherb mustard hybridization F1 offspring in detect genotype be TA.Thus table
Bright, KASP molecular labeling CmGsbRS3 can be used to spend between skin tip melon and potherb mustard and its genotype identification of offspring.
According to Fig. 6-1, we conclude that using CmGsbRS4 primer pair respectively from flower skin tip melon and potherb mustard genome
In detect genotype be AA and CC, flower skin tip melon and potherb mustard hybridization F1 offspring in detect genotype be AC.Thus table
Bright, KASP molecular labeling CmGsbRS4 can be used to spend between skin tip melon and potherb mustard and its genotype identification of offspring.
2, KASP marks the verifying of CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4:
One, DNA is extracted
It is selfed the genomic DNA for obtaining 107 single plants of F2 offspring after extracting flower skin tip melon and potherb mustard hybridization, method is the same as real
Apply example 2.
Two, PCR amplification
Ibid.
According to Fig. 3-2, we conclude that using CmGsbRS1 primer pair respectively from flower skin tip melon and potherb mustard hybridization after
Selfing obtains and detects CC, GG and CG genotype in F2 offspring genome, and three kinds of genotype are 20:47:41, with resistant phenotype base
This coincide, and substantially conforms to single gene dominant genetic development 1:2:1.Thus it verifies KASP molecular labeling CmGsbRS1 and muskmelon is climing withered
Sick resistance close linkage；
The F2 offspring of above-mentioned respectively CC, GG and CG genotype was planted to one heart stage of four leaves, blight dis-ease is carried out
Resistance Identification, acquired results are as follows:
It is accredited as CC type, all anti didymellas of Resistance Identification result；
It is accredited as GG type, all sense blight dis-eases of Resistance Identification result；
It is accredited as CG type, all anti didymellas of Resistance Identification result；
Therefore, the correctness of provable molecular labeling CmGsbRS1.
According to Fig. 4-2, we conclude that using CmGsbRS2 primer pair respectively from flower skin tip melon and potherb mustard hybridization after
Selfing obtains and detects TT, CC and TC genotype in F2 offspring genome, and three kinds of genotype are 20:47:41, with resistant phenotype base
This coincide, and substantially conforms to single gene dominant genetic development 1:2:1.Thus it verifies KASP molecular labeling CmGsbRS2 and muskmelon is climing withered
Sick resistance close linkage.
The F2 offspring of above-mentioned respectively TT, CC and TC genotype was planted to one heart stage of four leaves, blight dis-ease is carried out
Resistance Identification, acquired results are as follows:
It is accredited as TT type, all anti didymellas of Resistance Identification result；
It is accredited as CC type, all sense blight dis-eases of Resistance Identification result；
It is accredited as TC type, all anti didymellas of Resistance Identification result；
Therefore, the correctness of provable molecular labeling CmGsbRS2.
According to Fig. 5-2, we conclude that using CmGsbRS3 primer pair respectively from flower skin tip melon and potherb mustard hybridization after
Selfing obtains and detects TT, AA and TA genotype in F2 offspring genome, and three kinds of genotype are 20:47:41, with resistant phenotype base
This coincide, and substantially conforms to single gene dominant genetic development 1:2:1.Thus it verifies KASP molecular labeling CmGsbRS3 and muskmelon is climing withered
Sick resistance close linkage.
The F2 offspring of above-mentioned respectively TT, AA and TA genotype was planted to one heart stage of four leaves, blight dis-ease is carried out
Resistance Identification, acquired results are as follows:
It is accredited as TT type, all anti didymellas of Resistance Identification result；
It is accredited as AA type, all sense blight dis-eases of Resistance Identification result；
It is accredited as TA type, all anti didymellas of Resistance Identification result；
Therefore, the correctness of provable molecular labeling CmGsbRS3.
According to Fig. 6-2, we conclude that using CmGsbRS4 primer pair respectively from flower skin tip melon and potherb mustard hybridization after
Selfing obtains and detects AA, CC and AC genotype in F2 offspring genome, and three kinds of genotype are 20:47:41, with resistant phenotype base
This coincide, and substantially conforms to single gene dominant genetic development 1:2:1.Thus it verifies KASP molecular labeling CmGsbRS4 and muskmelon is climing withered
Sick resistance close linkage.
The F2 offspring of above-mentioned respectively AA, CC and AC genotype was planted to one heart stage of four leaves, blight dis-ease is carried out
Resistance Identification, acquired results are as follows:
It is accredited as AA type, all anti didymellas of Resistance Identification result；
It is accredited as CC type, all sense blight dis-eases of Resistance Identification result；
It is accredited as AC type, all anti didymellas of Resistance Identification result；
Therefore, the correctness of provable molecular labeling CmGsbRS4.
Embodiment 4 carries out Gummy Stem Blight Resistance in Melon with KASP label CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4
Assisted selection
Specific practice is: hybridizing to flower skin tip melon and potherb mustard, then potherb mustard is used to be returned for recurrent parent, obtained
Backcross progeny segregating population is obtained, KASP label CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4 is respectively adopted and is marked
Remember assisted Selection, genotype and the flower skin tip are selected as a result respectively as shown in Fig. 3-3, Fig. 4-3, Fig. 5-3, Fig. 6-3, in backcross progeny
Single plant when melon is consistent or occurs colored skin tip melon and potherb mustard genotype simultaneously is further used for breeding improvement.
One, DNA is extracted
With embodiment 2.
Two, PCR amplification
With embodiment 3.
Three, genotype detection
With embodiment 3.
Four, KASP marks CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4 to carry out the auxiliary of Gummy Stem Blight Resistance in Melon disease
Help selection and use
Anti didymella muskmelon idioplasm flower skin tip melon hybridized with susceptible muskmelon idioplasm potherb mustard, then use potherb mustard for
Recurrent parent is persistently returned, in conjunction with the auxiliary choosing of KASP label CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4
It selects.In backcross progeny group, selects genotype consistent with flower skin tip melon or occur colored skin tip melon and potherb mustard gene simultaneously
It is consistent with potherb mustard individual (Fig. 3-3, Fig. 4-3, Fig. 5-3, Fig. 6-3) to eliminate genotype for single plant when type, as Resistant gerplasm.
It is specific as follows:
When selecting KASP label CmGsbRS1: in being returned the 8th generation group, obtaining homozygous disease-resistant gene type CC germplasm altogether
It is 33, heterozygosis disease-resistant gene type CG germplasm is 18, and homozygous susceptible genotype GG germplasm is 66.
It is accredited as homozygous disease-resistant gene type CC germplasm by above-mentioned and plants to one heart stage of four leaves, carry out blight dis-ease resistance mirror
It is fixed, all anti didymellas of acquired results.
Therefore, the correctness of provable molecular labeling CmGsbRS1.
When selecting KASP label CmGsbRS2: in being returned the 8th generation group, obtaining homozygous disease-resistant gene type TT germplasm altogether
It is 33, heterozygosis disease-resistant gene type TC germplasm is 18, and homozygous susceptible genotype CC germplasm is 66.
It is accredited as homozygous disease-resistant gene type TT germplasm by above-mentioned and plants to one heart stage of four leaves, carry out blight dis-ease resistance mirror
It is fixed, all anti didymellas of acquired results.
Therefore, the correctness of provable molecular labeling CmGsbRS2.
When selecting KASP label CmGsbRS3: in being returned the 8th generation group, obtaining homozygous disease-resistant gene type TT germplasm altogether
It is 33, heterozygosis disease-resistant gene type TA germplasm is 18, and homozygous susceptible frequency of genotypes AA germplasm is 66.
It is accredited as homozygous disease-resistant gene type TT germplasm by above-mentioned and plants to one heart stage of four leaves, carry out blight dis-ease resistance mirror
It is fixed, all anti didymellas of acquired results.
Therefore, the correctness of provable molecular labeling CmGsbRS3.
When selecting KASP label CmGsbRS4: in being returned the 8th generation group, obtaining homozygous disease-resistant gene type AA germplasm altogether
It is 33, heterozygosis disease-resistant gene type AC germplasm is 18, and homozygous susceptible genotype CC germplasm is 66.
It is accredited as homozygous disease-resistant gene type AA germplasm by above-mentioned and plants to one heart stage of four leaves, carry out blight dis-ease resistance mirror
It is fixed, all anti didymellas of acquired results.
Therefore, the correctness of provable molecular labeling CmGsbRS4.
Inventor also used during invention with molecular labeling CmGsbRS1, CmGsbRS2 of the invention,
Remaining close molecular labeling of CmGsbRS3, CmGsbRS4 sequence；But it will lead to and determine that deviation occurs in result, that is, cause to sentence
Determine the decline of result precision.
Finally, it should also be noted that the above list is only a few specific embodiments of the present invention.Obviously, of the invention
Above embodiments are not limited to, acceptable there are many denaturation.Those skilled in the art can be straight from present disclosure
All deformations for connecing export or associating, are considered as protection scope of the present invention.
Sequence table
<110>Zhejiang University
<120>four kinds of Gummy Stem Blight Resistance in Melon molecular labelings and purposes based on single nucleotide polymorphism
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gaatctacca aaagtatcag tagaaagag 29
<210> 2
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gaatctacca aaagtatcag tagaaagac 29
<210> 3
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ctcagaaaag gataaacctt tggaggaa 28
<210> 4
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aataaggctt tgttatactt actgagaaa 29
<210> 5
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aaggctttgt tatacttact gagaag 26
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ctccacgggt tccttctact ca 22
<210> 7
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
atttgtggga atctccccct ggt 23
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
atttgtggga atctccccct gga 23
<210> 9
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
cccatcttcc atttgaatgg taaaggaa 28
<210> 10
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cttccaggta taggtttgaa tgtagaa 27
<210> 11
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ttccaggtat aggtttgaat gtagac 26
<210> 12
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
tcaagcatgt tgatggtttg tcgtt 25
Claims (4)
1. four kinds of molecules for gummy stem blight of melon Resistance Identification based on the chain single nucleotide polymorphism exploitation of anti didymella
Label, using muskmelon as species, it is characterized in that: in molecular labeling CmGsbRS1, CmGsbRS2, CmGsbRS3, CmGsbRS4
Any one；Molecular labeling primer uses following primer pair, and nucleotides sequence therein is classified as 5 ' -3 ',
CmGsbRS1: equipotential primer 1:GAATCTACCAAAAGTATCAGTAGAAAGAG
Equipotential primer 2: GAATCTACCAAAAGTATCAGTAGAAAGAC
Universal primer: CTCAGAAAAGGATAAACCTTTGGAGGAA；
CmGsbRS2: equipotential primer 1:AATAAGGCTTTGTTATACTTACTGAGAAA
Equipotential primer 2: AAGGCTTTGTTATACTTACTGAGAAG
Universal primer: CTCCACGGGTTCCTTCTACTCA；
CmGsbRS3: equipotential primer 1:ATTTGTGGGAATCTCCCCCTGGT
Equipotential primer 2: ATTTGTGGGAATCTCCCCCTGGA
Universal primer: CCCATCTTCCATTTGAATGGTAAAGGAA；
CmGsbRS4: equipotential primer 1:CTTCCAGGTATAGGTTTGAATGTAGAA
Equipotential primer 2: TTCCAGGTATAGGTTTGAATGTAGAC
Universal primer: TCAAGCATGTTGATGGTTTGTCGTT.
2. the purposes of molecular labeling as described in claim 1, it is characterized in that: for identifying Gummy Stem Blight Resistance in Melon germplasm or thereafter
The assisted selection in generation.
3. the purposes of molecular labeling according to claim 2, it is characterized in that: when the hybridization for screening flower skin tip melon and potherb mustard
When with backcross progeny, genotype in offspring is selected to spend skin tip melon genotype consistent with disease-resistant muskmelon or there is colored skin tip melon simultaneously
Breeding is used for single plant when potherb mustard genotype.
4. the purposes of molecular labeling according to claim 2, it is characterized in that: when screening anti didymella muskmelon idioplasm, choosing
Genotype in germplasm is selected to spend skin tip melon genotype consistent with disease-resistant muskmelon or there is colored skin tip melon and potherb mustard genotype simultaneously
When germplasm be used for breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910109657.4A CN109735650B (en) | 2019-02-11 | 2019-02-11 | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910109657.4A CN109735650B (en) | 2019-02-11 | 2019-02-11 | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109735650A true CN109735650A (en) | 2019-05-10 |
| CN109735650B CN109735650B (en) | 2021-04-27 |
Family
ID=66367321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910109657.4A Active CN109735650B (en) | 2019-02-11 | 2019-02-11 | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109735650B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110331098A (en) * | 2019-07-11 | 2019-10-15 | 浙江省农业科学院 | A kind of sporogenic method of promotion blight dis-ease pathogen |
| CN115125320A (en) * | 2022-06-01 | 2022-09-30 | 华中农业大学 | InDel marker co-separated from gummy stem blight resistance gene Gsb-3 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140506A (en) * | 2010-12-16 | 2011-08-03 | 新疆农业科学院哈密瓜研究中心 | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof |
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
| CN102845300A (en) * | 2012-07-23 | 2013-01-02 | 南京农业大学 | Identification of muskmelon anti-gummy stem blight polymeric gene |
-
2019
- 2019-02-11 CN CN201910109657.4A patent/CN109735650B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140506A (en) * | 2010-12-16 | 2011-08-03 | 新疆农业科学院哈密瓜研究中心 | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof |
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
| CN102845300A (en) * | 2012-07-23 | 2013-01-02 | 南京农业大学 | Identification of muskmelon anti-gummy stem blight polymeric gene |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110331098A (en) * | 2019-07-11 | 2019-10-15 | 浙江省农业科学院 | A kind of sporogenic method of promotion blight dis-ease pathogen |
| CN110331098B (en) * | 2019-07-11 | 2021-11-09 | 浙江省农业科学院 | Method for promoting pathogenic bacteria of gummy stem blight to produce spores |
| CN115125320A (en) * | 2022-06-01 | 2022-09-30 | 华中农业大学 | InDel marker co-separated from gummy stem blight resistance gene Gsb-3 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109735650B (en) | 2021-04-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102098909B (en) | A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof | |
| CN101821409A (en) | Methods and compositions for breeding for preferred traits | |
| CN107090468B (en) | Methods and compositions for selecting soybean plants resistant to meloidogyne incognita | |
| CN106148510B (en) | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application | |
| US20220142075A1 (en) | Methods of identifying and selecting maize plants with resistance to anthracnose stalk rot | |
| US20220010325A1 (en) | Quantitative trait loci (qtl) associated with shattering-resistant capsules in sesame and uses thereof | |
| WO2011056836A2 (en) | Genetic loci associated with resistance to tropical rust in maize | |
| US20200063217A1 (en) | Compositions and methods for identifying and selecting maize plants with resistance to northern leaf blight | |
| WO2015143867A1 (en) | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof | |
| Abdellatif et al. | Genetic diversity of new maize hybrids based on SSR markers as compared with other molecular and biochemical markers | |
| CN109688805B (en) | Method for producing gray leaf spot resistant maize | |
| Missihoun et al. | Genetic diversity of Sorghum bicolor (L.) Moench landraces from Northwestern Benin as revealed by microsatellite markers | |
| CN104862416B (en) | The locus associated with Fusarium ear mold resistance in corn | |
| CN109735650A (en) | Four kinds of Gummy Stem Blight Resistance in Melon molecular labelings and purposes based on single nucleotide polymorphism | |
| CN109797238A (en) | Two kinds of molecular labelings and application thereof for gummy stem blight of melon Resistance Identification based on the exploitation of anti didymella linked gene | |
| CN106591489A (en) | Rice grain length gene GW7 molecular marker and special primer sequences thereof | |
| US10161009B2 (en) | Compositions and methods for selecting maize plants with resistance to anthracnose stalk rot | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CA2956473C (en) | Compositions and methods for selecting maize plants with increased ear weight and increased yield | |
| Von Korff et al. | Genetic variation among Rhynchosporium secalis populations of West Asia and North Africa as revealed by RAPD and AFLP analysis | |
| US20170137840A1 (en) | Compositions and methods for selecting maize plants with resistance to bacterial stalk rot | |
| CN104271769A (en) | Compositions and methods to select for reduced grain moisture in maize | |
| US20150167105A1 (en) | Genetic loci associated with gray leaf spot in maize | |
| Mienie | Towards marker assisted selection for nematode resistance in soybean. | |
| Naidoo | Identification of molecular markers linked to resistance quantitative trait loci (QTL) to common bacterial blight in dry bean |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |