CN109735641A - A kind of quick detection primer group of chlamydia pneumoniae, kit - Google Patents
A kind of quick detection primer group of chlamydia pneumoniae, kit Download PDFInfo
- Publication number
- CN109735641A CN109735641A CN201910158453.XA CN201910158453A CN109735641A CN 109735641 A CN109735641 A CN 109735641A CN 201910158453 A CN201910158453 A CN 201910158453A CN 109735641 A CN109735641 A CN 109735641A
- Authority
- CN
- China
- Prior art keywords
- probe
- chlamydia pneumoniae
- primer
- sequence
- quick detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of quick detection primer group of chlamydia pneumoniae, kit, the quick detection primer group of chlamydia pneumoniae includes detecting the upstream and downstream primer and probe of chlamydia pneumoniae gene group MOMP gene order；The chlamydia pneumoniae quick detection kit includes the following contents: lysate redissolves liquid, the EMA reaction tube containing primed probe, positive quality control product, negative quality-control product.Primer sets provided by the invention can cooperate EMA technology to be prepared into chlamydia pneumoniae detection kit, significantly improve the specificity and sensitivity of detection in conjunction with chlamydia pneumoniae MOMP gene specific.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of quick detection primer group of chlamydia pneumoniae, kit.
Background technique
Chlamydia pneumoniae (Chlamydia pneumoniae, CP) is a kind of Chlamydia kind of discovery the 1980s,
Grain stain is negative, and the prokaryotes of special sexual cell endoparasitism are a kind of human pathogens.Mainly passed by respiratory tract droplet
It broadcasts.Incubation period is 15-23 days.Into after human body, generate endotoxin, the infection of the upper respiratory tract can be caused, as nasosinusitis, tympanitis and
Pharyngitis can also cause lower respiratory tract infection, such as bronchitis and pneumonia.Investigation in recent years shows, community acquired pneumonia
In (community acquired pneumonia, CAP) pathogen, chlamydia pneumoniae has been thermophilic after streptococcus pneumonia and influenza
Cause the main pathogens of CAP after blood bacillus, and proportion constantly increases.It is easy to out in the more intensive place of population
Existing prevalence.Majority of populations are in subclinical infection, and preliminary clinical feature is often unobvious, controls once cannot find to be easy to cause in time
Treat delay.Also it is difficult to obtain accurate diagnosis according to its clinical manifestation, x-ray inspection etc. after suspected infection.For Chlamydia
The treatment of pneumonia, more active drug mainly include macrolides, Tetracyclines and fluoroquinolones, but Tetracyclines and
Fluoroquinolones do not recommend to use in children.In addition, chlamydia pneumonia therapeutic response is slow, the course for the treatment of is longer, such as treats
Early to stop, symptom is easy recurrence.Some researches show that old and frail, immunocompromised person is easier to pneumonia infection Chlamydia, and easily anti-
It is multiple, it is difficult to control, in the infected, the elderly's case fatality rate reaches 5%-10%, and China's aging is got worse, this makes pneumonia
The early diagnosis and control of choamydiae infection are more important.
Currently, clinically detect chlamydia pneumoniae method it is very much, mainly have cell culture isolation, serological method,
Nucleic acid amplification etc..Cell culture isolation takes a long time, and sensitivity is lower and operation is complicated；Serological method is generally examined
IgM or IgG antibody are surveyed, and the generation of internal antibody needs the long period and is easy to be interfered, and cannot accomplish early screening.Core
The features such as sour amplification is highly sensitive, time-consuming short because of it, is increasingly becoming main detection method.It is usually used in detecting pneumonia clothing at present
The molecular detection technology of substance includes real-time fluorescence quantitative PCR, ring mediation nucleic acid isothermal amplification technology (loop-mediated
Isothermalamplification method, LAMP) etc..Although and these method high sensitivities, need temperature varied cyclical
Or 65 DEG C of higher constant temperature, it is easy to produce aerosol, there is the risk of pollution, this allows for specificity and is affected, furthermore
These methods require to be equipped with expensive accurate real-time fluorescent PCR amplification instrument, and trivial operations, take a long time, have to operator
Compared with high-tech requirement.If 105567802 A of patent CN is using Taqman probe, needs are entirely reacted using the method for PCR
2 hours.
In order to overcome the above difficulty, the present invention is devised for chlamydia pneumoniae outer membrane major protein encoding gene (MOMP)
Multipair primer is screened, finally obtained primer, can be prominent to base with specific bond MOMP gene, and since primer is longer
Change has certain inclusiveness, improves the sensitivity of detection；Probe length 35bp is different from the both ends label of Taqman, this hair
Probe label in bright is in sequence middle and lower reaches 26-28, is embedded in interior sequences, and such design facilitates fluorescence noise reduction,
It reduces the false positive of detection, improve the specificity of detection.Cooperate room temperature nucleic acid amplification technologies (Enzymes Mediated
Amplification, EMA), under 37-45 DEG C of relatively low constant temperature, detects 10-30 minutes, this kit can be made to have
The advantages that high sensitivity, specificity are high, time-consuming short, easy to operate, at low cost, anti-pollution, makes the quick detection of chlamydia pneumoniae
Kit has certain competitiveness in molecular diagnosis industry.
Summary of the invention
In view of the above problems, the present invention provides a kind of quick detection primer group of chlamydia pneumoniae, kit, high sensitivity,
Specificity is high, easy to operate, instrument cost is low, not easy to pollute, can quickly and accurately detect chlamydia pneumoniae.
In order to achieve the above objectives, the technical scheme is that the quick detection primer group of chlamydia pneumoniae, includes detection lung
The upstream and downstream primer and probe of scorching chlamydia trachomatis gene group MOMP gene conserved sequence, the upstream primer is: 5 '-
ACTCTACAGCGTTCAATCTCGTTGGTT-3'；The downstream primer is: 5 '-
CCTTTATAGCCCTTGGGTTTGTTTACAGA-3'；The probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-
FAMdT//idSp//iBHQ1dT/GCATATTGGA-3’C3 Spacer。
Wherein: " i6-FAMdT " refers to that the dT nucleotide of 6-FAM (6- Fluoresceincarboxylic acid) fluorescent marker, " idSp " refer to that base lacks
It loses, " iBHQ1dT " refers to that the dT nucleotide with BHQ1 quenching group label, " C3 Spacer " refer to that 3 ' hydroxyls are closed."i6-
FAMdT ", " iBHQ1dT " are in sequence middle and lower reaches the 26th, 28.
Further, the upstream primer can be 5 ' of upstream primer sequence described in claim 1,3 ' ends and extend or contract
Short 10bp, the downstream primer can be 5 ' of downstream primer sequence described in claim 1,3 ' ends and extend or shorten 10bp, institute
Stating probe can be 5 ' of probe sequence described in claim 1,3 ' end extensions or shortens 10bp；Alternatively, the upstream and downstream primer
It can be the sequence with the sequence homology of upstream and downstream primer and probe described in claim 1 greater than 85% respectively with probe；Or
Person, the upstream and downstream primer and probe can be the series with upstream and downstream primer and probe described in claim 1 respectively
The sequence of reverse complemental；Alternatively, the 6-FAM of the probe, missing or BHQ1 label are in 21-32 of sequence；Alternatively, institute
6-FAM, missing or the BHQ1 label for stating probe are in 21-32 of reverse complementary sequence.
Further, the probe length has a 35bp, fluorescence, base deletion and that modification is quenched is adjacent, and in sequence
26-28, downstream.
The present invention also provides a kind of chlamydia pneumoniae quick detection kits, and the kit includes the following contents:
(1) lysate
(2) liquid is redissolved；
(3) the EMA reaction tube containing primed probe；The primer includes upstream and downstream primer and probe；The upstream primer
It is: 5 '-ACTCTACAGCGTTCAATCTCGTTGGTT-3 '；The downstream primer is: 5 '-
CCTTTATAGCCCTTGGGTTTGTTTACAGA-3'；The probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-
FAMdT//idSp//iBHQ1dT/GCATATTGGA-3'C3 Spacer；
(4) positive quality control product；
(5) negative quality-control product.
Further, the upstream primer can be 5 ' of upstream primer sequence described in claim 1,3 ' ends and extend or contract
Short 10bp, the downstream primer can be 5 ' of downstream primer sequence described in claim 1,3 ' ends and extend or shorten 10bp, institute
Stating probe can be 5 ' of probe sequence described in claim 1,3 ' end extensions or shortens 10bp；Alternatively, the upstream and downstream primer
It can be the sequence with the sequence homology of upstream and downstream primer and probe described in claim 1 greater than 85% respectively with probe；Or
Person, the upstream and downstream primer and probe can be the series with upstream and downstream primer and probe described in claim 1 respectively
The sequence of reverse complemental；Alternatively, the 6-FAM of the probe, missing or BHQ1 label are in 21-32 of sequence；Alternatively, institute
6-FAM, missing or the BHQ1 label for stating probe are in 21-32 of reverse complementary sequence.
Further, the probe length has a 35bp, fluorescence, base deletion and that modification is quenched is adjacent, and in sequence
26-28, downstream.
Preferably, the lysate contains chelex-100,10- of NP-40,20-50mg/mL of final concentration of 2-5%
The Tris-Ac and ultrapure water of the pH8.0 of 20mM；
Preferably, the MgAc for redissolving liquid and containing final concentration of 20-30mM2, 90-100mM Tris-Ac (pH8.0),
The PEG20000 (W/V) and ultrapure water of KAc, 10-15% of 55-60mM.
Preferably, the ingredient of the EMA reaction tube containing primed probe is as follows: containing final concentration of in each reaction tube
The single-stranded DNA binding protein of 24-27ng/ μ l, the ATP regenerated protein of 62-125pg/ μ l, 6-7.5ng/ μ l DNA helicase, 2-
The archaeal dna polymerase of 3ng/ μ l, the DNA restriction enzyme of 90-120pg/ μ l, 300-400pg/ μ l auxilin, 200-
The upstream primer of 300nM, the downstream primer of 200-300nM, the probe of 30-40nM, the Creatine Phosphate Sodium of 20-30mM, 2-3mM
The Tris-Ac (pH8.0) of ATP, 100-150 μM dNTP, 50-60mM, the trehalose of 35-50 μ g/ μ l, 100-120mM
KAc, the mannitol of 7.5-10ng/ μ l, 1-5% PEG20000 (W/V).
Preferably, the negative quality-control product is ultrapure water blank control.
Preferably, the positive quality control product is the plasmid containing aim sequence, and concentration is 1*104copies/μl。
The present invention also provides the quick detection primer groups of the chlamydia pneumoniae in preparation chlamydia pneumoniae quick detection reagent
Application in box.
The present invention also provides a kind of detection method of chlamydia pneumoniae, the detection method uses the chlamydia pneumoniae
Quick detection kit, the detection method is not for the purpose of the diagnosing and treating of disease；The detection method includes following step
It is rapid:
(1) the chlamydia pneumoniae quick detection kit is used, target sample swab is put into 500 μ l lysates
And cut, vortex oscillation 30 seconds, 5000 revs/min, it is centrifuged 1 minute, 100 μ l supernatants is taken to be transferred in new 1.5mL centrifuge tube,
90 DEG C of heating of metal bath crack 10 minutes, are subsequently cooled to room temperature, supernatant is taken to be detected；
(2) the chlamydia pneumoniae quick detection kit is used, 10 μ l is taken to redissolve liquid and 10 μ l samples cracking gained
Supernatant is added in the EMA reaction tube containing primed probe, mixes well, the another setting positive and negative control；
(3) the EMA reaction tube of redissolution is put into Click i nucleic acid fluorescent detector, 37-45 DEG C amplification 10-30 minutes,
Scanning fluorescence is primary within every 30 seconds, acquires fluorescence data, when drafting m- fluorescence signal figure；
(4) result Quality Control: positive quality control product Ct value < 20, fluorescence curve are typical " S " type, negative quality-control product without Ct value,
Conditions above is all satisfied, this experiment effectively, otherwise in vain, needs to check reason and retests；
(5) result judges: if scan sample fluorescence curve is typical " S " type, and Ct value < 30, being then judged as positive knot
Fruit；Conversely, scanning fluorescence curve is horizontal linear, no Ct value is then negative findings.
The present invention uses room temperature nucleic acid amplification technologies, passes through DNA helicase, single-stranded DNA binding protein, archaeal dna polymerase etc.
Multiple enzymatic reactions can make target DNA amplification millions of under 37-45 DEG C of relatively low constant temperature in 10-30 minutes
Times, cooperate detection technique of fluorescence, the quick detection to DNA to be checked may be implemented.
What primer sequence of the invention was obtained by: screening lung is compared by domestic and foreign literature and Genebank database
Scorching chlamydia trachomatis gene, it is final to determine with outer membrane major protein encoding gene (MOMP) as purpose gene, the gene it is highly conserved and
With chlamydia pneumoniae species specificity, by detecting the sequence, it can whether contain chlamydia pneumoniae in clear sample.From
Chlamydia pneumoniae MOMP gene order (sequence number KC512913.1) is downloaded in Genebank, it is soft by Primer Premier 6
Part designs 3 pairs of primers and 1 probe, and using the plasmid containing aim sequence as template, 37-45 DEG C of amplification passes through the knot of fluorescence detection
Fruit screens suitable primer and probe.Screening criteria: expanding sensitivity at least to 100copies/ μ l, positive amplification curve is
Typical " S " curve, negative amplification curve are horizontal linears.
To obtain primer sets of the invention:
Upstream primer is: 5 '-ACTCTACAGCGTTCAATCTCGTTGGTT-3 '；
Downstream primer is: 5 '-CCTTTATAGCCCTTGGGTTTGTTTACAGA-3 '；
Probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-FAMdT//idSp//iBHQ1dT/
GCATATTGGA-3’C3 Spacer。
Kit of the invention is to cooperate EMA (Enzymes Mediated using the primer sets obtained after screening
Amplification, the nucleic acid amplification technologies that multienzyme mediates, i.e. room temperature nucleic acid amplification technologies) system preparation condition, adjust primer
And the optium concentration of probe, it prepares the EMA reaction tube containing primed probe, redissolve liquid, lysate, negative quality-control product and positive quality control
Product form chlamydia pneumoniae quick detection kit.
The beneficial effect comprise that
1, primer sequence is longer in the present invention, even if target sequence can also be expanded normally there are 1-3 mutation in sample,
To increase sensitivity of the invention.
2, middle probe sequence of the present invention is longer, FAM and BHQ1 label sequence inside and fluorescence, base deletion and be quenched
Modify adjacent, such design increases the adaptability of amplification system, reduces background fluorescence while reducing false positive.If
In sample there is mutation in target sequence, will not influence the annealing of fluorescence probe and target sequence and the generation of fluorescence signal and release
It puts, helps to increase accuracy of the invention, sensitivity and specificity.
3, kit contains lysate in the present invention, can be with the DNA of chlamydia pneumoniae in rapidly extracting sample, without additional
Extracts kit reduces cost and improves efficiency.
4, the reagent in this kit in EMA reaction tube pass through frozen dried, can 2-8 DEG C of storage and transport, reduce guarantor
It deposits and the equipment requirement of cold chain transportation, while extending validity period.
5, amplifying nucleic acid amplification condition of the present invention is 37 DEG C to 45 DEG C, low to temperature requirement, low to machine requirement, is reduced simultaneously
Aerosol reduces the risk of pollution.
6, the nucleic acid amplification time of the invention is short, can report result in 30 minutes.
The present invention screens best primer and probe using the conserved sequence of the MOMP gene of chlamydia pneumoniae as purpose gene,
And cooperate with general EMA enzyme, optimal experiment reaction system is formed, makes kit of the present invention that there is the advantage in detectability
With feature, simple and easy, but also sensitivity with higher, accuracy, precision, specificity and repeatable are not only detected
Property.
The present invention devises multipair primer for chlamydia pneumoniae outer membrane major protein encoding gene (MOMP) and screens,
Finally obtained primer can have certain inclusiveness to base mutation with specific bond MOMP gene, and since primer is longer,
Improve the sensitivity of detection；Probe length 35bp, is different from the both ends label of Taqman, and the probe label in the present invention is in
Sequence middle and lower reaches 26-28, are embedded in interior sequences, and such design facilitates fluorescence noise reduction, reduces the false positive of detection, mentions
The specificity of high detection, therefore the present invention has very high sensitivity, specificity and accuracy.Cooperate room temperature nucleic acid amplification technologies
(EnzymesMediated Amplification, EMA), under 37-45 DEG C of relatively low constant temperature, 10-30 points of detection
Clock can make this kit have the advantages that high sensitivity, specificity are high, time-consuming short, easy to operate, at low cost, anti-pollution, make pneumonia
The quick detection kit of Chlamydia has certain competitiveness in molecular diagnosis industry.
Detailed description of the invention
Fig. 1 is the selection result of the quick detection primer group of 1 chlamydia pneumoniae of embodiment.
Fig. 2 is the verification result of 2 chlamydia pneumoniae primary dcreening operation primer of embodiment.
Fig. 3 is the testing result of 4 cross reaction of embodiment.
Specific embodiment
The present invention will be further described in detail with reference to the specific embodiments, and selected formula is the preferred of kit
Formula, but the range being not intended to limit the invention.
The quick detection primer group of chlamydia pneumoniae provided by the invention guards sequence comprising detection chlamydia pneumoniae MOMP gene
The upstream and downstream primer and probe of column, the upstream primer is: 5 '-ACTCTACAGCGTTCAATCTCGTTGGTT-3 '；Under described
Trip primer is: 5 '-CCTTTATAGCCCTTGGGTTTGTTTACAGA-3 '；The probe is 5 '-
AAGTTCTTCAACTTTAGGTTTGGAC/i6-FAMdT//idSp//iBHQ1dT/GCATATTGGA-3’C3 Spacer。
The present invention also provides chlamydia pneumoniae quick detection kit, the kit includes the following contents:
(1) lysate；
(2) liquid is redissolved；
(3) the EMA reaction tube containing primed probe；The primed probe includes upstream and downstream primer and probe；Draw the upstream
Object is: 5 '-ACTCTACAGCGTTCAATCTCGTTGGTT-3 '；The downstream primer is: 5 '-
CCTTTATAGCCCTTGGGTTTGTTTACAGA-3'；The probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-
FAMdT//idSp//iBHQ1dT/GCATATTGGA-3'C3 Spacer；
(4) positive quality control product；
(5) negative quality-control product.
Preferably, the lysate contains chelex-100,10- of NP-40,20-50mg/mL of final concentration of 2-5%
The Tris-Ac and ultrapure water of the pH8.0 of 20mM.
Preferably, it is described redissolve liquid contain final concentration of 20-30mM MgAc2,90-100mM Tris-Ac (pH8.0),
The PEG20000 (W/V) and ultrapure water of KAc, 10-15% of 55-60mM.
Preferably, the ingredient of the EMA reaction tube containing primed probe is as follows: containing final concentration of in each reaction tube
The single-stranded DNA binding protein of 24-27ng/ μ l, the ATP regenerated protein of 62-125pg/ μ l, 6-7.5ng/ μ l DNA helicase, 2-
The archaeal dna polymerase of 3ng/ μ l, the DNA restriction enzyme of 90-120pg/ μ l, 300-400pg/ μ l auxilin, 200-
The upstream primer of 300nM, the downstream primer of 200-300nM, the probe of 30-40nM, the Creatine Phosphate Sodium of 20-30mM, 2-3mM
The Tris-Ac (pH8.0) of ATP, 100-150 μM dNTP, 50-60mM, the trehalose of 35-50 μ g/ μ l, 100-120mM
KAc, the mannitol of 7.5-10ng/ μ l, 1-5% PEG20000 (W/V).
Preferably, the negative quality-control product is ultrapure water blank control.
Preferably, the positive quality control product is the plasmid containing aim sequence, and concentration is 1*104copies/μL。
The upstream primer can be 5 ' of upstream primer sequence described in claim 1,3 ' ends and extend or shorten 10bp, institute
It states downstream primer and can be 5 ' of downstream primer sequence described in claim 1,3 ' ends and extend or shorten 10bp, the probe can be with
It is 5 ', 3 ' end extensions or the shortening 10bp of probe sequence described in claim 1；Alternatively, the upstream and downstream primer and probe can be with
It is the sequence for being greater than 85% with the sequence homology of upstream and downstream primer and probe described in claim 1 respectively；Alternatively, on described,
Downstream primer and probe can be respectively with the series reverse complemental of upstream and downstream primer and probe described in claim 1
Sequence；Alternatively, the 6-FAM of the probe, missing or BHQ1 label are in 21-32 of sequence；Alternatively, the 6- of the probe
FAM, missing or BHQ1 label are in 21-32 of reverse complementary sequence.
The present invention also provides a kind of detection method of chlamydia pneumoniae, the detection method uses the chlamydia pneumoniae
Quick detection kit, for the detection method not for the purpose of the diagnosing and treating of disease, the detection method includes following step
It is rapid:
(1) the chlamydia pneumoniae quick detection kit is used, target sample swab is put into 500 μ l lysates
And cut, vortex oscillation 30 seconds, 5000 revs/min, it is centrifuged 1 minute, 100 μ l supernatants is taken to be transferred in new 1.5mL centrifuge tube,
90 DEG C of heating of metal bath crack 10 minutes, are subsequently cooled to room temperature, supernatant is taken to be detected；
(2) the chlamydia pneumoniae quick detection kit is used, 10 μ l is taken to redissolve liquid and 10 μ, 1 sample cracking gained
Supernatant is added in the EMA reaction tube containing primed probe, mixes well, the another setting positive and negative control；
(3) the EMA reaction tube of redissolution is put into Click i nucleic acid fluorescent detector, 37-45 DEG C amplification 10-30 minutes,
Scanning fluorescence is primary within every 30 seconds, acquires fluorescence data, when drafting m- fluorescence signal figure；
(4) result Quality Control: positive quality control product Ct value < 20, fluorescence curve are typical " S " type, negative quality-control product without Ct value,
Conditions above is all satisfied, this experiment effectively, otherwise in vain, needs to check reason and retests；
(5) result judges: if scan sample fluorescence curve is typical " S " type, and Ct value < 30, being then judged as positive knot
Fruit；Conversely, scanning fluorescence curve is horizontal linear, no Ct value is then negative findings.
The screening of the quick detection primer group of embodiment 1, chlamydia pneumoniae
Chlamydia pneumoniae specific sequence is screened by document and Genebank, final determination is compiled with outer membrane major protein
Code gene (MOMP) is purpose gene, and the gene is highly conserved and has chlamydia pneumoniae species specificity, by detecting the sequence
Column, it can whether contain chlamydia pneumoniae in clear sample.Chlamydia pneumoniae MOMP gene order is downloaded from Genebank
(sequence number KC512913.1) passes through 6 software design of Primer Premier, 3 upstream primers, 3 downstream primers and 1
Probe (is shown in Table 1).Using EMA enzyme and the probe of design, with containing MOMP gene order plasmid (copy number is 1 ×
104Copies/ μ l) it is template, the primer of design is subjected to cross match, totally 9 kinds of combinations, are expanded, and screen primer.Primary dcreening operation
Standard: positive amplification curve is that typical " S " curve, negative amplification curve are that horizontal linear, amplification curve Ct value are small as far as possible.Primer
Screening PRELIMINARY RESULTS is shown in Fig. 1, primer pair CPF1/CPR1, CPF1/CPR2, CPF1/CPR3, CPF2/CPR2, CPF2/CPR3,
CPF3/CPR2, can amplify " S " curve and feminine gender is horizontal linear, other primer pairs do not amplify curve, wherein drawing
Object is forward to CPF1/CPR2 amplification curve Ct value, so this is selected to carry out verifying detection limit to primer.
1 primer sets sequence of table
The verifying of embodiment 2, chlamydia pneumoniae primary dcreening operation primer
For the present embodiment using the primer and probe screened, preparation contains primed probe EMA reaction tube, contains in the reaction tube
There are the single-stranded DNA binding protein of final concentration of 24-27ng/ μ l, the ATP regenerated protein of 62-125pg/ μ l, 6-7.5ng/ μ l
The auxiliary of DNA helicase, the archaeal dna polymerase of 2-3ng/ μ l, the DNA restriction enzyme of 90-120pg/ μ l, 300-400pg/ μ l
Albumen, the upstream primer of 200-300nM, the downstream primer of 200-300nM, the probe of 30-40nM, 20-30mM phosphocreatine
Trehalose, the 100- of sodium, the Tris-Ac (pH8.0) of ATP, 100-150 μM dNTP, 50-60mM of 2-3mM, 35-50 μ g/ μ l
The KAc of 120mM, the mannitol of 7.5-10ng/ μ l, 1-5% PEG20000 (W/V).Be lyophilized, be stored in 2-8 DEG C it is spare.
It prepares and redissolves liquid, the Tris-Ac (pH8.0) of MgAc2,90-100mM in solution containing final concentration of 20-30mM,
The PEG20000 (W/V) and ultrapure water of KAc, 10-15% of 55-60mM.
Reagent verifying: using the plasmid containing MOMP gene order as template, and by template with 10 times of gradient dilutions, concentration model
Enclose is 1 × 106Copies/ μ l to 1copies/ μ l, is expanded.Amplification is shown in Fig. 2.The template of lcopies/ μ l concentration does not have
There is amplification curve, the detection of primer sets amplification is limited in 10copies/ μ l or so, can reach primer sets screening criteria.
Embodiment 3, design chlamydia pneumoniae quick detection kit
The present embodiment is based on EMA technology (room temperature nucleic acid amplification technologies), separately designs lysate, redissolves liquid, visits containing primer
The EMA reaction tube of needle.The primed probe is the primed probe that 1 finishing screen of embodiment is selected.
(1) lysate
By comparing each combination, ratio, lytic effect, pyrolysis time and interference to EMA system for extracting reagent, finally
The lysate of selection contains chelex-100,10-20mM's of the NP-40 (v/v) of final concentration of 2-5%, 20-50mg/mL
The Tris-Ac and ultrapure water of pH8.0.
(2) liquid and the EMA reaction tube containing primed probe are redissolved
By adjusting primer, concentration of probe etc., optimal amplification system is formd:
The redissolution liquid of selection contains Tris-Ac (pH8.0), the 55- of MgAc2,90-100mM of final concentration of 20-30mM
The PEG20000 (W/V) and ultrapure water of KAc, 10-15% of 60mM.
Contain the single stranded DNA combination egg of final concentration of 24-27ng/ μ l in the EMA reaction tube containing primed probe selected
White, 62-125pg/ μ l ATP regenerated protein, the DNA helicase of 6-7.5ng/ μ l, 2-3ng/ μ l archaeal dna polymerase, 90-
The DNA restriction enzyme of 120pg/ μ l, the auxilin of 300-400pg/ μ l, the upstream primer of 200-300nM, 200-
The downstream primer of 300nM, the probe of 30-40nM, the Creatine Phosphate Sodium of 20-30mM, 2-3mM ATP, 100-150 μM of dNTP,
The Tris-Ac (pH8.0) of 50-60mM, the trehalose of 35-50 μ g/ μ l, the KAc of 100-120mM, 7.5-10ng/ μ l sweet dew
The PEG20000 (W/V) of alcohol, 1-5%.
(3) negative quality-control product is ultrapure water blank control.
(4) positive quality control product is the plasmid containing aim sequence, and concentration is 1*104copies/μl。
Chlamydia pneumoniae fluorescence EMA detecting step is as follows:
The extraction of the first step, sample DNA.Target sample swab is put into 500 μ l lysates and is cut, vortex oscillation 30
Second, it 5000 revs/min, is centrifuged 1 minute, takes 100 μ l supernatants to be transferred in new 1.5mL centrifuge tube, 90 DEG C of heating of metal bath are split
Solution 10 minutes, is subsequently cooled to room temperature, supernatant is taken to be detected；
Second step takes 10 μ l to redissolve liquid and 10 μ l samples cracking gained supernatant, is added to the EMA reaction tube containing primed probe
In, it mixes well, the another setting positive and negative control；
The EMA reaction tube of redissolution is put into Click i nucleic acid fluorescent detector, 37-45 DEG C of amplification 10-30 by third step
Minute, scanning fluorescence is primary within every 30 seconds, acquisition fluorescence data, when drafting m- fluorescence signal figure；
4th step, result Quality Control: positive quality control product Ct value < 20, fluorescence curve are typical " S " type, and negative quality-control product is without Ct
Value, conditions above are all satisfied, this experiment effectively, otherwise in vain, needs to check reason and retests；
5th step, result judge: if scan sample fluorescence curve is typical " S " type, and Ct value < 30, being then judged as positive
Property result；Conversely, scanning fluorescence curve is horizontal linear, no Ct value is then negative findings.
Embodiment 4: the detection of cross reaction:
The nucleic acid extractive of part human infection common causative is selected, nucleic acid concentration is shown in Table 2, including mycoplasma pneumoniae,
Influenza H1N1, syncytial virus type A, adenovirus type III, Adenovirus type 7, mycobacterium tuberculosis, streptococcus pneumonia, Staphylococcus aureus
Bacterium, Escherichia coli, Candida albicans, with the plasmid (1 × 10 containing target gene4Copies/ μ l) it is positive control, it is handed over
The detection of reaction is pitched, as the result is shown in addition to the plasmid containing chlamydia pneumoniae target gene is positive findings (curve of such as Fig. 3),
Other sample results are feminine gender, it was demonstrated that other pathogens no cross reaction in this kit and the present embodiment.
2 cross reaction sample list of table
Embodiment 5: sensitivity, the specificity detection of clinical sample
The present embodiment has carried out small sample detection.Sample is Shanghai hospital respiratory pathogens sample nucleic acid, wherein having 17
Example detection is determined as chlamydia pneumoniae positive sample, in addition there is 9 tuberculosis positive samples, 5 syncytial virus type A positive samples,
14 negative samples, totally 45.Benefit chlamydia pneumoniae quick detection kit prepared with embodiment 3, carries out augmentation detection.Step
It is rapid as follows:
The first step takes 10 μ l to redissolve liquid and 10 μ l sample nucleic acids, is added in the EMA reaction tube containing primed probe, sufficiently
It mixes, the another setting positive and negative control；
The EMA reaction tube of redissolution is put into Click i nucleic acid fluorescent detector by second step, and 42 DEG C expand 30 minutes；
Third step, result Quality Control: positive quality control product Ct value < 20, fluorescence curve are typical " S " type, and negative quality-control product is without Ct
Value, conditions above are all satisfied, this experiment effectively, otherwise in vain, needs to check reason and retests；
Step 4: result judges: if scan sample fluorescence curve is typical " S " type, and Ct value < 30, being then judged as positive
Property result；Conversely, scanning fluorescence curve is horizontal linear, no Ct value is then negative findings.
Testing result is shown in Table 3, table 4.Table 3 is sample nucleic acid hospital calibration result and testing result of the present invention.The results show that
Sensitivity of the invention is 100%, and specificity is 100%.
3 sample Ct value result of table
Note: project is not surveyed in "/" expression；"-" indicates negative findings.
4 clinical sample testing result of table
For the present invention using the MOMP sequence of chlamydia pneumoniae as purpose gene, the gene is highly conserved and has kind special
Property.For MOMP sequence, best primer and probe are designed and screened, cooperates general EMA enzyme, forms optimal experiment reactant
System, make kit of the present invention have the characteristics that the advantage in detectability and, not only detect simple and easy, but also standard with higher
Exactness, precision, specificity and repeatability.Operation of the present invention is simple, the time is short, instrument requirements are low, is highly suitable for
The early stage of chlamydia pneumoniae quick auxiliary diagnosis.
What has been described above is only a preferred embodiment of the present invention, it is noted that for those of ordinary skill in the art
For, without departing from the concept of the premise of the invention, various modifications and improvements can be made, these belong to the present invention
Protection scope.
Sequence table
<110>Suzhou Dian Jing Biotechnology Co., Ltd
<120>the quick detection primer group of chlamydia pneumoniae
<130> 0
<141> 2019-03-01
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> misc_feature
<222> (1)..(27)
<400> 1
actctacagc gttcaatctc gttggtt 27
<210> 2
<211> 29
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> misc_feature
<222> (1)..(29)
<400> 2
cctttatagc ccttgggttt gtttacaga 29
<210> 3
<211> 35
<212> DNA
<213> Chlamydia pneumoniae
<220>
<221> misc_feature
<222> (1)..(35)
<400> 3
aagttcttca actttaggtt tggacgcata ttgga 35
Claims (10)
1. a kind of quick detection primer group of chlamydia pneumoniae, which is characterized in that the quick detection primer group packet of chlamydia pneumoniae
The upstream and downstream primer and probe of the chlamydia pneumoniae gene group MOMP gene conserved sequence containing detection；The upstream primer is: 5 '-
ACTCTACAGCGTTCAATCTCGTTGGTT-3'；The downstream primer is: 5 '-
CCTTTATAGCCCTTGGGTTTGTTTACAGA-3'；The probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-
FAMdT//idSp//iBHQ1dT/GCATATTGGA-3’C3 Spacer。
2. the quick detection primer group of chlamydia pneumoniae as described in claim 1, which is characterized in that the upstream primer can be
5 ', 3 ' ends of upstream primer sequence described in claim 1 extend or shorten 10bp, and the downstream primer can be claim 1
5 ', 3 ' ends of the downstream primer sequence extend or shorten 10bp, and the probe can be probe sequence described in claim 1
5 ', 3 ' ends extend or shorten 10bp；Alternatively, the upstream and downstream primer and probe can be respectively with it is upper described in claim 1,
The sequence homology of downstream primer and probe is greater than 85% sequence；Alternatively, the upstream and downstream primer and probe can be difference
With the sequence of the series reverse complemental of upstream and downstream primer and probe described in claim 1；Alternatively, the 6- of the probe
FAM, missing or BHQ1 label are in 21-32 of sequence；Alternatively, the 6-FAM of the probe, missing or BHQ1 label are in
21-32 of reverse complementary sequence.
3. the quick detection primer group of chlamydia pneumoniae as described in claim 1, which is characterized in that the probe length has
35bp, fluorescence, base deletion and be quenched modification it is adjacent, and be in sequence middle and lower reaches 26-28.
4. it is quick that the quick detection primer group of chlamydia pneumoniae as claimed in claim 1,2 or 3 is applied to preparation chlamydia pneumoniae
Detection kit.
5. a kind of chlamydia pneumoniae quick detection kit, which is characterized in that the kit includes the following contents:
(1) lysate；
(2) liquid is redissolved；
(3) the EMA reaction tube containing primed probe；The EMA reaction tube includes upstream and downstream primer and probe, the upstream primer
It is: 5 '-ACTCTACAGCGTTCAATCTCGTTGGTT-3 '；The downstream primer is: 5 '-
CCTTTATAGCCCTTGGGTTTGTTTACAGA-3'；The probe is 5 '-AAGTTCTTCAACTTTAGGTTTGGAC/i6-
FAMdT//idSp//iBHQ1dT/GCATATTGGA-3'C3 Spacer；
(4) positive quality control product；
(5) negative quality-control product.
6. chlamydia pneumoniae quick detection kit as claimed in claim 5, which is characterized in that the lysate contains dense eventually
Degree is the Tris-Ac and ultrapure water of the pH8.0 of chelex-100,1-20mM of NP-40,1-100mg/mL of 1-10%.
7. chlamydia pneumoniae quick detection kit as claimed in claim 5, which is characterized in that the redissolution liquid contains dense eventually
The PEG20000 and surpass that degree is KAc, 5-15% of Tris-Ac, 55-70mM of the pH8.0 of MgAc2,80-100mM of 10-50mM
Pure water.
8. chlamydia pneumoniae quick detection kit as claimed in claim 5, which is characterized in that described containing primed probe
The ingredient of EMA reaction tube is as follows: containing single-stranded DNA binding protein, the 16- of final concentration of 6-60ng/ μ l in each reaction tube
The ATP regenerated protein of 160pg/ μ l, the DNA helicase of 1-10ng/ μ l, the archaeal dna polymerase of 1-5ng/ μ l, 5-150pg/ μ l
DNA restriction enzyme, the auxilin of 200-500pg/ μ l, the upstream primer of 200-500nM, the downstream of 200-500nM are drawn
Object, the probe of 1-50nM, the Creatine Phosphate Sodium of 1-50mM, 1-10mM ATP, 50-150 μM dNTP, 50-100mM Tris-
Ac, the trehalose of 5-50 μ g/ μ l, the KAc of 100-500mM, the mannitol of 1-10ng/ μ l, 1-10% PEG20000.
9. chlamydia pneumoniae quick detection kit as claimed in claim 5, which is characterized in that the feminine gender quality-control product is super
Pure water blank control, the positive quality control product are the plasmids containing aim sequence, and concentration is 1*104copies/μl。
10. a kind of detection method of chlamydia pneumoniae, which is characterized in that the detection method is using lung described in claim 5
Scorching Chlamydia quick detection kit, the detection method is not for the purpose of the diagnosing and treating of disease, the detection method packet
Include following steps:
(1) using detection kit described in claim 5, target sample swab is put into 500 μ l lysates and is cut, whirlpool
Rotation oscillation 30 seconds, is centrifuged 1 minute, takes 100 μ l supernatants to be transferred in new 1.5mL centrifuge tube, metal bath 90 by 5000 revs/min
DEG C heating cracking 10 minutes, be subsequently cooled to room temperature, supernatant taken to be detected；
(2) it using detection kit described in claim 5, takes 10 μ l to redissolve liquid and 10 μ l samples cracking gained supernatant, is added
It into the EMA reaction tube containing primed probe, mixes well, the another setting positive and negative control；
(3) the EMA reaction tube of redissolution is put into Click i nucleic acid fluorescent detector, 37-45 DEG C amplification 10-30 minutes, every 30
Second scanning fluorescence is primary, acquires fluorescence data, when drafting m- fluorescence signal figure；
(4) result Quality Control: positive quality control product Ct value < 20, fluorescence curve are typical " S " type, and negative quality-control product is above without Ct value
Condition is all satisfied, this experiment effectively, otherwise in vain, needs to check reason and retests；
(5) result judges: if scan sample fluorescence curve is typical " S " type, and Ct value < 30, being then judged as positive findings；
Conversely, scanning fluorescence curve is horizontal linear, no Ct value is then negative findings.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910158453.XA CN109735641A (en) | 2019-03-01 | 2019-03-01 | A kind of quick detection primer group of chlamydia pneumoniae, kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910158453.XA CN109735641A (en) | 2019-03-01 | 2019-03-01 | A kind of quick detection primer group of chlamydia pneumoniae, kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109735641A true CN109735641A (en) | 2019-05-10 |
Family
ID=66369128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910158453.XA Pending CN109735641A (en) | 2019-03-01 | 2019-03-01 | A kind of quick detection primer group of chlamydia pneumoniae, kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109735641A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112442543A (en) * | 2019-08-27 | 2021-03-05 | 孙余华 | Method for detecting stability of arterial plaque |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773884A (en) * | 2014-02-12 | 2014-05-07 | 深圳康美生物科技股份有限公司 | Primer group and probe for detecting chlamydia pneumoniae 98KDa MOMP genes and application thereof |
| CN107916304A (en) * | 2017-12-29 | 2018-04-17 | 苏州点晶生物科技有限公司 | Canine distemper virus fluorescence EMA detection primers group, kit and detection method |
-
2019
- 2019-03-01 CN CN201910158453.XA patent/CN109735641A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773884A (en) * | 2014-02-12 | 2014-05-07 | 深圳康美生物科技股份有限公司 | Primer group and probe for detecting chlamydia pneumoniae 98KDa MOMP genes and application thereof |
| CN107916304A (en) * | 2017-12-29 | 2018-04-17 | 苏州点晶生物科技有限公司 | Canine distemper virus fluorescence EMA detection primers group, kit and detection method |
Non-Patent Citations (3)
| Title |
|---|
| 彭瑞云等: "《现代实验病理技术》", 31 August 2012, 军事医学科学出版社 * |
| 王菲等: "肺炎衣原体及肺炎支原体临床血清学检测试剂的研发及应用", 《标记免疫分析与临床》 * |
| 罗焰芳等: "实时荧光定量PCR技术检测肺炎衣原体的诊断价值", 《中国临床新医学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112442543A (en) * | 2019-08-27 | 2021-03-05 | 孙余华 | Method for detecting stability of arterial plaque |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107365876B (en) | Kit for detecting 10 respiratory tract infection pathogens and using method thereof | |
| EP3882364B1 (en) | Dual detection kit for 2019 novel corona virus | |
| CN107937613B (en) | Real-time fluorescent multiplex PCR primer probe and kit for seven influenza virus pathogens common to respiratory system | |
| CN108300808A (en) | A kind of African hog cholera virus fluorescent PCR detection kit, preparation method and application method | |
| CN111378784A (en) | Novel coronavirus SARS-CoV-2 nucleic acid visual detection kit | |
| US20230070496A1 (en) | Nucleic Acid Detection Kit For Novel Coronavirus 2019-nCoV | |
| Giammarioli et al. | Development of a novel hot-start multiplex PCR for simultaneous detection of classical swine fever virus, African swine fever virus, porcine circovirus type 2, porcine reproductive and respiratory syndrome virus and porcine parvovirus | |
| WO2022089550A1 (en) | Novel compositions and methods for coronavirus detection | |
| CN113005226A (en) | Oligonucleotide and kit for detecting SARS-CoV-2 | |
| CN110055353B (en) | Internal reference-containing double isothermal nucleic acid amplification method for rapidly detecting 7-type adenovirus | |
| CN109762942B (en) | Internal reference-containing double isothermal nucleic acid amplification method for rapidly detecting respiratory syncytial virus | |
| CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN101812539B (en) | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof | |
| CN110373485A (en) | A kind of ureaplasma urealyticum, three joint inspection kit of chlamydia trachomatis and gonococcus | |
| Zhang et al. | Direct detection of Staphylococcus aureus in positive blood cultures through molecular beacon-based fluorescence in situ hybridization | |
| US20180127836A1 (en) | Improved compositions and methods for detection of viruses | |
| Zheng et al. | A TaqMan-MGB real-time RT-PCR assay with an internal amplification control for rapid detection of Muscovy duck reovirus | |
| CN109735641A (en) | A kind of quick detection primer group of chlamydia pneumoniae, kit | |
| Wang et al. | Establishment and application of a quadruple real-time RT-PCR for detecting avian metapneumovirus | |
| CN113046452B (en) | Composition for detecting Boeck hollandia farci and application thereof | |
| CN109735640A (en) | The quick detection primer group of mycoplasma pneumoniae, kit | |
| CN111961763A (en) | Novel gene chip for detecting coronavirus | |
| CN105936945B (en) | A kind of multiple reverse transcription quantitative PCR kit of four kinds of Respirovirus of joint inspection | |
| CN113512598B (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for bordetella pertussis and special primer and probe thereof | |
| EP1666608A1 (en) | Method for detecting and distinguishing infectious bursal disease virus (IBDV) strains by fluorescence-based real time RT-PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20211115 Address after: 215000 units 201 and 204, building A6, phase I, biomedical industrial park, 218 Xinghu street, Suzhou Industrial Park, Jiangsu Province Applicant after: Suzhou Jingrui Biotechnology Co.,Ltd. Address before: 215123 units 201 and 204, building A6, biological nano Park, 218 Xinghu street, industrial park, Suzhou, Jiangsu Applicant before: SUZHOU CLICKGENE BIOTECH Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190510 |