CN109706138A - A kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and its gene order - Google Patents

Abstract

The invention discloses a kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and its gene orders, full length gene 1665bp, encode 554 amino acid, zymoprotein molecular size range is 64.13KDa, using pRS426-URA Yeast protein expression plasmid as carrier, it is host with Saccharomyces Cerevisiae in S accharomyces cerevisiae WQ011, realize the heterogenous expression of Celastrus angulatus sesquiterpene synthase CaTPS2, recombinant bacterium WQ011/pRS426-URA-CaTPS2 can generate α-eucalyptol (α-Eudesmol) and Selina-3,7 two kinds of (11)-diene sesquiterpenoids simultaneously.50mL shaking flask yield is γ-eucalyptol 0.15mg/L and sagittol 0.06mg/L.The acquisition of the gene has far-reaching significance the research of Celastrus angulatus sesquiterpenoid.

Description

A kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and its gene order

Technical field

The invention belongs to enzyme gene engineering and enzyme engineering fields, and in particular to one kind derives from Celastrus angulatus (Celastrus Angulatus sesquiterpene synthase CaTPS2 and gene order CaTPS-24009).

Background technique

Terpenoid is chemical structure and conformation natural products the most complicated, and presently found terpenoid has 80000 kinds or so, the one third of natural products is occupied, is distributed widely in plant and microorganism.The biology of terpenoid The most basic structural unit that synthesis needs is dimethylallylpyrophosphate Dimethylallyl diphosphate, DMAPP With isopentenyl pyrophosphate Isopentenyl diphosphate, IPP from mevalonate pathway and deoxy-D-xylulose sugar phosphoric acid Ester approach.DMAPP and IPP the head and the tail polymerization of different number form monoterpene (C using the catalysis of special diterpene synthase₁₀) sequiterpene (C₁₅) and diterpene (C₂₀) etc. natural products.Sesquiterpenoids is one kind of structure and most species in terpenoid, It is widely used in bio-pharmaceuticals, natural green agricultural insecticide and fungicide, fuel substitute and food grade spice and seasoning The exploitation of the industries such as agent uses.

The sesquiterpenoids such as α-eucalyptol (α-Eudesmol) and Selina-3,7 (11)-diene have significant Bioactivity.If α-eucalyptol can block calcium channel, inhibit the nerve of overacfivity, after brain being helped to be wound Adjuvant treatment；Selina-3,7 (11)-diene has effects that clearing heat and detoxicating, smooth throat to stop cough.

Celastrus angulatus (Celastrus angulatus) belongs to Celastraceae (Celastraceae) Celastrus (Celastrus) Perennial liana is distributed widely in the hills and mountain area of China the Yellow River, the Yangtze river basin.Insecticidal activity (the food refusal of Celastrus angulatus Activity, narcotic activity, cytotoxicity) ingredient is mainly distributed in root skin.Research has shown that active insecticidal components master contained therein If with β-dihydroagarofuran polyol ester sesquiterpenoids and its alkaloid, the difference of substituent group decides compound Activity it is different.At present research be concentrated mainly on to the effective component Celastrus angulatus in Celastrus angulatus carry out separation with Structural Identification and Action mechanism research, not to the pertinent literature of sesquiterpene synthase in Celastrus angulatus biosynthesis.Therefore bitter skin is studied The function and its sequence signature of rattan sesquiterpene synthase are of great significance to the distribution of terpenoid.

Summary of the invention

It is an object of the invention to make up the deficiencies in the prior art, provide a kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and Its gene order additionally provides the plasmid comprising gene of the present invention and the host cell comprising the expression plasmid, and utilizes host Cell (recombinant bacterium) inducing expression sesquiterpene synthase CaTPS2 generates sesquiterpenoids.

The technical scheme is that

A kind of Celastrus angulatus sesquiterpene synthase is denoted as CaTPS2, and amino acid sequence is as shown in SEQ ID NO.1.

The gene for encoding above-mentioned Celastrus angulatus sesquiterpene synthase CaTPS2, is denoted as CaTPS-24009, nucleotide sequence is such as Shown in SEQ ID NO.2.

A kind of recombinant plasmid, is denoted as pRS426-URA-CaTPS2, contains coding Celastrus angulatus sesquiterpene synthase CaTPS2's Gene, galactose-inducible promoter PGal1,10, uracil auxotrophy screens label.

A kind of recombinant bacterium, is denoted as WQ011/pRS426-URA-CaTPS2, contains above-mentioned recombinant plasmid.

The beneficial effects of the present invention are: the invention discloses a kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and its gene sequences Column, full length gene 1665bp encode 554 amino acid, and zymoprotein molecular size range is 64.13KDa, with pRS426-URA ferment Female protein expressing plasmid is carrier, is host with Saccharomyces Cerevisiae in S accharomyces cerevisiae WQ011, realizes hardship The heterogenous expression of skin rattan sesquiterpene synthase CaTPS2, recombinant bacterium WQ011/pRS426-URA-CaTPS2 can generate α-simultaneously Two kinds of sesquiterpenoids of eucalyptol (α-Eudesmol) and Selina-3,7 (11)-diene.50mL shaking flask yield is γ-eucalyptol 0.15mg/L and sagittol 0.06mg/L, production and utilization to sequiterpene are of great significance, while the acquisition of the gene Forming Mechanism and biotic mechanism study to Celastrus angulatus sesquiterpenoid lay the foundation.

Detailed description of the invention

Fig. 1 is WQ011/pRS426-URA-CaTPS2 restructuring yeast strains validating DNA Ago-Gel map (purpose item Band size is 1665bp)；

M: stranded DNA molecule ruler；Swimming lane 1 is CaTPS-24009 gene DNA sample；

Fig. 2 is external standard method standard curve；

Fig. 3 is WQ011/pRS426-URA-CaTPS2 restructuring yeast strains product GC-MS map；

A is the GC map of tunning；B is that the mass spectrogram at the peak retention time 11.82min and NIST14 compose α-folium eucalypti in library Alcohol mass spectrogram compares；C is that the mass spectrogram at the peak retention time 12.43min and NIST14 compose Selina-3,7 (11)-diene in library Mass spectrogram compares.

Specific embodiment

The present invention is described in further detail with reference to the accompanying drawings and examples.

Sesquiterpene synthase gene source of the present invention is collected in Shaanxi on May 11st, 2017 in Celastrus angulatus plant, plant Save Yangling Area northwest agricultural design of university museum park.

It selects the Celastrus angulatus plant of fresh acquisition to carry out RNA extraction, and its cDNA sequence, structure is obtained by reverse transcription PCR Build cDNA library.Be sequenced using PacBio ISO-Seq platform, by Interpro (http: // Www.ebi.ac.uk/interpro BLAST is carried out in) compares acquisition with PF_03936Terpene synthase family The target gene of structural domain.Using cDNA sequence as template, design primer expands CaTPS-24009 gene order, and passes through digestion It is connected to acquisition pRS426-URA-CaTPS2 yeast host expression plasmid on WQ011/pRS426-URA-CaTPS2 plasmid.Using Lithium acetate yeast chemical transformation passes through recombinant plasmid pRS426-URA-CaTPS2 conversion such as Saccharomyces cerevisiae host WQ011 URA deficiency screening flat board, screening obtain WQ011/pRS426-URA-CaTPS2 restructuring yeast strains, realize times of Celastrus angulatus The high efficient expression of hemiterpene synzyme CaTPS2.

WQ011/pRS426-URA-CaTPS2 bacterial strain Celastrus angulatus sesquiterpene synthase gene C aTPS- described in embodiment 1. 24009 clone and expression

Celastrus angulatus total serum IgE is extracted using RNAprep pure Plant Kit.Using Clontech SMARTer PCR CDNA Synthesis Kit the first chain of synthesis cDNA, the first chain cDNA synthesize the second chain cDNA by PCR amplification, then double-strand DNA builds library after secondary PCR expands, for SMRTbell, and is sequenced using PacBio ISO-Seq platform.

According to the CaTPS-24009 gene order SEQ ID NO.2 that sequencing obtains, design primer amplifying target genes draw Object sequence is as follows:

Primer CaTPS-24009-F:5'CGCGGATCCATGGCAGCAACCAACCAATC 3'(SEQ ID NO.3)

Primer CaTPS-24009-R:5'CCGCTCGAGTTAATTATCTTGGATTGGTATTTGT3'(SEQ ID NO.4)

The cDNA sequence obtained using reverse transcription is template, using above-mentioned primer, PCR amplification CaTPS-24009 gene order. Reaction system is 50ul, including ddH₂O 18ul, dNTP mixture 1ul, CaTPS-24009-F primer 1ul, CaTPS- 24009-R primer 1ul, DNA profiling 1ul, 2 × Phanta Max 25ul, Fidelity DNA polymerase 1ul.Amplification Process are as follows: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 35 recycle；72 DEG C of ends Extend 5min.

PCR product through 1.5% Ago-Gel test strip size, with Universal DNA Purification Kit recycles target fragment.

The DNA fragmentation and pRS426-URA plasmid purified with BamHI and XhoI digestion, the product after digestion pass through Universal DNA Purification Kit recycles to obtain endonuclease bamhi, is connected by T4DNA ligase ligase It connects, obtains recombinant plasmid.Digestion system are as follows: 1.5 μ L of BamHI1.5 μ L, XhoI, 42 μ L, cut smart of DNA fragmentation or plasmid buffer 5μL.37 DEG C of water-bath 2h.Linked system are as follows: 7 μ L of purpose digestion genetic fragment and 1 μ L, T4 ligase of digested plasmid, 1 μ L, 10 × T4ligase buffer1 μ L.16 DEG C of connections overnight.

Using lithium acetate transformation method, yeast conversion is carried out, operating procedure is as follows:

(1) Wine brewing yeast strain WQ011 scribing line YPD plate, 30 DEG C of cultures, until growing single colonie about 1-3mm.It is flat from YPD One ring saccharomycete of plate picking is inoculated in containing in 5mL YPD fluid nutrient medium, 180r/min, and 30 DEG C, 14~16h of shaking table culture.

(2) according to 1% inoculum concentration, bacterium solution is accessed in 50mL YEPD fluid nutrient medium, 180r/min, 30 DEG C of cultures are extremely OD₆₀₀=0.5 (about 3-5h).

(3) 5000r/min, 4 DEG C of refrigerated centrifuge 6min collect thallus.

(4) 25mL aseptic deionized water suspension thalline, 5000r/min, 4 DEG C of refrigerated centrifuge 6min is added.

(5) it is primary to repeat previous action.

(6) thallus is resuspended with the LiAc buffer that 1mL concentration is 0.1mol/L, stands 5min.5000r/min, 4 DEG C of freezings After being centrifuged 5min, discard supernatant.

(7) thallus is resuspended with the LiAc buffer of 500 μ L 0.1mol/L, every 100 μ L is dispensed into a centrifuge tube, is made At competent yeast cells.

(8) ssDNA is cooling rapidly on ice after boiling 12min.

(9) in the competent yeast cells dispensed, the carrier or linear DNA of 100-500ng is added.Rotation adds later Enter in following mixture.The ingredient of transformation mixture is as follows: 1) PEG-4000 50% (w/v), 620 μ l；2)LiAc1.0mol/ L, 90 μ l；3) SS-DNA (10mg/ml), 40 μ l.

30min is incubated in (10) 30 DEG C of incubators.

(12) 42 DEG C of water-bath heat shock 20min.

(15) 6000r/min is centrifuged 1min, discards part supernatant, and thallus is resuspended, takes 100 μ L coated plates, 30 DEG C of culture 2-3 It, grows transformant.

(16) a little single colonie of picking, the 20mM NaOH solution that 50 μ l degermings are added mix.

(17) it is placed in PCR instrument, according to program: 99 DEG C, 5min；4 DEG C, 1min is recycled 3 times.

(18) bacterium solution is taken out, 8000r/min is centrifuged 5 minutes, takes supernatant as pcr template.

(19) reaction system is 10ul, including CaTPS-24009-F primer 1ul, CaTPS-24009-R primer 1ul, DNA Template 3ul, 2 × Taq Master Mix 5ul.Amplification procedure are as follows: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 72 DEG C of extension 1.5min, 35 circulations；72 DEG C extend 5min eventually.

(20) whether PCR product is correct through 1.5% Ago-Gel test strip size.

The result shows that (as shown in Figure 1): the transformant selected has single band between 1200bp and 2000bp, it was demonstrated that turns Beggar is positive clone molecule.

2. induction fermentation of embodiment

(1) transformant WQ011/pRS426-URA-CaTPS2 is forwarded to 50mL synthetic media (without URA) In, 180r/min, 30 DEG C, shaking table culture 30h.

(2) final concentration 10g/L galactolipin inducing expression is added in 30h to 90-120h, is added in 36h and 72h dense eventually 10g/L ethyl alcohol is spent as supplementary carbon source.

(3) fermentation liquid carries out GC-MS detection using 3mL n-hexane extraction tunning 15min.

Embodiment 3.GC-MS detects tunning

(1) GC-MS detection method

Chromatographic column: TG-5MS；Ion source；EI, 70eV；Sample volume: 1uL；Injector temperature: 200 DEG C；Detector temperature: 280 ℃；Column temperature: 240 DEG C；Temperature programming: 70 DEG C of initial temperature, 10 DEG C/min is warming up to 280 DEG C, maintains 5min.

(2) yield is calculated using external standard method.It is accurate respectively to prepare 0.02,0.04,0.06,0.08 and 1.0mg/L standard items, Using peak area as ordinate, concentration is that abscissa draws standard curve (as shown in Figure 2).

The result shows that: the target peak in GC-MS spectrogram, by being sent out compared with the reference mass spectrometric data in NIST14 database Existing, chromatographic peak of the WQ011/pRS426-URA-CaTPS2 bacterial strain fermentation liquor N-hexane extract in retention time 11.82min is α-eucalyptol (α-Eudesmol), 50mL shaking flask yield are 0.15mg/L (as shown in Fig. 3 A, 3B).In retention time 12.43min Chromatographic peak be Selina-3,7 (11)-diene, 50mL shaking flask yield be 0.06mg/L (as shown in Fig. 3 A, 3C).

It is all using made by description of the invention and accompanying drawing content the foregoing is merely the preferred embodiment of the present invention Several improvement or deformation, being applied directly or indirectly in other relevant technical fields, also should be regarded as protects in patent of the invention It protects in range.

<110>University Of Tianjin

<120>a kind of Celastrus angulatus sesquiterpene synthase CaTPS2 and its gene order

<130>

<160> 4

<170>

<210> 1

<211> 554

<212> PRT

<213>Celastrus angulatus

<400> 1

Met Ala Ala Thr Asn Gln Ser Ala Glu Val Ser Arg Arg Leu Ala Asn

5 10 15

Phe Ala Pro Ala Ile Trp Gly His Asp Asp Phe Ala Ser Phe Thr Ser

20 25 30

Asp Gln Asp Ser Val Tyr Gly Leu Tyr Thr Lys Arg Val Glu Glu Leu

35 40 45

Lys Val Gln Val Arg Asp Leu Leu Leu Ser Thr Asn Asp Ile Val Glu

50 55 60

Lys Val Glu Leu Ile Asp Leu Leu Gly Arg Leu Gly Ile Ser Tyr His

65 70 75 80

Phe Glu Ser Glu Ile Glu Asn Gln Leu Met Gln Asn Leu Asn Ile Ile

85 90 95

Lys Thr Lys Leu Ile Asp Asp Asn Asp Tyr Ser Leu Tyr Ala Val Ala

100 105 110

Leu Leu Phe Arg Val Phe Arg Gln Tyr Gly Tyr Lys Ile Ser Cys Asp

115 120 125

Val Phe Glu Lys Phe Glu Gly Asp Asp Gly Lys Phe Lys Met Ser Leu

130 135 140

Ala Ser Asp Val Glu Gly Met Leu Ser Leu Tyr Glu Ala Ser His Leu

145 150 155 160

Ser Met His Gly Glu Asp Val Leu Asp Glu Ala Leu Val Phe Ser Lys

165 170 175

Thr Ser Leu His Ser Met Val Thr Gln Leu Asn Pro His Phe Ala Asn

180 185 190

Gln Val Thr His Ala Leu Gln Gln Pro Tyr His Lys Gly Ile Pro Arg

195 200 205

Ile Glu Ser Arg Lys Tyr Ile Asn Phe Tyr Glu Glu Asp Glu Ser Arg

210 215 220

Asn Glu Ile Met Leu Lys Leu Ala Lys Ile Asp Phe Asn Arg Val Gln

225 230 235 240

Leu Leu His Gln Gln Glu Leu Ser His Val Ser Arg Trp Tyr Lys Asp

245 250 255

Leu Gln Ile Ala Ser Lys Phe Pro Tyr Ala Arg Asp Arg Ile Ala Glu

260 265 270

Ile Tyr Met Trp Thr Val Gly Ser Asn Phe Glu Pro His Tyr Gly Arg

275 280 285

Thr Arg Ile Phe Leu Thr Lys Ser Val Thr Met Ile Ser Ile Leu Asp

290 295 300

Asp Thr Tyr Asp Ala Tyr Gly Thr Ile Glu Glu Leu Arg Leu Leu Thr

305 310 315 320

Asp Ala Val Glu Arg Trp Asp Val Gly Ala Ile Asp Glu Leu Pro Asp

325 330 335

Tyr Met Lys Val Leu Tyr Lys Met Ile Ile Asn Leu Tyr Asp Glu Phe

340 345 350

Glu Asn Glu Leu Lys Asn Glu Gly Arg Ser Ser Cys Val Ala Tyr Ala

355 360 365

Arg Asp Ala Leu Arg Glu Met Val Lys Ala Tyr His Val Glu Ala Glu

370 375 380

Trp Cys Asn Lys Gly Tyr Ile Pro Thr Phe Asp Glu Tyr Met Glu Asn

385 390 395 400

Ala Leu Ile Thr Ser Cys Tyr His Ala Ile Pro Ala Ala Cys Phe Leu

405 410 415

Gly Met Gly Glu Ile Ala Gly Thr Lys Glu Phe Glu Trp Leu Lys Ser

420 425 430

Ile Pro Lys Ile Ile Arg Ala Ser Glu Met Ile Gly Arg Leu Met Asp

435 440 445

Asp Ile Met Ser His Lys Glu Glu Gln Glu Arg Gly His Val Ala Ser

450 455 460

Ser Ile Glu Cys Phe Met Lys Gln Tyr Gly Val Ser Ser Glu Glu Glu

465 470 475 480

Val Val Gln Asp Phe Gln Ile Arg Ile Ala Asn Ala Trp Lys Asp Ile

485 490 495

Asn Glu Glu Cys Val Arg Pro Thr Ala Val Ser Leu His Leu Leu Met

500 505 510

Pro Ile Leu Asn Leu Thr Arg Ile Ile Asp Val Val Tyr Lys Asn Glu

515 520 525

Asp Gly Tyr Ser Asn Pro Val Asn Leu Lys Glu His Val Lys Ala Leu

530 535 540

Phe Ile Gln Gln Ile Pro Ile Gln Asp Asn

545 550 554

<210> 2

<211> 1665

<212> DNA

<213>Celastrus angulatus

<400> 2

atggcagcaa ccaaccaatc cgcggaggtt tcacggcggc tggccaactt cgcccccgcc 60

atttggggtc acgatgactt tgcttctttt acttctgatc aagactcggt gtatggattg 120

tatacaaaga gagtggagga gctgaaagta caagtgagag atttgttgct gtctacaaat 180

gacattgtgg agaaagtcga gttgatcgac ttgttgggtc gtcttggtat ttcatatcac 240

tttgaaagtg agattgaaaa ccagcttatg cagaatctca acataatcaa aactaaactc 300

atcgatgata atgactacag tttatacgct gtagcacttc tattccgcgt tttcagacaa 360

tatggttata aaatatcttg tgacgtgttt gagaagtttg agggagatga tggaaagttt 420

aaaatgagtc tagctagtga tgtggagggg atgctaagct tgtatgaagc ttctcacttg 480

agcatgcatg gagaggatgt tttggatgaa gcactagtgt tttcaaaaac ttctcttcat 540

tccatggtga cccaattgaa cccacacttt gcaaaccaag ttactcatgc actgcaacag 600

ccttatcaca agggcatacc aagaatagag tcgagaaaat acatcaattt ctacgaagaa 660

gatgagtctc gaaatgaaat tatgctcaaa ttagcgaaaa ttgattttaa tcgagtacaa 720

ttgttgcacc aacaagagct aagtcatgtt tcaaggtggt acaaagactt gcagattgct 780

tcaaaatttc cttatgcaag agatagaatt gctgaaatct acatgtggac tgttgggtct 840

aattttgaac cacattatgg acgtacccgc atttttctta ctaaaagtgt gacaatgata 900

tcaattttag atgacacata tgatgcatac ggtacaattg aagaactccg actcttgacc 960

gatgcagttg aaaggtggga cgttggtgcc attgatgaac taccagatta catgaaagtt 1020

ctttacaaga tgattataaa tctctacgat gaattcgaga acgaattgaa aaatgaagga 1080

agatcttctt gtgtcgctta tgctagagac gcgctaagag aaatggtgaa agcctaccac 1140

gttgaagcag agtggtgcaa caaaggttac ataccaacat ttgatgagta catggagaat 1200

gcattgatca caagctgtta tcatgcaatt ccagctgcat gttttctagg catgggagaa 1260

attgcaggaa caaaagaatt tgaatggctc aaaagcatcc caaaaattat tagagcttct 1320

gagatgatcg gtcgtcttat ggacgacata atgtcacata aggaggagca agagaggggg 1380

catgtcgcgt caagtattga gtgctttatg aagcaatatg gtgtgtcgag tgaggaagag 1440

gtggttcaag attttcaaat taggattgcg aatgcttgga aggatattaa tgaagaatgt 1500

gtgagaccaa ctgctgtgtc tcttcatctt ctgatgccaa ttttgaacct aacacgcatc 1560

atagatgttg tctacaagaa tgaagatggg tattcaaatc cagtgaattt gaaggagcat 1620

gtcaaggctt tgttcattca acaaatacca atccaagata attaa 1665

<210> 3

<211> 29

<212> DNA

<213>artificial sequence

<400> 3

cgcggatcca tggcagcaac caaccaatc 29

<210> 4

<211> 34

<212> DNA

<213>artificial sequence

<400> 4

ccgctcgagt taattatctt ggattggtat ttgt 34

Claims (4)

1. a kind of Celastrus angulatus sesquiterpene synthase, is denoted as CaTPS2, which is characterized in that its amino acid sequence such as SEQ ID NO.1 It is shown.

2. encoding the gene of Celastrus angulatus sesquiterpene synthase CaTPS2 described in claim 1, it is denoted as CaTPS-24009, feature It is, nucleotide sequence is as shown in SEQ ID NO.2.

3. a kind of recombinant plasmid, is denoted as pRS426-URA-CaTPS2, which is characterized in that containing gene described in claim 2, partly Lactose inducible promoter PGal1,10, uracil auxotrophy screens label.

4. a kind of recombinant bacterium, is denoted as WQ011/pRS426-URA-CaTPS2, which is characterized in that contain recombination described in claim 3 Plasmid.