WO2018111194A1 - Targets for improving terpene production in rhodosporidium toruloides - Google Patents

Abstract

The present invention relates to the field of fungal production of a terpene or its derivatives. More specifically, the present invention relates to the production of a terpene or its derivatives in Rhodosporidium genus or Rhodotorula genus through the overexpression of a heterologous terpene synthase and the alteration of mRNA expression of one or more genes.

Description

TARGETS FOR IMPROVING TERPENE

PRODUCTION IN RHODOSPORIDIUM TORULOIDES

SEQUENCE LISTING

[0001] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 2577255PCTSequenceListing.txt, created on 14 December 2017 and is 256 kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] The present invention relates to the field of fungal production of a terpene or its derivatives. More specifically, the present invention relates to the production of a terpene or its derivatives in Rhodosporidium genus or Rhodotorula genus through the overexpression of a heterologous terpene synthase and the alteration of mRNA expression of one or more genes.

[0003] The publications and other materials used herein to illuminate the background of the invention or provide additional details respecting the practice, are incorporated by reference, and for convenience are respectively grouped in the Bibliography.

[0004] Terpenes are synthetized from the common C5 precursors, isopentenyl pyrophosphate ( PP) and its isomer dimethylallyl pyrophosphate (DMPP). Terpenoids, such as anti-malaria drug artemisinic acid, are made by hydroxylation and oxidation of terpenes [1-5]. Over the past decade, synthetic biology has made tremendous progress in the production of terpenes, particularly sesquiterpene, in Escherichia coli and Saccharomyces cerevisiae [1, 6-8]. Although S. cerevisiae has fully functional mevalonate biosynthetic pathway (MVP) while E. coli has 1- deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol 4-phosphate (DOXP/MEP) biosynthetic pathway for sterol and terpenoids biosynthesis, both are not robust enough for economical production without complex pathway re-engineering, i.e., synthetc biology approach [9-11]. In S. cerevisiae and animals, HMG-CoA reductase (HMGR) is a major rate-limiting factor in the mevalonate pathway and its expression is tightly controlled, at transcriptional and post- translational levels [12-14]. In yeast, overexpression of cytosolic HMGR leads to extracellular squalene accumulation and development of abnormal cell structure known as "karmellae", a type of nuclear-associated paired membranes [13, 15]. Both FPP precursor and terpene synthesized are toxic to the hosts. Mechanisms for the cytotoxicity are not well understood at present although it has reported that, in S. cerevisiae, artemisinic acid biosynthesis leads to strong induction of stress responsive genes, such as those encoding ABC transporters and major facilitator superfamily (MSF) proteins, and enzymes involved in reducing oxidative and osmotic stress [16-21].

[0005] The potential of red yeasts, particularly species in Rhodosporidium (also known as Rhodotorula) for lipid (triacylglyceride) production has been recognized for more than 30 years because of their superior ability to produce intracellular lipid under very high density fermentation conditions producing >100g L^"1 dry cell biomass with up to about 70% lipid [22- 24]. Previously, proteomic studies in R toruloides Y4 strain has identified some proteins associated with lipid accumulation [25]. Recently, the combination of genomic, transcriptomic and proteomic studies has further advanced the understanding of biosynthetic pathways for lipid biosynthesis and intracellular accumulation [26-29]. Rhodosporidium are also natural producers of carotenoids [30]. An emerging area of research relates to channelling the high productivity of lipid and carotenoids to other high-value compounds, such as terpenne, alkane, and alkene, aromatic hydrocarbon and their derivatives, which may find diverse applications, such as nutrition, medicine, cosmetics, flavor and fragrance and biofuel [30-35]. Because Rhodosporidium species already have strong carotenoid biosynthetic pathway and strong metabolic flux to make precursor acetyl-CoA, it is conceivable that an efficient production system for terpenoids and carotenoids can be created with less engineering steps. Towards these goals, we and a number of other laboratories in the world have been developing genetic transformation methods and genetic manipulation tools [36-40].

[0006] It is desired to provide improved methods for the production of terpenes or their derivatives in fungal species, such as species of Rhodosporidium or Rhodotorula.

SUMMARY OF THE INVENTION

[0007] The present invention relates to the field of fungal production of a terpene or its derivatives. More specifically, the present invention relates to the production of a terpene or its derivatives in Rhodosporidium genus or Rhodotorula genus through the overexpression of a heterologous terpene synthase and the alteration of mRNA expression of one or more genes.

[0008] Thus, in one aspect, the present invention provides a genetically modified host cell having an overexpression of a heterologous farnesyl pyrophosphate synthase (FPPS), an overexpression of a heterologous terpene synthase involved in the production of a desired terpene and down-regulation of one or more gene products that are each a production bottleneck for the synthesis of the desired terpene. Such gene products are also referred to herein as terpene-induced gene products. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a promoter operatively linked to a heterologous nucleic acid sequence encoding FPPS. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a promoter operatively linked to a heterologous nucleic acid sequence encoding a terpene synthase. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a nucleic acid sequence for down-regulating a terpene-induced target gene. In some embodiments, the genetically modified host cell comprises a knocked-out terpene-induced target gene. In some embodiments, the terpene synthase may be amorphadiene synthase (ADS), a santalene synthase (SSY), beta- eudesmol synthase, bisabolene synthase, farnesene synthase, humulene synthase, zingiberene synthase, caryophyllene synthase, vetivazulene synthase, guaiazulene synthase or patchoulene synthase. In some embodiments, the coding sequence for FPPS and/or terpene synthase is codon modified for expression in the host cell. In some embodiments, the desired terpene is amorphadiene, santalene, beta-eudesmol, bisabolenes, farnesene, humulene, zingiberene, caryophyllene, vetivazulene, guaiazulene or patchoulene.

[0009] In some embodiments, a gene product that is a production bottleneck (or the terpene- induced gene product) is related to stress responses, DNA repair, rRNA processing, metabolism, transporters, regulators and signalling, which may play critical roles in restoring energy metabolism in normal cell physiology though detoxification, shutdown of metabolite production or induction of chemical degradation mechanisms. In some embodiments, a gene product that is a production bottleneck is kynurenine 3-monoxygenase, phosphatidic acid (PA) phosphatase, terpene oxidase, a transporter protein. In some embodiments, the down-regulation is a knockout. In some embodiments, the down-regulation or knock-out of the one or more gene products results in significantly increased growth of and/or terpene production in the genetically modified host cell.

[0010] In some embodiments, the host cell is a cell of a Rhodosporidium species or a Rhodotorula species. In some embodiments, the host cell is a cell of a strain of Rhodosporidium toruloides. In some embodiments the R. toruloides strain is the A29 strain.

[0011] In a second aspect, the present invention provides a method for producing a desired terpene. In some embodiments, the method comprises growing the genetically modified host cells described herein in or on a suitable medium for growth of the genetically modified host cell and for production of the desired terpene described herein. In some embodiments, the genetically modified host cells are cultured in a culture medium described herein. In some embodiments, the genetically modified host cells are grown in a conical flask containing a culture medium described herein. In some embodiments the genetically modified host cells are cultured in the conical flasks at a temperature as described herein. In some embodiments, the conical flasks are shaken at a rate as described herein.

[0012] In some embodiments, the genetically modified host cells are grown in a bioreactor containing a culture medium described herein. In some embodiments, the genetically modified host cells are inoculated into a bioreactor at a dilution rate as described herein. In some embodiments, the fermentation medium is kept at a temperature as described herein. In some embodiments, the pH of the fermentation medium is kept at a pH as described herein. In some embodiments, the fermentation medium is kept at a p02 as described herein. In some embodiments, terpene yield is increased by culturing the genetically modified host cells in the medium for a time period described herein. In some embodiments, isoproply myristate is then added as described herein. In some embodiments, feeding is done daily using a glucose solution with isopropyl myristate as described herein.

[0013] In a third aspect, the present invention provides a medium useful for the growth of the genetically modified host cell described herein and for the production of the desired terpene described herein. In some embodiments, the medium is designated Medium III. In some embodiments, Medium III comprises yeast extract, peptone, glucose, (NH₄)₂S0₄, KH₂PO₄, MgS0₄-7H₂0, FeS0₄ and CuCl₂ as described herein. In some embodiments, the medium is designated Y4 medium. In some embodiments, Y4 medium comprises glucose, peptone, yeast extract, ( H₄)₂S0₄, KH₂P0₄, MgS0₄ as described herein.

BRIEF DESCRIPTION OF THE FIGURES

[0014] Figs. 1A and IB show the effects of amorphadiene production on R. toruloides growth. Fig. 1A: Cell growth and amorphadiene production levels. OD₆₀oof Wt (open circle) and A29 (open triangle), and amorphadiene level of A29 (closed triangle) over 5 days of culture. Arrows indicate RNA sampling points. Fig. IB: Production of amorphadiene in 2L bioreactor.

[0015] Figs. 2A and 2B show pairwise comparisons of transcript abundance between A29 and Wt. Fig. 2 A: at day 1, and Fig. 2B: day 3. Plots were generated by EdgeR. logFC = log2(fold change) while logCounts = log2(average expression) between paired samples. Transcripts identified as significantly differentially expressed (p value < 0.05) are colored in gray.

[0016] Figure 3 shows heatmap and clustering of transcripts. The relative expression levels (log2FPKM) of transcripts were median-centered by transcript. [0017] Figure 4 shows a schematic diagram of potential genes limiting terpene production in R. toruloides. The number besides transcript ID indicates log2(fold change) on day 3 (see Table 6).

[0018] Figures 5 A and 5B show validation of DE transcripts by qRT-PCR. A29 and WT cells were cultured Medium III and sampled at day 1 or day 2. Two-way ANOVAs were used to determine significant differences between the expression levels of (ns, not significantly). Fig. 5 A: up-regulated genes. Fig. 5B: down-regulated genes. The IDs of the transcripts are listed in Table 6. Each data point was made with 3 biological replicates. Error bars indicate SD.

[0019] Figure 6 show sensitivity of Wt cells to terpenes. Cells were cultured in Medium III supplemented with menthol, linalool, caryophyllene or farnesol at the concentration indicated. MICo value determined as the lowest concentration that inhibited the visible growth of Wt cells when compared to the control cultures (dashed lines).

[0020] Figures 7A and 7B show terpene inducibility of 23 transcripts. Wt cells were cultured in Medium III with the supplementation of exogenous menthol (+M), linalool (+L), caryophyllene (+C) or farnesol (+F) at MIC₀. The relative expression levels at 1 hour, 5 hours and 24 hours after exposure are shown. Fig. 7A: 14 up-regulated genes. Fig. 7B: 9 down- regulated genes. The IDs of the transcripts are listed in Table 6. Each data point was made with 3 biological replicates. Error bars indicate SD.

[0021] Figure 8 shows the comparison of sesquiterpene titers in engineered strains. AF or SF, site-specific integration of amorphadiene or santalene producing cassettes, i.e. ADS-FPPS or SaSSY-FPPS cassettes at the URA3 locus.

[0022] Figures 9A-9C show deletion and over-expression plasmids. Fig. 9A: schematic illustration of deletion strategy using KO-cl623-pRH311 as an example. LB and RB are the left border and right border sequences of T-DNA derived from pPZP200 respectively; HI and H2 are 5' and 3 ' flanking sequences of the target gene (cl623) on the Rtl genome; HPT-3 cassette is ^RtGPm- ^'HPT-3: :Tsv4o, promoter KtGPDl + codon-optimized hygromycin phosphotransferase gene HPT-3 + transcriptional terminator Tsv₄o,^' loxP, recognition sequences of ere recombinase. Fig. 9B: schematic illustration of knock-in strategy. Hpt-3 cassette is V-_BXG_PDI - ^'-HPT-3 TSV_W, SaSSY cassette is V_mGPD1: :SaSSY-3: :T_ma, FPP cassette is V_RtGPOl: M^FPP: :T^. Fig. 9C: schematic illustration of over-expression strategy. HPT-3 cassette is VRtQPOi- ^'-HPTSwTsww, KMOl cassette is ^'P_RtGp_Oi: :KmoT. :T_35S.

[0023] Figures 10A-10Q transcript clusters extracted from the hierarchical clustering heatmap. X axis: samples; y axis: median-centered log2(FPKM). Gray lines, individual transcripts; blue line, average expression values per cluster. Number of transcripts in each cluster is shown in the left corner of each plot.

[0024] Figures 11A-11W show expression levels of 23 selected genes shown by ΔΔΟΤ WT + terpene/terpenoid vs. Wt after exposure to each terpene (menthol, linalool, caryophyllene or farnesol) at MICO for 1 hour, 2 hour, 5 hours and 24 hours, a.) the 14 up-regulated genes in A29. b.) the 9 down-regulated genes in A29.

DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention relates to the field of fungal production of a terpene or its derivatives. More specifically, the present invention relates to the production of a terpene or its derivatives in Rhodosporidium genus or Rhodotorula genus through the overexpression of a heterologous terpene synthase and the alteration of mRNA expression of one or more genes.

[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention belongs.

[0027] The term "about" or "approximately" means within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term "about" or "approximately" depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.

[0028] A "control" or "control fungus" or "control fungal cell" provides a reference point for measuring changes in phenotype of a subject fungus or fungal cell in which genetic alteration, such as transformation, has been effected as to a polynucleotide of interest. A subject fungus or fungal cell may be descended from a fungus or fungal cell so altered and will comprise the alteration.

[0029] A control fungus or fungal cell may comprise, for example: (a) a wild-type fungus or fungal cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject fungus or fungal cell; (b) a fungus or fungal cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a fungus or fungal cell genetically identical to the subject fungus or fungal cell but which is not exposed to conditions or stimuli that would induce expression of the polynucleotide of interest or (d) the subject fungus or fungal cell itself, under conditions in which the polynucleotide of interest is not expressed.

[0030] "Constitutive promoter" refers to a promoter which is capable of causing a gene to be expressed in most cell types at most. A "strong constitutive promoter" refers to a constitutive promoter that drives the expression of a mRNA to the top 10% of any mRNA species in any given cell.

[0031] A "dsRNA" or "RNAi molecule," as used herein in the context of RNAi, refers to a compound, which is capable of down-regulating or reducing the expression of a gene or the activity of the product of such gene to an extent sufficient to achieve a desired biological or physiological effect. The term "dsRNA" or "RNAi molecule," as used herein, refers to one or more of a dsRNA, siRNA, shRNA, ihpRNA, synthetic shRNA, miRNA.

[0032] The term "down regulated," as it refers to genes inhibited by the subject RNAi method, refers to a diminishment in the level of expression of a gene(s) in the presence of one or more RNAi construct(s) when compared to the level in the absence of such RNAi construct(s). The term "down regulated" is used herein to indicate that the target gene expression is lowered by 1-100%). For example, the expression may be reduced by about 5%, 10%>, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

[0033] The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein coding sequence results from transcription and translation of the coding sequence.

[0034] As used herein, "gene" refers to a nucleic acid sequence that encompasses a 5' promoter region associated with the expression of the gene product, any intron and exon regions and 3 Or 5' untranslated regions associated with the expression of the gene product.

[0035] As used herein, "genotype" refers to the genetic constitution of a cell or organism.

[0036] The term "heterologous" or "exogenous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous or exogenous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein). [0037] "Inducible promoter" refers to a promoter which is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress, such as that imposed directly by heat, cold, salt or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus or other biological or physical agent or environmental condition.

[0038] "Introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0039] "Knock-out" or "knockout" as used herein refers to a gene that is or has been made inoperative. Knock-out or gene knock-out refers to an inhibition or substantial suppression of endogenous gene expression either by a transgenic or a non-transgenic approach. For example, knock-outs can be achieved by a variety of approaches including transposons, retrotransposons, deletions, substitutions, mutagenesis of the endogenous coding sequence and/or a regulatory sequence such that the expression is substantially suppressed; and any other methodology that suppresses the activity of the target of interest.

[0040] "Operable linkage" or "operably linked" or "operatively linked" as used herein is understood as meaning, for example, the sequential arrangement of a promoter and the nucleic acid to be expressed and, if appropriate, further regulatory elements such as, for example, a terminator, in such a way that each of the regulatory elements can fulfill its function in the recombinant expression of the nucleic acid to make dsRNA. This does not necessarily require direct linkage in the chemical sense. Genetic control sequences such as, for example, enhancer sequences, can also exert their function on the target sequence from positions which are somewhat distant, or indeed from other DNA molecules (cis or trans localization). Preferred arrangements are those in which the nucleic acid sequence to be expressed recombinantly is positioned downstream of the sequence which acts as promoter, so that the two sequences are covalently bonded with one another. Regulatory or control sequences may be positioned on the 5' side of the nucleotide sequence or on the 3' side of the nucleotide sequence as is well known in the art. [0041] "Over-expression" or "overexpression" refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal, control or non-transformed organisms.

[0042] As used herein, "phenotype" refers to the detectable characteristics of a cell or organism, which characteristics are the manifestation of gene expression.

[0043] The terms "polynucleotide," "nucleic acid" and "nucleic acid molecule" are used interchangeably herein to refer to a polymer of nucleotides which may be a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role. Unless otherwise indicated, nucleic acids or polynucleotide are written left to right in 5' to 3' orientation, Nucleotides are referred to by their commonly accepted single-letter codes. Numeric ranges are inclusive of the numbers defining the range.

[0044] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Amino acids may be referred to by their commonly known three-letter or one-letter symbols. Amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range.

[0045] "Promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.

[0046] "Promoter functional in a fungus" is a promoter capable of controlling transcription in fungal cells whether or not its origin is from a fungal cell.

[0047] "Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/ transduction/transposition) such as those occurring without deliberate human intervention.

[0048] "Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein. A suppression DNA construct, used herein, is a type of recombinant DNA construct. In several embodiments described herein, a recombinant DNA construct may also be considered an "over expression DNA construct."

[0049] "Regulatory sequences" refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein.

[0050] "Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.

[0051] "Transformation" as used herein refers to both stable transformation and transient transformation.

[0052] A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

[0053] "Transgenic fungus" includes reference to a fungus which comprises within its genome a heterologous polynucleotide. For example, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. "Transgenic fungus" also includes reference to fungi which comprise more than one heterologous polynucleotide within their genome. A "transgenic fungus" encompasses all descendants which continue to harbor the foreign DNA.

[0054] Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, WI). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5: 151-153) with the default parameters (GAP PEN ALT Y= 10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

[0055] Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5: 151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8: 189-191 (1992)) can be found in the MegAlign™ v6.1 program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow-Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table in the same program.

[0056] The term "under stringent conditions" means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5xSSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC to 6xSSC at about 40-50 °C (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42 °C) and washing conditions of, for example, about 40-60 °C, 0.5-6xSSC, 0.1%) SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50 °C and 6xSSC. Highly stringent conditions can also be readily determined by those skilled in the art, e.g., depending on the length of DNA.

[0057] Generally, such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65 °C, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably 2xSSC, most preferably 0.2xSSC), compared to the moderately stringent conditions. For example, highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68 °C, 0.2xSSC, 0.1% SDS. SSPE (lxSSPE is 0.15 M NaCl, 10 mM NaH₂P0₄, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (lxSSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.

[0058] It is also possible to use a commercially available hybridization kit which uses no radioactive substance as a probe. Specific examples include hybridization with an ECL direct labeling & detection system (Amersham). Stringent conditions include, for example, hybridization at 42 °C for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCl, and washing twice in 0.4% SDS, 0.5xSSC at 55 °C for 20 minutes and once in 2xSSC at room temperature for 5 minutes.

[0059] In one aspect, the present invention provides a genetically modified host cell having an overexpression of a heterologous farnesyl pyrophosphate synthase (FPPS), an overexpression of a heterologus terpene synthase involved in the production of a desired terpene and down- regulation of one or more gene products that are each a production bottleneck for the synthesis of the desired terpene. Such gene products are also referred to herein as terpene-induced gene products. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a promoter operatively linked to a heterologous nucleic acid sequence encoding FPPS. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a promoter operatively linked to a heterologous nucleic acid sequence encoding a terpene synthase. In some embodiments, the genetically modified host cell comprises a nucleic acid construct comprising a nucleic acid sequence for down-regulating a terpene-induced target gene. In some embodiments, the genetically modified host cell comprises a knocked-out terpene-induced target gene. In some embodiments, the invention provides a genetically modified fungal cell useful for producing a desired terpene that comprises (a) a nucleic acid construct that overexpresses a heterologous farnesyl pyrophosphate synthase (FPPS), (b) a nucleic acid construct that overexpresses a heterologous terpene synthase involved in the production of a desired terpene and (c) either (i) one or more nucleic acid constructs each down-regulating one or more terpene-induced genes or (ii) one or more knocked-out terpene induced genes or a combination of (i) and (ii). [0060] In some embodiments, the terpene synthase may be amorphadiene synthase (ADS), a santalene synthase (SSY), beta-eudesmol synthase, bisabolene synthase, farnesene synthase, humulene synthase, zingiberene synthase, caryophyllene synthase, vetivazulene synthase, guaiazulene synthase or patchoulene synthase. In some embodiments, the coding sequence for FPPS and/or terpene synthase is codon modified for expression in the host cell. In some embodiments, the desired terpene is amorphadiene, santalene, beta-eudesmol, bisabolenes, farnesene, humulene, zingiberene, caryophyllene, vetivazulene, guaiazulene or patchoulene. In some embodiments, the heterologous FPPS and terpene synthase coding sequences are operatively linked to a strong constitutive promoter. In some embodiments, the strong constitutive promoter is the promoter of RtGPDl gene. In some embodiments the promoter of RtGPDl gene comprises the sequence set forth in SEQ ID NO: 126.

[0061] In some embodiments, the FPPS is derived from Methylobacterium populi and has the sequence set forth in SEQ ID NO: 5 with the coding sequence set forth in SEQ ID NO:4; E,E- farnesyl diphosphate synthase of Santalum album (GenBank No. ADO87007); farnesyl pyrophosphate synthase of Humulus lupulus (GenBank No. BAB40665.1); farnesyl diphosphate synthase of Rhodotorula toruloides (GenBank No. XP 016272719).

[0062] In some embodiments, the ADS is derived from Artemisia annau and has the sequence set forth in SEQ ID NO: 3 with the optimized codon coding sequence set forth in SEQ ID NO:2.

[0063] In some embodiments, the SSY is derived from Santalum album and has the sequence set forth in SEQ ID NO: 128 with the coding sequence set forth in SEQ ID NO: 127.

[0064] In some embodiments, a gene product that is a production bottleneck (or the terpene induced gene product) is related to stress responses, DNA repair, rRNA processing, metabolism, transporters, regulators and signalling, which may play critical roles in restoring energy metabolism in normal cell physiology though detoxification, shutdown of metabolite production or induction of chemical degradation mechanisms. In some embodiments, a gene product that that limits the production of metabolite of interest is a protein that is homologous to kynurenine 3-monoxygenase, phosphatidic acid (PA) phosphatase, diacyl glycerol diphosphate phosphatase, MFS (major facilitator superfamily) transporter or P450 cytochrome oxidase. In some embodiments, the down-regulation is a knock-out. In some embodiments, the down-regulation or knock out of the one or more gene products results in significantly increased growth of and/or terpene production in the genetically modified host cell. [0065] In some embodiments, the expression of the terpene-induced gene or production of its protein is reduced (down-regulated) or knocked-out by anti-sense expression, co-suppression, dsRNA, ribozymes, microRNA, RNAi, genome editing, targeted promoter inactivation, site- directed mutagenesis and knock-outs. Such techniques are described in U.S. Patent Nos. 7,312,323 and references cited therein. For example, reduction might be accomplished, for example, with transformation of a fungal host cell to comprise a promoter and other 5' and/or 3' regulatory regions described herein linked to an antisense nucleotide sequence, hairpin, RNA interfering molecule, double stranded RNA, microRNA or other nucleic acid molecule, such that tissue-preferred expression of the molecule interferes with translation of the mRNA of the native DNA sequence or otherwise inhibits expression of the native target gene in fungal cells. For further description of RNAi techniques or microRNA techniques, see, e.g., U.S. Patent Nos. 5,034,323; 6,326,527; 6,452,067; 6,573,099; 6,753,139; and 6,777,588. See also International Publication Nos. WO 97/01952, WO 98/36083, WO 98/53083, WO 99/32619 and WO 01/75164; and U.S. Patent Application Publication Nos. 2003/0175965, 2003/0175783, 2003/0180945, 2004/0214330, 2005/0244858, 2005/0277610, 2006/0130176, 2007/0265220, 2008/0313773, 2009/0094711, 2009/0215860, 2009/0308041, 2010/0058498 and 2011/0091975. See also International Publication No. WO 2016/159887. RNAi molecules or microRNA molecules (referred to collectively herein as RNAi molecules) can be prepared by the skilled artisan using techniques well known in the art, including techniques for the selection and testing of RNAi molecules and microRNA molecules that are useful for down regulating a target gene.. See, for example, Wesley et al. [106], Mysara et al. [107], and Yan et al. [108].

[0066] Knockouts of terpene induced target genes is accomplished using conventional techniques well known to skilled artisan, for example, by using homologous recombination which may be enhanced by the use of a non-homologous end-joining (NUEJ) mutant [109] (Koh et al. "Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70- deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides." BMC microbiology 14.1 (2014): 1.), or by using the CRISPR-CAS9 system [110].

[0067] In some embodiments, the host cell is a cell of a Rhodosporidium species or a Rhodotorula species. In some embodiments, the host cell is a cell of a strain of Rhodosporidium toruloides. In some embodiments the R toruloides strain is the A29 strain. In some embodiments, a nucleic acid construct is stably integrated in the genome of the fungal cell. In other embodiments, the fungal cell is part of a composition also comprising a culture medium. [0068] In some embodiments, the genetically engineered host cell further comprises an over- expressed mevalonate pathway gene. In some embodiments, the mevalonate pathway gene encodes an acetyl-CoA C-acetyltransferase (e.g., SEQ ID NO: 11); a hydroxymethylglutaryl- CoA synthase (e.g., SEQ ID NO: 12); hydroxyl methylglutaryl-CoA reductase (e.g., SEQ ID NO: 13); phosphomevalonate kinase (e.g., SEQ ID NO: 15); diphosphomevalonate decarboxylase (e.g., SEQ ID NO: 16); or a isopentenyl-diphosphate del ta-isom erase (e.g., SEQ ID NO: 17 or 18). In some embodiments, mevalonate pathway genes are expressed under the regulation of a strong and constitutive or inducible promoter. In some embodiments, the promoter is the strong constitutive promoter RtGPDl (GenBank Accession No. JN208861; SEQ ID NO: 126).

[0069] In a second aspect, the present invention provides a method for producing a desired terpene. In some embodiments, the method comprises growing the genetically modified host cells described herein in or on a suitable medium for growth of the genetically modified host cell and for production of the desired terpene described herein. In some embodiments, the genetically modified host cells are cultured in a culture medium described herein. In some embodiments, the genetically modified host cells are grown in a conical flask containing a culture medium described herein. In some embodiments the genetically modified host cells are cultured in the conical flasks at about 20 °C to about 32 °C, preferably at about 25 °C to about 30 °C, more preferably at about 30 °C. In some embodiments, the conical flasks are shaken at about 100 rpm to about 300 rpm, preferably at about 150 rpm to about 300 rpm, more preferably about 250 rpm to about 280 rpm.

[0070] In some embodiments, the genetically modified host cells are grown in a bioreactor containing a culture medium described herein. In some embodiments, the genetically modified host cells are inoculated into a bioreactor at a dilution rate of about 1% to about 30%, preferably about 5% to about 20%, more preferably about 10%. In some embodiments, the fermentation medium is kept at about 20 °C to about 32 °C, preferably at about 25 °C to about 30 °C, more preferably at about 30 °C. In some embodiments, the fermentation medium is kept at a pH of about 4 to about 7, preferably about 5 to about 6. more preferably about 5.5. In some embodiments, the fermentation medium is kept at a p02 of about 10% to about 50%, preferably about 10%) to about 40%>, more preferably about 30%>.

[0071] In some embodiments, terpene yield is increased by culturing the genetically modified host cells in the fermentation medium for about 48 to about 240 hrs, preferably about 72 hrs to about 120 hrs. In some embodiments, isoproply myristate is then added at a concentration from about 5%> v/v to about 15%> v/v, preferably from about 5%> v/v to about 10%> v/v, more preferably about 10% v/v. In some embodiments, feeding is done daily using a glucose solution with isopropyl myristate. In some embodiments the glucose solution comprises glucose at about 50% to about 80%), about 65%> to about 80%>, more preferably about 80%>. In some embodiments the glucose solution comprises isopropyl myristate at about 5% to about 15%, about 5%> to about 10%>, more preferably about 10%>.

[0072] In some embodiments, the amount of terpene produced in accordance with the present invention ranges in the amount of about 10 mg L^"1 to about 1000 mg L^"1 in the shaking flask cultures.

[0073] In a third aspect, the present invention provides a medium useful for the growth of the genetically modified host cell described herein and for the production of the desired terpene described herein. In some embodiments, the medium is designated Medium III. In some embodiments, Medium III comprises yeast extract, peptone, glucose, ( H₄)₂S0₄, KH₂PO₄, MgS0₄-7H₂0, FeS0₄ and CuCl₂. In some embodiments, Medium III comprises 8 g L^"1 yeast extract, 3 g L^"1 peptone, 100 g L^"1 glucose, 3 g L^"1 ( H₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.5 g L^"1 MgS0 -7H₂0, 0.1 mM FeS0 and 0.1 mM CuCl₂. In some embodiments, the medium is designated Y4 medium. In some embodiments, Y4 medium comprises glucose, peptone, yeast extract, ( H₄)₂S0₄, KH₂P0₄, MgS0₄. In some embodiments, Y4 medium comprises 100 g L^"1 glucose, 15.7 g L^"1 peptone, 15.7 g L^"1 yeast extract, 12 g L^"1 ( H₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.75 g L^"1 MgS0₄.

[0074] As shown herein and similar to previous findings in bread yeast and E. coli [16-21], over production of FPP and accumulation of terpene resulted in growth repression and production bottleneck in red yeast. In order to formulate new measures to improve terpene production in this engineered red yeast, RNA-seq and de novo transcriptomic analysis was applied. As shown herein, the MVP genes were not significantly affected by over-expression of FPPS and a terpene synthase, such as ADS, but it was found that many DE transcripts related to stress responses, DNA repair and rRNA processing, metabolism, transporters, regulators and signalling, which may play critical roles in restoring energy metabolism in normal cell physiology though detoxification, shutdown of metabolite production or induction of chemical degradation mechanisms. Through MIC test, qRT-PCR and mutation experiments, several DE transcripts as knock-out targets to improve terpene production further in this host. Examples of DE transcripts that can be down-regulated to improve terpene production include cl623_gl_il encoding a kynurenine 3-monooxygenase related protein; c8301 encoding a LPP1 type2/haloperoxidase, c8162 encoding a LPPl-like protein; cl873 encoding a santalene oxidase like protein; or c459 encoding a major facilitator superfamily (MFS) transporter. Examples of sequences for these genes that can be targeted include:

kynurenine 3-monoxygenase: SEQ ID NO:6;

phosphatidic acid (PA) phosphatase/ diacylglycerol diphosphate phosphatase: SEQ ID NO:9, SEQ ID NO: 130 ,

MFS (major facilitator superfamily) transporter: SEQ ID NO: 129; and

P450 cytochrome oxidase: SEQ ID NO: 131.

In addition to these identified sequences, further examples include homologs thereof and sequences having at least 90% identity, or at least 95% identity, or at least 98% identity or at least 99% identity.

[0075] In preparing nucleic acid constructs for use in the present invention, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g. transitions and transversions may be involved.

[0076] Nucleic acids of the present invention may also be synthesized, either completely or in part, especially where it is desirable to provide fungi-preferred sequences, by methods known in the art. Thus, all or a portion of the nucleic acids of the present invention may be synthesized using codons preferred by a selected host. Species-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a particular host species. Other modifications of the nucleotide sequences may result in mutants having slightly altered activity.

[0077] One or more nucleic acid constructs may be introduced directly into a fungal cell using techniques such as electroporation, DNA particle bombardment. Alternatively, the nucleic acid constructs may be combined with suitable T-DNA flanking regions and introduced into an Agrobacterium tumefaciens host, which will deliver the gene cassette into the fungal genome. Thus, any method, which provides for effective transformation/transfection of fungi may be employed. See, for example, U.S. Patent Nos. 7,241,937, 7,273,966 and 7,291,765 and U.S. Patent Application Publication Nos. 2007/0231905 and 2008/0010704 and references cited therein. See also, International Published Application Nos. WO 2005/103271 and WO 2008/094127 and references cited therein. See also International Publication No. WO 2016/159887.

[0078] The transformed fungi are transferred to standard growing media (e.g., solid or liquid nutrient media, grain, vermiculite, compost, peat, wood, wood sawdust, straw, etc.) and grown or cultivated in a manner known to the skilled artisan.

[0079] After the polynucleotide is stably incorporated into transformed fungi, it can be transferred to other fungi by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

[0080] It may be useful to generate a number of individual transformed fungi with any recombinant construct in order to recover fungi free from any positional effects. It may also be preferable to select fungi that contain more than one copy of the introduced polynucleotide construct such that high levels of expression of the recombinant molecule are obtained.

[0081] It may be desirable to produce fungal lines that are homozygous for a particular gene if possible in the particular species. In some species this is accomplished by the use monosporous cultures. By using these techniques, it is possible to produce a haploid line that carries the inserted gene and then to double the chromosome number either spontaneously or by the use of colchicine. This gives rise to a fungus that is homozygous for the inserted gene, which can be easily assayed for if the inserted gene carries with it a suitable selection marker gene for detection of fungi carrying that gene. Alternatively, fungi may be self-fertilized, leading to the production of a mixture of spores that consists of, in the simplest case, three types, homozygous (25%), heterozygous (50%) and null (25%) for the inserted gene. Although it is relatively easy to score null fungi from those that contain the gene, it is possible in practice to score the homozygous from heterozygous fungi by Southern blot analysis in which careful attention is paid to the loading of exactly equivalent amounts of DNA from the mixed population, and scoring heterozygotes by the intensity of the signal from a probe specific for the inserted gene. It is advisable to verify the results of the Southern blot analysis by allowing each independent transformant to self-fertilize, since additional evidence for homozygosity can be obtained by the simple fact that if the fungi was homozygous for the inserted gene, all of the subsequent fungal lines from the selfed individual will contain the gene, while if the fungus was heterozygous for the gene, the generation grown from the selfed seed will contain null fungal lines. Therefore, with simple selfing one can select homozygous fungal lines that can also be confirmed by Southern blot analysis. [0082] Creation of homozygous parental lines makes possible the production of hybrid fungus and spores that will contain a modified protein component. Transgenic homozygous parental lines are maintained with each parent containing either the first or second recombinant DNA sequence operably linked to a promoter. Also incorporated in this scheme are the advantages of growing a hybrid crop, including the combining of more valuable traits and hybrid vigor.

[0083] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al, 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al, 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley- VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.

EXAMPLES

[0084] The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized.

EXAMPLE 1

Methods

[0085] Strains and sequence: RtlCE6, referred as wild-type (Wt) herein, is a derivative of R. toruloides ATCC 10657 containing the estrogen inducible gene cassette, Umgpd: :CRE: :ER: :NLS:nos (SEQ ID NO: l), which is composed of gdp promoter of Ustilago maydis [97] driving the expression of CRE: :ER: :NLS fusion Cre recombinase that can be activated by human hormone estrogen [36]. Strain A29 contains 2 chromosome-integrated artificial genes delivered by Agrobacterium tumefaciens mediated transformation (ATMT) composed of the enhanced ADS coding sequence (CDS) (SEQ ID NO: 2) of Artemisia annua (GenBank: AEQ63683), which had been codon-optimized for expression in R toruloides, and the FPP synthase CDS (MpFPPS; SEQ ID NO:4) derived from a local isolate of Methylobacterium populi [42]. Both CDSes were overexpressed by the strong constitutive promoter RtGPDl (GenBank Accession No. JN208861; SEQ ID NO: 126). The sequences noted above, sequences of possible transcript targets for gene deletion, a sequence for a kynurenine 3-monooxygenase (KMO) and a sequence for a santaleen synthase are identified by SEQ ID NO: in Table 1.

TABLE 1

Sequences

Sequence Name SEQ ID NO:

Umgpd: :CRE: :ER:nos 1

ADS-2 2

MpFPPS 4

>cl623 gl il kynurenine 3-monooxygenase 6 >c3369_gl_i4 NAD dependent oxidoreductase 7

>cl0565_gl_i l response to drug/mutagen-related protein 8

>c8301_gl_i l RHTO|LPPl_type_2/haloperoxidase2|phosphatidic acid 9 phosphatase type 2/haloperoxidase family protein

KMO 10

SaSSY 127

>c459 gl i l MFS transporter, siderochrome-iron transporter mirC 129

>c8162_gl_i l RHTO LPPl_type_2/haloperoxidase phosphatidic acid 130 phosphatase type 2/haloperoxidase

>cl 873_gl_i l Santalene oxidase like protein 131

>c6055_gl_i2 geranylgeranyl pyrophosphate synthase 132

>c3885_gl_i l RHTO LPPl_type_2/haloperoxidase3 phosphatidic acid 151 phosphatase type 2/haloperoxidase

>c4190_gl_i l RHTO LPP1 lysophosphatidic acid acyltransferase / 152 lysophosphatidylinositol acyltransferase

>c5695 gl i2 Santalene oxidase like protein 153

> RHTO0S08e01728gl 154

>2-dehydro pantoete 2 reductase (DPR1) 155

[0086] Culture of red yeast: A single colony of Wt or A29 strain established on a YPD plate was inoculated in YPD medium and cultured at 30°C for 24 hr. Yeast cells were collected by centrifugation; inoculated into 50 ml Medium III to -0.1 OD₆oo unit in a 250 ml conical flask and cultured at 30°C, 280 rpm for 5 days. Samples were collected daily for the determination of OD₆oo and amorphadiene concentration. Medium III is composed of 8 g L^"1 yeast extract, 3 g L^"1 peptone, 100 g L^"1 glucose, 3 g L^"1 (NH₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.5 g L^"1 MgS0₄-7H₂0, 0.1 mM FeSO₄ and 0.1 mM CuCl₂.

[0087] Fed-batch fermentation : A29 was inoculated into 2 Lbioreactors at a dilution rate of 10%. Y4 medium was usually used (100 g L^"1 glucose, 15.7 g L^"1 peptone, 15.7 g L^"1 yeast extract, 12 g L^"1 (NH₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.75 g L^"1 MgS0₄). Fermentation medium was kept at 30°C, pH 5.5, p02 -20%. To increase terpene yield, cells were cultured in the medium to 24 hours and then isopropyl myristate was added to 10% v/v. Feeding was done daily using 80% glucose solution with 10% isopropyl myristate. [0088] Extraction of terpene and GC-MS analysis: Extraction of terpene was done with 0.5 ml cell culture, which was pelleted by centrifugation at 10,000 rpm for 1 min and then 0.2 ml glass beads (0.5 mm diameter, BioSpec Products Inc., USA) and 0.5 ml ethyl acetate containing 0.02 mg/ml caryophyllene (as internal standard) were added. Cells were lysed in a FastPrep- 24™ homogenizer (MP Biomedicals, USA) for 60s at 6000 rpm. Ethyl acetate layers were collected after centrifugation for 1 min in a microcentrifuge at full speed. Extraction was repeated once and ethyl acetate layers were combined and subjected to GC-MS analysis.

[0089] GC-MS analysis was done in a Shimadzu GC2010 system (Shimadzu, Japan) equipped with a DB-WAX fused silica column (polar, 30 m, 0.25 mm ID., 0.25 m thickness, J & W Scientific, USA). Samples (1 μΐ) were injected in pulsed splitless mode at 200°C and run with helium as the carrier gas at a flow rate of 1.0 ml/min. Pulsed pressure was set at 15 psi for 0.5 min. Scan range: m/z 40-500; SIM: m/z 93, 94, 105, 107, 119, 122 and 202 with a dwell time of 50 ms. The column was running at 40°C for 3 min, ramp of 8°C/min to 180°C and stand for 5 min, 10°C/min to 220°C and stand for 10 min. Data was acquired with Chemstation (Shimidzu, Japan) and compounds were identified by search against the NIST/EPA/NIH mass spectral library v2.0 and comparison of mass spectrum using authentic standards. Compound quantification was done with caryophyllene or cyclohexane as the internal standard.

[0090] RNA-sequencing (RNA-seq): Cell cultures (1 ml) in 250 ml flask were collected on day 1 and day 3 and immediately stabilized with 2 volumes of KNAlater reagent (Qiagen, USA). Samples were extracted using RNAeasy Plus universal mini kit (Qiagen, USA). RNA was quantified with Nanodrop (Thermo scientific, USA) and RNA quality was assessed by agarose gel electrophoresis and Bioanalyzer (Agilent Technologies, USA) before sequencing. cDNA libraries construction and RNA-seq were done by Macrogen Inc. (Korea) using Illumina Hiseq 2000.

[0091] Computational analysis: Approximately 52 million 101 bp paired-end sequencing reads were generated by RNA-seq. Adaptor sequences and low quality reads were removed with NGS QC toolkit [98]. A local transcriptome sequence database was generated by assembling the raw reads using the Trinity software [99, 100]. Differentially expressed transcripts were identified with the RSEM and edgeR packages [101, 102]. Computational analysis was performed in a Galaxy platform installed locally [103].

[0092] MA-plots and Heatmaps were generated by comparing differential expression patterns between samples. The top DE transcripts were extracted by setting p values < 0.001 and log₂ (fold changes) >2. Gene annotation was done by BLASTx against non-redundant (NR) database and protein databases of R toruloides [26, 104].

[0093] Transcripts with potential functions in isoprenoid biosynthesis and regulation were extracted by BLASTx against a local protein database composed of enzymes reported previously in S. cerevisiae and R toruloides (Table 2). The expression levels of the transcripts were extracted from the edgeR results.

TABLE 2

Enzymes Involved in Isoprenoid Biosynthesis

ENZYME SEQ ID NO:

>RHTO|ERG10|acetyl-CoA C-acetyltransferase 11

>RHTO ERG13 hydroxymethylglutaryl-CoA synthase 12

>RHTO|HMGl |hydroxymethylglutaryl-CoA reductase (NADPH) 13

>RHTO hydroxymethylglutaryl-CoA lyase 14

>RHTO ERG8 phosphomevalonate kinase 15

>RHTO MVD1 diphosphomevalonate decarboxylase 16

>RHTO IDIl l isopentenyl-diphosphate delta-isomerase 17

>RHTO DDI 1 2 i sopentenyl-diphosphate delta-i somerase 18

>RHTO ERG20 farnesyl diphosphate synthase 19

>RHTO BTSl l farnesyl-diphosphate farnesyltransferase 20

>RHTO BTS 1 2 farnesyl-diphosphate farnesyltransferase 21

>RHTO|RHTO_04291 |protoheme IX farnesyltransferase 22

>RHTO|RHTO_05830|protein 23 farnesyltransferase/geranylgeranyltransf erase type-1 subunit alpha

>RHTO RHTO 06679 protein farnesyltransferase subunit beta 24

>RHTO ERG9 protein of squalene/phytoene synthase family 25

>Sce ERG10 acetyl-CoA C-acetyltransferase 26

>Sce ERG13 hydroxym ethyl glutaryl-CoA synthase 27

>Sce|HMG2|hydroxymethylglutaryl-CoA reductase(NADPH) 28

>Sce ERG12 mevalonate kinase 29

>Sce ERG8 phosphomevalonate kinase 30

>Sce MVD1 diphosphomevalonate decarboxylase 31 >Sce|HMGl |hydroxymethylglutaryl-CoA reductase (NADPH) 32

>Sce IDI1 isopentenyl-diphosphate del ta-isom erase 33

>Sce ERG20 bifunctional (2E,6E)-farnesyl diphosphate 34 synthase/dimethylallyltranstransferase

>Sce BTS 1 farnesyltranstransferase 35

>Sce ERG9 bifunctional farnesyl-diphosphate 36 farnesyltransferase/squalene synthase

>SCE LPP1 phosphatidate phosphatase 37

>SCE DPP1 bifunctional diacyl glycerol diphosphate 38 phosphatase/phosphatidate phosphatase

>RHTO LPPl_type_2_beta type 2 phosphatidic acid phosphatase beta 39

>RHTO LPPl_type_2/haloperoxidase phosphatidic acid phosphatase 40 type 2/haloperoxidase

>RHTO LPP1 lysophosphatidic acid acyltransferase / 41 lysophosphatidylinositol acyltransferase

>RHTO LPPl_type_2/haloperoxidase2 phosphatidic acid phosphatase 42 type 2/haloperoxidase family protein

>RHTO LPPl_type_2/haloperoxidase3 phosphatidic acid phosphatase 43 type 2/haloperoxidase

[0094] qRT-PCR: Total RNA samples were treated by RNase-free DNase I (Roche, Germany) to remove contaminating genomic DNA. First-strand cDNA was synthesized with 1 μg DNA-free total RNA using oligo-dT as the primer and the ImProm-IITM Reverse Transcription System (Promega, USA). PCR primer pairs were designed using Primer 3 software or Primer Designing Tool at NCBI (http colon slash slash www dot ncbi dot nlm dot nih dot gov slash tools slash primer-blast slash).

[0095] PCR reactions were performed in MicroAmp® 384-well plates (Applied Biosystems, USA) on a 7900HT Real-Time PCR System with Sequence Detection Systems Software version 2.3 (Applied Biosystems, USA). Each well contained 5 μΐ 2 SYBR® Select Master Mix (Life Technologies, USA), 20 ng cDNA, and 300 nM of each primer pair (Table 3) in a final volume of 10 μΐ. Thermal cycling conditions were: 2 min at 50°C, 2 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. Melting curve analysis (60°C to 95°C, after the 40 cycles of PCR) was performed to verify the specificity of the amplicons. Threshold cycles (CT) of each transcript was the average of 3 independent reactions normalized against CT of the reference gene Actin [37]. The fold change values were calculated using AA l method. TABLE 3

Primer Pairs

PRIMER NAME PRIMER SEQUENCE 5' TO 3' SEQ ID

C1143f CCTCGTCTGGTCGCTCAAGT 44

C1143r CCGAGTTGTAGAGGCGATGG 45

C4387f TGAGATGGTGCTGGTGGAGA 46

C4387r GCAACGAACGGAAGGATCAG 47

C1623f CGAGAGACCCCCTCATTCCT 48

C1623r GCGGTGTTCTGGAGCTATCG 49

C3369f CTCCCTCCTCGCACTCTTCA 50

C3369r GCCTCCTCCACCGGTTTATC 51

C7986f CTCGGAAAAGCGTGGTTGAC 52

C7986r GGGAAAGGGAATGGTCTTGC 53

C944f CCGCTCAGTCCTCCAACAAC 54

C944r TGCCAGAGTCATCGAGTCCA 55

C9624f GCACGAGATTCCGACCAGAC 56

C9624r GGCGACAGACACACTGCAAC 57

C10565f ACTGCAAGTGCTCACGCTCA 58

C10565r CGACCGAGACGTTGATGATG 59

C4760f CCAGCTCGACAATCCTCTGG 60

C4760r GCCGCTCGTAGGGAGAAACT 61

C8954f GGTTTGGCGTCAACGACTTC 62

C8954r GAGAGGGTCGGGAAGAGGAA 63

C139f CGCCTCCTCCAAAACCTACC 64

C139r CGACCTTGTCGTTCCACTCC 65

C1930f CAAAGCGACCCCGTACTGAC 66

C1930r AAGCGGTGTTGGAGCACAAG 67

C2947f GCAGCCTCTCCAACCTTGTG 68

C2947r GGCGAGAGTTCAAGCAAGGA 69

C4046f CAGCTCGCCTCCTACTTCCA 70

C4046r GGTGCGAGTATCGGTCAAGG 71

C459f CTCGGCACTCAAGTCCGTCT 72 C459r TGC GT AC AGGA AGAC GC AGA 73

cl576f CAAGCTCAACCCGAAGGCTA 74

cl576r TCGAAAGCGACGATGATGCT 75

c2369f CGACTTGTGGTGGAGGGAAC 76

c2369r TCCACCTGCTCCTCCATACC 77

c3252f AGGTATCCGAGGAGGTAGGC 78

c3252r CTCTTCTCCTCCCCTCCCAC 79

c4018f CGTGTTGTTCTCGGTGAGGA 80

c4018r TACAGTCTCGTCAGGCAGGT 81

c5009f GCCTGCTTGCTTTCTCTCCT 82

c5009r GAGATGCGTGAGAGGGGC 83

c5018f GAGTCAGTCTGGGATGCTGG 84

c5018r CTCACCACACCCTGAGAACC 85

c503f GGAAGAGGTGGTGGGTGAAG 86

c503r CAGACAGTCCTGCGCAACTA 87

c7313f CTCCGTTGAGCGACTTTCCT 88

c7313r TCCGAGTGTTCCACATGACG 89

c9467f ATCTCCGCAATGTCGTCCTC 90

c9467r AACGACCCGCTCATCTACTC 91

[0096] Toxicological studies of terpenes: Responses of Wt cells to exogenously added terpenes were tested using menthol, linalool, farnesol and caryophyllene. The lowest concentration that inhibited the growth of Wt cells (MICo) was determined by analyzing cell growth in Medium III (overnight at 30°C with shaking at 200 rpm). Yeast cells were inoculated at the density of - lOVml (1% of overnight cultures; OD₅₃₀ -0.1) in Medium III supplemented with one of the 4 compounds at various concentrations. Menthol, linalool and caryophyllene were added between 1000 mg L^"1 and 4 mg L^"1 while farnesol added ranged between 200 mg L^"1 and 3 mg L^"1. Cells were cultured at 30°C for 31 hours. Cell optical density (OD₅₃₀) at the different time points was determined with a Tecan infinite M200 microplate reader (Tecan, USA). All experiments were performed in triplicates.

[0097] To study the expression of terpene-responsive genes, Wt cells were cultured in 50 ml Medium III (initial OD₅₃₀ adjusted to 0.1) in 250 ml flasks, which were maintained at 30°C, 280 rpm for 1 day. Each terpene was added to MIC₀ level before the culture. Cells were sampled at 1, 5 and 24 hours after terpene supplementation and total RNA was extracted.

[0098] Gene deletion and over-expression: Several targets were subjected to gene deletion and over-expression by the homologous recombination (HR) strategy. After gene locations on Rtl genome (LNKUOl) were confirmed by blastn with shortlisted transcripts, the 5' and 3' flanking sequences (HI and H2 respectively, ~800bp) were amplified using Wt DNA extracted by Gentra Puregene Yeast/Bact. Kit (Qiagen). Oligonucleotides used were listed in Table 4. All DNA restriction and modification enzymes were sourced from New England Biolabs (NEB, USA). All the plasmid constructions were illustrated in Figures 9A-9C.

TABLE 4

Oligonucleotides used for gene knock-out and over-expression

Name Sequence (5' to 3') (without over-lap for Specificity

Gibson assembly) (SEQ ID NO:)

Gene deletion *

cl623 AGGGAC TC A AGC GGA AGC TC (92) HI forward primer

CTCGATCTCGCGAACGGCG (93) HI reverse primer

ATAACGCGAGAGCGGAAGGG (94) H2 forward primer

CTCGCCGATTTGCAAGCTGA (95) H2 reverse primer c459 AGCGGCAGAAGAGGGTTGTC (96) HI forward primer

GGCGACGAGCTTTTCGCATC (97) HI reverse primer

TGTCCTTCGTGCCGATCGTA (98) H2 forward primer

TCCAGCGAGGTTGCGAGAAT (99) H2 reverse primer

C10565 CAGCACAAATGGCTCAGGGG (100) HI forward primer

GAATGTCAAGGGGAGGGGGC (101) HI reverse primer

AGGA AGGGGA AGA AC GC AC G (102) H2 forward primer

TCCTGTTCTGGCGGGGATTC (103) H2 reverse primer c3369 TCAGCATTCGCCAGCTCTAC (104) HI forward primer

CGCCAGCTTGACCTTCTCAA (105) HI reverse primer

CCTTCGGCTCCTCATCCAAC (106) H2 forward primer

CGATGAGGCAATGAGGACGA (107) H2 reverse primer c8301 TCGATCGTCTCCTCGTCCAT (108) HI forward primer

GTAGAGACTCTTGCGAGCCC (109) HI reverse primer

GCCTCGACCCATTGCAAAAT (110) H2 forward primer

CCAGCCAATACTCCCCAGTC (111) H2 reverse primer c8162 AGA A A AGGAC GGTC AGC TC G (112) HI forward primer

GAGGATGAGTACAACGGCCC (113) HI reverse primer

ACGAGATCTTGACGGTGCAG (114) H2 forward primer

CTCCATAACCCTCAACCGCT (115) H2 reverse primer

Over-expression **

Kmo-F ATGTCCTCAGACGAGCGAA (116) forward primer

Kmo-br TCTGCAATAACGCCTCCTCG (117) Kmo-bf TCGATACGCTTGTCTGACCG (118)

Kmo-R GTCCACCCGCACGAGG (119) reverse primer

Notes:

* For gene deletion:

TTAACGCCGAATTGAATTCG (SEQ ID NO:120) was added to the 5' of each Hl forward primer;

GTATGCTATACGAACGGTAG (SEQ ID NO:121) was added to the 5' of each Hl reverse primer;

CAATCATGGCCTTAATTAAT (SEQ ID NO: 122) was added to the 5 ' of each H2 forward primer;

CTGTCAAACACTGATAGTTT (SEQ ID NO: 123) was added to the 5' of each H2 reverse primer.

** For gene over-expression:

AACAACACCAGATCACTCAC (SEQ ID NO: 124) was added to the 5' of each forward primer;

TCCCGGTCGGCATCTACGAT (SEQ ID NO: 125) was added to the 5' of each reverse primer.

[0099] pRH311 (Figure 9A) is a T-DNA vector backbone, pPZP200 derivative [105], consisting of a hygromycin resistant cassette (P¾G_PDI : :HPT-3 : :TSV₄O) [38]. The Hpt-3 cassette is flanked by loxP sits at both ends, allowing its deletion by Cre recombinase induced by estrogen. In order to ligate with HI and H2, pRH311 was firstly cut by BamHI, Xbal and Pmel, and a 4- fragment ligation (HI, Hpt-3 cassette, H2, T-DNA) was done by Gibson assembly kit (NEB, USA).

[00100] pKUl-SF (Figure 9B) allows efficient site-specific integration of Amorphadiene or Santalene producing cassettes, i.e. ADS or SaSSY (Seq ID. No.4, codon-optimized for expression in R. toruloides) cassette

Tnos) and MpFPPS cassette (Pi?iGPDi: :MpFPP: :T₃₅s), at the URA3 locus [36].

[0100] The starting yeast host was a Aku70 mutant of Wt, named RtlCK, with an improved gene deletion frequency by eliminating the non-homologous end-joining (NHEJ) pathway [36]. The KO plasmids (Figure 9A) were transformed into RtlCK by ATMT and the true mutants were validated by Southern blotting. After removal of hygromycin selection cassette by activating the Cre/loxP system and targeted insertion of a santalene tester cassette using pKUl- SF (Figure 9B), santalene production in knockout strains were compared to the RtlCK strain inserted the santalene tester cassette. The red yeasts (KO mutants and control) were cultured in 50 ml Medium III in flasks (30°C, 280 rpm) as before, and santalene was extracted by ethyl acetate and determined by GC-MS at day 3 of growth (refer to Methods - Extraction of terpene and GC-MS analysis). There independent experiments were performed in triplicates.

[0101] For over-expression of kynurenine 3-monooxygenase gene, pKC2-Kmo (Figure 9C) was constructed to efficiently integrate Kmo at the CAR2 locus [37]. Because the full-length of cDNA of Kmo is 1.9 kb, two pairs of primers were designed and iProof™ High-Fidelity PCR Kit (Bio-Rad) was used for high-fidelity amplification from cDNA of A29. The amplified 2 fragments of Kmo was assembled together with pKC2. The cl623 KO and KI strain was targeted inserted of pKC2-Kmo, and santalene production in over-expression strains were compared to the RtlCK strain inserted both pKUl- SF and pKC2.

[0102] GenBank accessions: This Transcriptome Shotgun Assembly project has been deposited at DDBJ/EMBL/GenBank under the accession GEEN00000000. The version described herein is the first version, GEENO 1000000.

EXAMPLE 2

R. toruloides Cell Growth During Amorphadiene Biosynthesis

[0103] To produce amorphadiene in R. toruloides, a codon-optimized amorphadiene synthase gene ADS from Artemisia annua [41] and a native FPPS [42] derived from a Methylobacterium populi L2-79 strain [43] were overexpressed using the native GPD1 promoter [38]. The dual- gene cassette was transformed to R. toruloides by Agrobacterium tumefaceins mediated transformation (ATMT) [38] and high producers of amorphadiene were selected by GC-MS quantification of metabolites produced in small scale cultures. Strain A29 was amongst the highest producers. Time course of culturing study showed that Wt strain steadily increased cell density for the first 4 days, from 0.1 to above -30 OD₆₀o units, and the density growth leveled off after day 4. Notably, A29 strain grew significantly slower than Wt from day 3 to day 5. This suggests that the amorphadiene produced was inhibitory to cell growth although the effect on amorphadiene biosynthesis was minimal under the condition tested (Fig. 1A). On day 5, the titer of amorphadiene reached approximately 80 mg L^"1 in shaking flask cultures without the use of solvent to the culture medium to capture amorphadiene produced. This level of production was much better than that achieved in S. cerevisiae if with a similar gene manipulation [1, 44]. These results confirmed that R. toruloides is a superior host for terpene production. However, this level remained low compared to recent S. cerevisiae strains that contain multiple genetic modifications in MVP [1, 45]. The inhibitory effect on amorphadiene on its own biosynthesis was more obvious when cells were cultured in higher density in bioreactors, where the production reached > 500 mg L^"1 at day 5 and ceased to increase thereafter (Fig. IB). To identify genes that may affect amorphadiene biosynthesis in vivo, RNA profiles of Wt and A29 strains were compared. EXAMPLE 3

Differentially Expressed Transcripts In Amorphadiene Biosynthetic Strain

[0104] De novo assembly of approximately 52 million RNA-seq reads generated approximately 14,050 'isoforms', which served as our transcriptome database. Overall, about 95% of raw reads could be mapped to the transcriptome database. Pairwise comparison between the amorphadiene biosynthetic strain A29 and Wt identified numerous differentially expressed (DE) transcripts, the number of which were higher on day 3 than in than 1 (Figure 2). When the log2 magnitude of changes in transcript abundance was set >2 and p value set at < 0.001, 159 DE transcripts were identified between Wt and A29: 37 on day 1 and 122 on day 3. In addition, 247 DE transcripts were found between dayl and day 3. The relative transcription levels of the DE transcripts are shown in Figure 3 and can be hierarchically clustered in 17 groups based on their expression patterns (Figures 10A-10Q). About 60% DE transcripts could be assigned with a biological function (Table 5). The top 52 DE transcripts between A29 and Wt are listed in Table 6.

TABLE 5

Functional Annotations of Cluster Transcripts

Transcript ID Annotation

Cluster 1

c3841_gl_i2 hypothetical protein

c5828_gl_i3 polyubiquitin

c9467_gl_il beta-lactamase

c7390_gl_il nucleotide -binding, alpha-beta plait domain containing protein

cl0334_gl_il Sokl protein homologue

c5828_gl_i2 polyubiquitin

c4859_gl_il major facilitator superfamily (MFS) multidrug transporter

c5479_gl_il secreted protein

c2369_gl_il fungal specific transcription factor / C6 transcription factor (Mut3)

Cluster 2

c3514_gl_i2 hypothetical protein

c6500_gl_il hypothetical protein

c3514_gl_il hypothetical protein

c5018_g2_il hypothetical protein

c5454_gl_il hypothetical protein

c5018_g2_i3 hypothetical protein

cl576 gl il phosphatidylserine decarboxylase Cluster 3

c4018_gl_il arylsulfotransferase

c3252_gl_i2 adenosine 3'-phospho 5'-phosphosulfate transporter 1

c5009_g2_il low affinity iron permease, Fet4

c503_gl_il velvet factor family protein

c3738_gl_il hypothetical protein

Cluster 4

c5268_gl_il phosphatidylethanolamine-binding protein PEBP

c239_gl_il hypothetical protein

c7356_gl_il Phox/Bemlp domain containing protein

c5325_gl_il Cys-rich family protein

c2819_gl_il conserved hypothetical protein

Cluster 5

c3460_gl_il phenylalanine ammonia-lyase

cl0239_gl_il hypothetical protein

c3224_gl_il hypothetical protein

c3483_gl_il conserved hypothetical protein

(R,R)-butanediol dehydrogenase / diacetyl reductase / L-iditol 2- cl603_gl_i2

dehydrogenase / xylitol dehydrogenase

c4369_gl_il hypothetical protein

c7223_gl_il MFS monosaccharide transporter

cl603_gl_il (R,R)-butanediol dehydrogenase / diacetyl reductase

short-chain dehydrogenase/reductase SDR family protein / D-arabinitol c9506_gl_il

dehydrogenase / L-xylulose reductase

acyl-CoA dehydrogenase / isovaleryl-CoA dehydrogenase /glutaryl-CoA c8788_gl_il dehydrogenase / fatty acid desaturase 2 (delta-6 desaturase) /nitrate reductase

(NADH) / cytochrome b5

c9044_gl_il zip -like iron-zinc transporter

c2826_gl_il NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 c688_gl_il hypothetical protein

Cluster 6

c4789_gl bZIP transcription factor

c5803_gl Fasciclin domain family protein

c3862_g2 U3 small nucleolar RNA-associated protein 6

c5345_gl conserved hypothetical protein

c3259_gl_il hypothetical protein

3-hydroxyacyl-CoA dehydrogenase / 3-hydroxy-2-methylbutyryl-CoA c8876_gl_il dehydrogenase / short-chain dehydrogenase/reductase SDR family protein /

D-arabinitol dehydrogenase

DNA/RNA helicase, DEAD/DEAH box type / pre-mRNA -splicing helicase c5609_gl_i2

BRR2 / ATP -dependent rna helicase dob 1 / antiviral helicase SKI2 c705_gl_il protein Rdsl (stress response protein)

cl0243_gl_il conserved hypothetical protein

c9007_gl_il alpha 1,2-mannosyltransferase, glycosyltransferase family 71 protein conserved hypothetical protein

hypothetical protein

Pall-related protein

hypothetical protein

transposon txl uncharacterized 149 kda / polynucleotide 3 '-phosphatase / bifunctional polynucleotide phosphatase/kinase

hypothetical protein

MFS multidrug transporter

hypothetical protein

MFS transporter / monooxygenase / salicylate hydroxylase / zeaxanthin epoxidase / cycloheximide resistance protein, Mfs transporter

Pall-related protein

DUF1264 domain protein

4-aminobutyrate aminotransferase / (S)-3-amino-2-methylpropionate transaminase / ornithine-oxo-acid transaminase / acetylornithine aminotransferase

amidohydrolase

Bestrophin/UPF0187 protein

conserved hypothetical protein

oxidoreductase, oxoglutarate/iron-dependent oxygenase family delayed-type hypersensitivity antigen - related

hypothetical protein

Bestrophin/UPF0187 protein

zinc finger, C2H5-type domain containing protein

hypothetical protein RTG 00088

Cluster 7

cl0393_gl hypothetical protein

cl074_gl Proteophosphoglycan ppg4

cl200_gl glutamate dehydrogenase (NAD+)

cl511_gl isocitrate lyase, mitochondrial

4-coumarate-CoA ligase / 5- / 6- / acetyl-CoA synthetase / AMP-dependent cl563_gl

synthetase and ligase / phenylacetyl-CoA ligase

cl615_gl UbiE/COQ5 family methyltransferase

cl619_gl 3- oxoacyl-[acyl-carrier protein] reductase

L-xylulose reductase / short-chain dehydrogenase/reductase SDR family cl619_g2 protein / 3-oxoacyl-(acyl-carrier-protein) reductase / multifunctional beta- oxidation protein / D-arabinitol dehydrogenase

cl772_gl hypothetical protein

cl955_gl soluble epoxide hydrolase

acyl-CoA dehydrogenase / isovaleryl-CoA dehydrogenase /glutaryl-CoA c213_gl_il

dehydrogenase

acyl-CoA dehydrogenase / glutaryl-CoA dehydrogenase / isovaleryl-CoA c213_gl_i2

dehydrogenase

c2209_gl_i] Mandelate racemase/muconate lactonizing enzyme

4- coumarate-CoA ligase / 5- / 6- / acetyl-CoA synthetase / AMP-dependent c2216_gl_i]

synthetase and ligase / phenylacetyl-CoA ligase c2399_gl_i2 conserved hypothetical protein

c2406_gl_i2 hypothetical protein

c2435_gl_il hypothetical protein

c2435_gl_i2 hypothetical protein

c2504_gl_il peripilin-like protein

c3040_gl_il acyl-CoA dehydrogenase

acyl-CoA dehydrogenase / fatty acid desaturase 2 (delta-6 desaturase) / L- c3040_g2_il

lactate dehydrogenase (cytochrome)

4-coumarate-CoA ligase / 5- / 6- / acetyl-CoA synthetase / AMP-dependent c3124_gl_il

synthetase and ligase / phenylacetyl-CoA ligase

c3351_gl_il cytosolic Fe-S cluster assembling factor CFD1

c3351_gl_i2 conserved hypothetical protein

c3351_gl_i2 cytosolic Fe-S cluster assembling factor CFD1 / NBP35

c3351_gl_i3 conserved hypothetical protein

c3503_gl_il hypothetical protein

c3670_gl_i2 integral membrane protein, glucose receptor Git3

c378_gl_il hypothetical protein

c383_gl_il 60S ribosomal protein L28

c383_gl_i2 60S ribosomal protein L28

c3886_gl_il hypothetical protein

MFS glucose transporter / MFS maltose transporter / MFS transporter, SP c3899_gl_il

family, arabinose:H+ symporter / MFS transporter, quinate permease c3956_gl_il mitochondrial carrier protein, tricarboxylate carrier

c4011_g2_il hypothetical protein

c4228_g2_il von Willebrand domain containing protein

3-ketoacyl-CoA thiolase, mitochondrial / peroxisomal 3-ketoacyl-coA c4275_gl_il

thiolase / 3-ketoacyl-CoA thiolase (POT1) / acetyl-CoA C-acetyltransferase c4368_g2_il MFS sugar transporter

c4368_g3_il MFS sugar transporter

MFS allantoate transporter / high-affinity MFS nicotinic acid transporter / c4601_gl_il

MFS pantothenate transporter

MFS transporter / MFS nicotinic acid transporter / MFS transporter, c4601_gl_i2

allantoate permease / MFS transporter, pantothenate transporter

MFS transporter / MFS nicotinic acid transporter / MFS transporter, c4601_gl_i4

allantoate permease / MFS transporter, pantothenate transporter

c4685_gl_il 1 -aminocyclopropane - 1 -carboxylate synthase

carbohydrate -binding domain family 9-like / cytochrome b561/ferric c495_gl_il

reductase transmembrane domain protein

carbohydrate -binding domain family 9-like / cytochrome b561/ferric c495_gl_i2

reductase transmembrane domain protein

3-methylcrotonyl-CoA carboxylase alpha subunit / carbamoyl-phosphate c5298_gl_il synthase / aspartate carbamoyltransferase / pyruvate carboxylase / urea

carboxylase / allophanate hydrolase

urea carboxylase / allophanate hydrolase / 3-methylcrotonyl-CoA carboxylase c5298_gl_i2 alpha subunit / pyruvate carboxylase /carbamoyl-phosphate synthase /

aspartate carbamoyltransferase MFS phosphate transporter, glycerophosphoinositol and c5596_gl_il

glycerophosphocholine uptake / PHS family, inorganic phosphate transporter c5642_gl_il snl -specific diacylglycerol lipase alpha

c571_gl_il class II aldolase/adducin domain containing protein

F-box and leucine-rich repeat protein 7, Substrate recognition component of a SCF (SKPl-CULl -F-box protein) E3 ubiquitin-protein ligase complex which c5717_gl_il

mediates the ubiquitination and subsequent proteasomal degradation of AURKA during mitosis, causing mitotic arrest

c5717_gl_i2 F-box and leucine-rich repeat protein 7

c575_gl_il 3-hydroxyacyl-CoA dehyrogenase / 3-hydroxybutyryl-CoA dehydrogenase aldehyde dehydrogenase / methylmalonate-semialdehyde dehydrogenase / c581_gl_il

succinate-semialdehyde dehydrogenase (NADP+)

methylmalonate-semialdehyde dehydrogenase / aldehyde dehydrogenase / c581_g2_il

succinate-semialdehyde dehydrogenase (NADP+)

c6011_gl 3- (3-hydroxy-phenyl)propionate hydroxylase / phenol 2-monooxygenase c6305_g4 reverse transcriptase

c6305_g5 reverse transcriptase

c6419_g2 hypothetical protein

4- coumarate-CoA ligase / 5- / 6- / acetyl-CoA synthetase / AMP-dependent c6497_gl

synthetase and ligase / phenylacetyl-CoA ligase

c6661_gl hypothetical protein

c720_gl_i] priA protein / tenascin XB

c7250_gl Proteophosphoglycan ppg4

c7579_gl uracil phosphoribosyltransferase

c8018_gl protein of Allergen V5/Tpx-1 -related family

siderophore iron transporter mirC / MFS transporter, drug:H+ antiporter / c829_gl_i]

MFS transporter, siderophore-iron:H+ symporter

c8354_gl hypothetical protein

c8789_gl acyl-CoA oxidase

c8830_gl COMPASS (Complex proteins associated with Setlp) component shgl short-chain dehydrogenase/reductase SDR family protein / 3-alpha(or 20- beta)-hydroxysteroid dehydrogenase / 3-oxoacyl-(acyl-carrier-protein) c8855_gl

reductase / D-arabinitol dehydrogenase / gluconate 5 -dehydrogenase / L- xylulose reductase / tropine dehydrogenase

c9064_gl beta-lactamase

c9091_gl conserved hypothetical protein

c9736_gl Yippee-like protein

c987_gl_il protein of unknown function DUF1772

Cluster 8

c219_gl_il NmrA-like domain containing protein

c2405_gl_il major facilitator superfamily (MFS) protein

c3073_gl_i2 MFS multidrug transporter

c3389_gl_il S2P endopeptidase

c3678_gl_il alpha 1,2-mannosyltransferase, glycosyltransferase family 71 protein c3727_gl_il glycosyltransferase family 49 protein c3727_gl_ glycosyltransferase family 49 protein

c3895_gl_ ll capsular associated protein, glycosyltransferase family 90 protein c4066_gl_ ll transcription initiation factor TFIIF subunit alpha

c4352_gl_ ll ATP-binding cassette

_C4474_^gl_ ll fungal specific transcription factor

_C4474_^gl_ i2 fungal specific transcription factor

c4475_gl_ i2 velvet factor family protein

c4639_gl_ ll protein kinase

c4793_gl_ ll beta-glucosidase, glycoside hydrolase family 3 protein c4859_gl_ i2 MFS multidrug transporter

c4911_g2_ ll ATP-dependent rna helicase dhx8

c4962_gl_ ll conserved hypothetical protein

c4969_gl_ ll CXCXC repeat-containing protein

c4969_gl_ i3 CXCXC repeat-containing protein

c5238_gl_ ll hypothetical protein

c5238_gl_ i2 hypothetical protein

c5263_gl_ i2 BTB/POZ-like domain containing protein

c5590_gl_ ll hypothetical protein

c5609_gl_ i3 DNA/R A helicase, DEAD/DEAH box type

c5757_gl_ ll hypothetical protein

c5757_gl_ i2 hypothetical protein

c583_gl_il hypothetical protein

c5938_gl_ ll Major Facilitator Superfamily protein

c5938_gl_ i2 Major Facilitator Superfamily protein

c5938_gl_ i3 Major Facilitator Superfamily protein

c6007_gl_ ll MFS efflux transporter

c6142_gl_ ll carboxymethylenebutenolidase

c6318_gl_ ll L-pipecolate oxidase

c6509_gl_ ll amino acid transmembrane transporter

c704_gl_i] high-affinity nicotinic acid transporter

c7313_gl_ ll glycosyltransferase family 31 protein

c7397_gl_ ll NCS1 allantoate transporter

c7560_gl_ ll urea transporter

c833_gl_il PAK-box/P21-Rho-binding domain containing protein c83_gl_il ABC bile acid transporter

c83_gl_i2 ABC bile acid transporter

c8456_gl_ ll cyclin-like F-box domain containing protein

c8495_gl_ ll hypothetical protein

c8833_gl_ ll methyltransferase type 11

c9977_gl_ ll hypothetical protein

Cluster 9

cl0252_gl _il hypothetical protein

cl0686_gl _il fungal specific transcription factor

cl078_gl_ ll cyclin-like F-box domain containing protein cl078_gl_i2 cyclin-like F-box domain containing protein cl l25_gl_il hypothetical protein

cl351_gl_i2 carotenoid cleavage dioxygenase

c2204_gl_il short-chain dehydrogenase/reductase SDR family protein c2204_gl_i2 short-chain dehydrogenase/reductase SDR family protein c226_gl_il hypothetical protein

c2465_gl_il Immunoglobulin4ike domain contaning protein

c2465_gl_i2 Immunoglobulin4ike domain contaning protein

c2465_gl_i3 Immunoglobulin4ike domain contaning protein

c2555_gl_il NAD(P)-binding protein

c2745_gl_il hypothetical protein

c2745_gl_i2 hypothetical protein

c27_gl_il long-chain acyl-CoA synthetase, putative

c282_gl_il Glutathione S-transferase, N-terminal

c3545_gl_il Blue (type 1) copper domain containing protein

c3670_gl_il integral membrane protein, glucose receptor Git3

c3901_gl_il beta-Ig-H3/Fasciclin

c4053_gl_il monooxygenase

c4053_gl_i2 monooxygenase

c4080_gl_il glucose-methanol-choline (gmc) oxidoreductase

c4080_gl_i3 glucose-methanol-choline (gmc) oxidoreductase

c4080_gl_i4 glucose-methanol-choline (gmc) oxidoreductase

c4163_gl_il lipase esterase protein

c4269_g2_il zinc finger, C2H2-type domain containing protein c4369_gl_i3 hypothetical protein

c4369_gl_i4 hypothetical protein

c4369_gl_i5 hypothetical protein

c4642_gl_il 5-oxoprolinase

c4643_gl_il MFS transporter, SHS family, lactate transporter

c4643_gl_i2 MFS transporter, SHS family, lactate transporter

c4786_gl_il acyl-CoA oxidase

c4937_gl_i3 long-chain acyl-CoA synthetase, putative

c5018_g2_i2 hypothetical protein

c5178_gl_il heat shock protein 30

c5197_gl_il oxidoreductase,Oxoglutarate/iron-dependent oxygenase family c5247_gl_i2 hypothetical protein

c5332_gl_il alcohol dehydrogenase

c5407_gl_i3 hypothetical protein

c5451_g2_il 3-ketoacyl-CoA thiolase, mitochondrial

c5455_gl_il nitrosoguanidine resistance protein

c5757_gl_i3 hypothetical protein

c5805_gl_il peroxisomal 3,2-trans-enoyl-CoA isomerase

c6387_g2_il l reverse transcriptase

c6547_gl_il oxoglutarate/iron-dependent oxygenase

c6566_gl_il aryl-alcohol oxidase; vanillyl-alcohol oxidase c6571_gl il aryl-alcohol oxidase; vanillyl-alcohol oxidase

c71_gl_il sodium/potassium-transporting ATPase subunit alpha

c7256_gl_ il glyoxylate reductase

c727_gl_il short-chain dehydrogenase/reductase SDR family protein

c7474_gl il hypothetical protein

c7647_gl il hypothetical protein

c8046_gl il taurine dioxygenase

c8338_gl_ il Amid-like NADH oxidoreductase

c8802_gl_ il cytochrome P450

c9024_gl_ il conserved hypothetical protein

c9048_gl il MFS transporter

c9063_gl il Amid-like NADH oxidoreductase

c9638_gl il 5-oxoprolinase

c9786_gl il multifunctional beta-oxidation protein

c9869_gl il hypothetical protein

Cluster 10

c6066_gl il high-affinity nickel-transporter

c6530_gl il purine nucleoside permease

cl912_gl il ammonium transmembrane transporter

c8141_gl il hypothetical protein

c7504_gl_ il glutamate dehydrogenase (NADP+)

cl222_gl_ il protein of unknown function DUF3602

regulator of chromosome condensation (RCCl)-like protein, adenylylsulfate c5256_gl_ il

kinase

Cluster 11

cl l42_gl il CsbD-like family protein

cl278_gl_ il serine/threonine protein kinase

c2505_gl_ il WSC and DUF1996 domain containing protein

c2524_gl_ il expansin family protein

c2827_gl_ il hypothetical protein

c2841_gl il cytochrome P450, family 4, subfamily F (leukotriene-B4 20-monooxygenase) c3985_gl_ il Glycosyl transferase, family 2

c4158_gl _i2 neutral amino acid permease

c422_gl_il alcohol dehydrogenase

c4463_gl il MFS monosaccharide transporter

c5085_gl il expansin family protein

c5264_gl _i2 putative G-protein coupled receptor

c6109_g2 _i4 histone H3

c7246_gl_ il C-4 methylsterol oxidase

c7315_gl_ il aspartic-type endopeptidase

c755_gl_il Kelch-type beta propeller domain containing protein

c8072_gl_ il actin

c863_gl_il MSF transporter

c9021_gl il glycoside hydrolase family 16 protein c9183_gl_il expansin family protein

Cluster 12

c7361_gl il Conserved hypothetical protein, HtrL

MFS transporter, siderophore-iron:H+ symporter / siderophore iron cl248_gl il

transporter mirC

replication-associated protein A, partial [Escherichia coli PA28] / Similar to c8933_gl_ il

Minor spike protein H; acc. no. P03646 [Pyronema omphalodes CBS 100304]

Cluster 13

cl067_gl il chitin deacetylase, carbohydrate esterase family 4 protein

cl084_gl il macrofage activating glycoprotein

c2016_gl il hypothetical protein

c4181_gl il hypothetical protein

c4204_gl_ il casein kinase II subunit alpha

c4204_gl_ _i2 casein kinase II subunit alpha

c4204_gl_ casein kinase II subunit alpha

c4204_gl_ _i4 casein kinase II subunit alpha

c4204_gl_ _i5 casein kinase II subunit alpha

c4204_gl_ _i6 casein kinase II subunit alpha

c5115_gl il hypothetical protein

c528_gl_i 1 conserved hypothetical protein

_C5444_^gl il fungal specific transcription factor

c5592_gl_ _i5 conserved hypothetical protein

c6145_gl il zinc finger, C2H2-type domain containing protein

c6568_gl il hypothetical protein

c8135_gl il BTB/POZ-like domain containing protein

PLC-like phosphodiesterase, TIM beta/alpha-barrel domain containing c821_gl_i 1

protein

c8856_gl il Domain of unknown function DUF2235

c915_gl_i 1 ferric -chelate reductase

c3654_gl il hypothetical protein RTG 01239

c3654_gl _i2 hypothetical protein RTG 01239

Cluster 14

cl l43_gl il hypothetical protein

cl l43_gl _i2 hypothetical protein

c4387_gl_ il uracil-DNA glycosylase-like

c4893_gl il Smad nuclear interacting protein 1

c498_gl_i 1 hypothetical protein

c5432_gl_ il hypothetical protein

c6055_gl _i2 geranylgeranyl pyrophosphate synthase [Methylobacterium extorquens] c6055_gl _i5 geranylgeranyl pyrophosphate synthase [Methylobacterium extorquens] c6055_g3_ il amorpha-4, l l-diene synthase [synthetic construct]

c9126_gl il putative uncharacterized protein CLP1 Cluster 15

cl623_gl il kynurenine 3-monooxygenase

cl930_gl il Extracellular membrane protein, CFEM domain, fungi protein

c2947_gl il priA protein / tenascin XB

c3369_gl _i4 NAD dependent oxidoreductase

c4469_gl il hypothetical protein

c4469_gl _i2 hypothetical protein

c4469_gl β hypothetical protein

MFS transporter, siderochrome-iron transporter / siderophore iron transporter c459_gl_i 1

mirC

c5080_g2_ il hypothetical protein

c5369_gl β DNA replication complex GINS, subunit Psf3

c5980_gl il hypothetical protein RTG 00107

Ca2+-transporting ATPase / Cu2+-exporting ATPase / phospholipid- c6076_gl il translocating ATPase / plasma membrane H+-transporting ATPase /

sodium/potassium-transporting ATPase subunit alpha

c663_gl i 1 hypothetical protein

c663_gl_i2 hypothetical protein

resolvase [Xanthomonas axonopodis] / putative resolvase [Pseudomonas c6777_gl il aeruginosa] / MULTISPECIES: excisionase family DNA binding domain- containing protein [Pseudomonas]

modified hygromycin phosphotransferase [Binary vector pZH2Bik] / HygR c7054_gl il [Cloning vector pPLV03] / synthetic hygromycin resistance protein

[Luciferase reporter vector pGL4.14[luc2/Hygro]]

c7408_gl il putative Glycerol-3 -phosphate dehydrogenase

aldehyde reductase / aldo/keto reductase / conjugated polyketone reductase c7986_gl il CI / indole-3-acetaldehyde reductase (NADPH) / pyridoxal 4-dehydrogenase

/ xylose and arabinose reductase

c8745_gl il cation binding protein

c944_gl_il phosphatidylethanolamine-binding protein PEBP

glyoxylate pathway regulator / GPRl/FUN34/YaaH-class plasma membrane c9624_gl il

protein

Cluster 16

c4682_gl il conserved hypothetical protein

c4682_gl _i2 conserved hypothetical protein

c4682_gl β conserved hypothetical protein

c6279_gl β cohesin loading factor subunit SCC2

c8012_gl il myosin heavy chain / chitin synthase, glycosyltransferase family 2 protein c6562_gl il glycosyltransferase family 64 protein [Mixia osmundae IAM 14324]

Cluster 17

mnng and nitrosoguanidine resistance protein / response to drug-related cl0565_gl_il protein / endoplasmic reticulum protein [Cryptococcus neoformans var. grubii

H99]

cl39_gl_il capsular related protein, Esterase, SGNH hydrolase-type domain containing

1734 1 il aspartic-type endopeptidase / e chain the active site of aspartic proteinases /

- pepsinogen A2 precursor / peptidase Al family protein / saccharopepsin cl930_gl Extracellular membrane protein, CFEM domain, fungi protein c2977_gl ribonuclease T2

c3019_gl hypothetical protein

c3019_g2 hypothetical protein

c3449_gl hypothetical protein

c3449_gl hypothetical protein

c3584_gl LigA

c3831_gl conserved hypothetical protein

c4046_gl Salivary gland secretion 1

c4236_gl TBC domain protein, Rab GTPase activator

c4236_gl TBC domain protein, Rab GTPase activator

c4236_gl TBC domain protein, Rab GTPase activator

c4276_gl 60S ribosome subunit biogenesis protein NIP7

c4564_gl RTA-like protein

c4760_gl glycoside hydrolase family 16 protein

c5319_gl hypothetical protein

GATA transcription factor / PAS domain containing protein kinase / c6027_gl potassium voltage-gated channel Eag-related subfamily H member 3 / white collar 1 protein

DASH complex, subunit Daml / GATA transcription factor / PAS domain c6027_gl containing protein kinase / potassium voltage-gated channel Eag-related

subfamily H member 3 / 8 / white collar 1 protein

c8673_gl hypothetical protein

c8696_gl hypothetical protein

cellulose-binding GDSL lipase/acylhydrolase, carbohydrate Esterase Family 16 protein / GDSL family lipase, carbohydrate esterase family 16 protein / c8954_gl

Lipase, GDSL domain containing protein, carbohydrate Esterase Family 16 protein

c9548_gl hypothetical protein

TABLE 6

Functional Classification and Transcriptional Levels of DE Transcripts

Transcript ID Annotations" (SEQ ID NO:) logFC(dl)^d logFC(d3)^d Functions^c

Introduced genes

amorphadiene synthase [synthetic Amorphadiene c6055_g3_il^e 11.88 14.20

construct] synthesis[41] farnesyl-diphosphate synthase

c6055_gl_i2^f [Methylobacterium populi BJ001] 8.95 12.13 FPP synthesis [42]

(132)

modified hygromycin

c7054_gl_il⁸ 8.99 9.35 hygromycin resistance [46] phosphotransferase

Stress responses

c7986_gl_il aldo/keto reductase - 4.89 stress response [47] Stress/mutagen resistance cl0565_gl_il response to drug-related protein (8) - 3.95

[48]

response to heat shock / c2977_gl_il ribonuclease T2 (133) - 3.82 oxidative / osmotic stress

[49-51]

glycerol-3 -phosphate lipid biosynthesis [52], c7408_gl_il 4.02 3.29

dehydrogenase response to stresses [53, 54] resistance to toxic c4564_gl_il RTA-like protein (134) - 3.24

substances [55, 56] regulation of cell growth / cl734_gl_il aspartic-type endopeptidase 2.08 2.88 homeostasis during

apoptosis [57-59] c5778_gl_il Proteophosphoglycan ppg4 - 3.11 unknown

DNA replication/repair

c4387_gl_il uracil-DNA glycosylase-like protein 5.65 5.94 DNA repair [60] c6777_gl_il repair of DNA double- resolvase / excisionase - 9.21

**** stranded breaks [61-64]

DNA replication complex GINS

c5369_gl_i3 - 4.15 DNA replication [65, 66] protein Psf3

c2947_gl_il priA protein - 4.13 DNA repair [67-69]

Ribosome biosynthesis/processing

mRNA 3 '-end

processing/maturation and c9126_gl_il uncharacterized protein CLP1 8.76 8.57 re-initiation/termination of mRNA transcription [70, 71]

34S pre-rRNA processing

60S ribosome subunit biogenesis

c4276_gl_i4 - 4.34 and 60S ribosome subunit protein NIP7

assembly [72]

Metabolic enzymes

salivary gland secretion 1 / GDSL

carbohydrate modification c8954_gl_il family lipase, carbohydrate esterase - 4.96

[73, 74]

family 16 protein

salivary gland secretion 1 carbohydrate modification c4046_gl_il - 3.99

[73, 74]

tryptophan metabolism / cl623_gl_il kynurenine 3-monooxygenase (6) - 3.81

degradation [75] c4760_gl_il glycoside hydrolase family 16 - 3.74 β-glucan (cell wall) protein (144) degradation [76] c3369_gl_i4 NAD dependent oxidoreductase (7) - 3.72 redox reactions

Cell capsule/wall/membrane proteins and transporters

MFS transporter, siderochrome-iron import or export of iron or c459_gl_il - 3.61

transporter mirC other target substrates [77]

MFS transporter, siderophore- import or export of iron or cl248_gl_il iron:H+ symporter / siderophore - 5.26

other target substrates [77] iron transporter mirC (135)

Cas3p / capsular related protein,

polysaccharide capsule cl39_gl_il Esterase, SGNH hydrolase -type - 3.35

assembly [78] domain containing

Regulators and signaling systems

regulation of gene c4893_gl smad nuclear interacting protein 1 11.41 9.25

expression [79] extracellular membrane protein cell-surface receptors for cl930_gl_il,

(145), CFEM domain, fungi protein - 7.89 signal transducers or cl930_gl_i2

(146) adhesion [80]

Sensing light, oxygen and c6027_gl_il, potassium voltage-gated channel

- 3.99 stress stimuli and regulation c6027_gl_i2 Eag-related subfamily H member 3

of gene expression [81-85] lipid binding / signal phosphatidylethanolamine-binding

c944_gl_il - 3.70 transduction in MAPK protein PEBP

pathway [86]

c4236_gl_i2, Tre-2, BUB2p, and Cdcl6p (TBC)

c4236_gl_i3, domain protein, Rab GTPase - 3.45 cytokinesis [87-89] c4236_gl_i4 activator

acetate transporter [90] or sensor [91], indirectly c9624_gl_il glyoxylate pathway regulator - 3.19

involved in repression of glyoxylate pathway [91] unknown

c7361_gl proteophosphoglycan 5 (147) - 5.59 Unknown [92] c8745_gl proteophosphoglycan 5 (148) - 4.03 Unknown [92]

Transcriptional factors

fungal specific transcription factor /

c2369_gl_il -6.20 -4.82 gene transcription

C6 transcription factor (Mut3) (142)

c503_gl_il velvet factor family protein (143) -6.41 -6.25 gene transcription

Metabolic enzymes c7313_gl_il glycosyltransferase4ike protein -4.79 -4.25 protein glycosylation

glycine, serine and threonine and

cl576_gl_il phosphatidylserine decarboxylase -3.64 -5.01

glycerophospholipid metabolism

c4018_gl_il arylsulfotransferase -8.60 -3.75 sulfur metabolism c9467_gl_il beta-lactamase -5.26 -3.84 antibiotic resistance

Cell capsule/wall/membrane proteins and transporters

Cell wall surface anchor family

c5454_gl_il -3.00 -5.38 Cell wall surface anchor protein

low affinity iron transporter, Fet4

c5009_g2_il -5.65 -4.22 iron homeostasis

(141)

adenosine 3'-phospho 5'- transport and synthesis of c3252_gl_i2 -5.78 -7.04

phosphosulfate transporter 1 PAPS; signal transduction c3073_gl_i2 MFS multidrug transporter (136) -3.94 detoxification

c4859_gl_il MFS multidrug transporter (137) -8.39 detoxification

nucleobase cation c7397_gl_il NCS1 allantoate transporter (138) -3.68

symporter

c5938_gl_il,

MFS protein (139; 140) -3.92 detoxification

c5938_gl_i2

Unknown

c5018_g2_il, proteophosphoglycan ppg4 (149,

-5.96 -5.22 Unknown [92] c5018_g2_i3 150)

Notes:

a Transcript ID was assigned by Trinity, in which c, g and i represents cluster, gene and isoform respectively.

Annotation was done by BLASTx search against NCBI nr and R. toruloides protein databases. ^c Functions reported in literature.

d logFC(dl or d3): log₂(fold change of transcript/gene expressed of A29 vs Wt on day 1 or day 3). FC values are the trimmed mean of M-values (TMM), not the simple ratio of FPKM of transcript expressed between each pair of samples [93].

[0105] As expected, transcripts encoding ADS and FPPS, hygromycin phosphotransferase (HPT) were abundant and stable from day 1 to day 3. Cre-ER (c4412_gl_i l) transcript level was low (not shown). A large fraction of the induced transcripts relate to stress responses (Table 6). For example, c7986_gl_il (aldo/keto reductase), c2977_gl_il (ribonuclease T2) and cl734_gl_il(aspartic-type endopeptidase) appeared to be related to acid or oxidative stress. cl0565_gl_il (drug/mutagen-responsive protein) and c4564_gl_il (RTA-like protein) may be related to responses to toxic compounds. c7408_gl_il encodes putative glycerol-3 -phosphate dehydrogenase which was reported to be involved in osmoadaptation and redox regulation in S. cerevisiae [53, 54]. Notably, two transcripts (c459_gl_il and cl248_gl_il) encoding MFS transporters were significantly induced on day 3, but not on day 1. The two mRNAs are likely to encode efflux transporters for terpenes, which might be required for cellular detoxification when amorphadiene level was high on day 3. Three sensor/transporters (c9624_gl_il, c6027_gl_il/c6027_gl_i2, cl930_gl_il/cl930_gl _i2) showed similar pattern of induction to the MFS transporters. Meanwhile, cl623_gl_il (kynurenine 3-monooxygenase) and c3369_gl_i4 (NAD dependent oxidoreductase) encoding P450 family cytochrome oxidases may directly degrade intermediates or end production of amorphadiene synthesis. An unexpected group of induced transcripts were predicted to encode enzymes involved in DNA replication and repair, such as uracil-DNA glycosylase (c4387_gl_il), DNA replication complex GINS protein Psf3 (c5369_gl_i3) and bacteria priA-like protein (c2947_gl_il). Amorphadiene production appeared to affect cytokinesis as homologs of CDC16 (c4236_gl) and putative beta-glucanase (c4760_gl_il) were significantly induced on day 3. Other genes up-regulated appeared to be involved in ribosome biogenesis (c4276_gl_i4), mRNA transcription and RNA processing (c9126_gl_il).

[0106] Amongst the 12 most severely repressed transcripts, 6 (50%) encode transporters and 2 (c2369_gl_il , and c503_gl_il) encode transcriptional factors. It remains to be proved if the two transcriptional factors are related to the expression of some of the DE transcripts. A puzzling group of genes encode protein related proteophosphoglycan, mucin-like glycoprotein found on the surface of protozoa Leishmania major [92]: two (c7361_gl and c8745_gl) were induced and one (c5018_g2_il/c5018_g2_i3) was repressed in A29.

EXAMPLE 4

Expression of Genes in Mevalonate Pathway

[0107] Since fungi utilize mevalonate pathway (MVP) for isoprenoid biosynthesis, putative homologs of S. cerevisiae ERG JO, ERG13, HMG1, ERG12, ERG8, MVD1, IDI1, ERG20, ERG9, and BTS1 mRNAs were identified for R. toruloides. Typically, those sequences share > 90% identity to R toruloides reference in NCBI database and > 30% identity to S. cerevisiae counterparts at the protein level. None of the MVP genes were significantly altered in transcription level in A29 strain (Figure 4; Table 7). Transcripts encoding phosphatidic acid (PA) phosphatase, ie, Lppl and Dppl, which catalyze the hydrolysis of isoprenoid-phosphate and isoprenoid-pyrophosphate in S. cerevisiae [94], were also identified. One of them (c8301_gl_il) was weakly up-regulated (by 1.69 folds; p value<0.05) on day 3 (Figures 11A- 11W). These results suggest amorphadiene production at about 80 mg L^"1 didn't significantly perturb the upstream pathway for isoprenoid biosynthesis.

TABLE 7

Transcripts involved in isoprenoid biosynthesis pathway extracted by BLASTx against a small protein database with selected functional proteins from S. cerevisiae and R toruloides, and their expression levels extracted from the edgeR results. data extracted from 'A29_Trinity_trans. counts. matrix. TMM normalized.FPKM'

A29-ld A29-3d WT-ld WT-3d

c3220_gl_il 421.67 397.3 369.4 209.22

c5041_gl_il 55.9 22.87 61.3 24.34

c5041_gl_i2 123.94 24.34 135.36 19.88

c8151_gl_il 20.3 10.45 24.16 17.75

c3068_gl_il 89.67 40.96 77.81 42.93

c3037_gl_il 36.38 15.51 32.21 21.88

c3723_gl_il 69.27 26.67 62.36 31.5

c6816_gl_il 91.57 157.25 95.61 65.95

c6277_gl_il 261.17 78.93 190.45 44.05

c4086_gl_il 23.73 22.88 27.24 23.18

c3281_gl_il 55 30.37 52.67 45.39

c3885_gl_il 68.57 57.43 75.59 40.41

c4190_gl_il 32.9 24.08 30.07 30.52

c4374_gl_il 37.21 14.68 35.96 17.23

c6138_gl_il 0.64 1.95 2.22 2.98

c6138_gl_i2 0.25 7.85 1.95 4.31

c6138_gl_i3 1.34 5.42 2.32 5.99

c6456_gl_il 36.55 23.94 36.62 15.47

c8162_gl_il 31.43 14.42 29.47 17.12

c8301_gl_il 42 61.06 24.91 18.53

data extracted from 'A29_Trinity_trans. counts. matrix. A29-ld_vs_WT-ld.edgeR.DE_results' logFC logCPM p-Value c3220_ _gi. _il 0.190917974 9.142141459 0.771094128 c5041 _gi. _il -0.133008945 7.590798709 0.841121121 c5041 _gi. J2 -0.127147762 7.774980356 0.847819942 c8151 _gi. _il -0.250736259 6.588227173 0.705282596 c3068 _gi. _il 0.204697329 7.785516846 0.756499713 c3037_ _gi. _il 0.175868226 6.362634046 0.79505428 c3723_ _gi. _il 0.151599305 6.481015361 0.824755574 c6816 _gi. _il -0.062292545 6.48252446 0.928095827 c6277_ _gi. _il 0.455551584 8.096071169 0.488887393 c4086 _gi. _il -0.199357331 6.982233457 0.766041829 c3281 _gi. _il 0.062472387 6.511714876 0.929531995 c3885 _gi. _il -0.140723697 7.379615512 0.832512391 c4190 _gi. _il 0.129620389 6.403975828 0.848779345 c4374_ _gi. _il 0.049510727 5.748872509 0.946456373 c6138 _gi. _il -1.680878683 -0.283219763 0.430641822 c6138 _gi. J2 -2.824585183 0.345806888 0.08447205 c6138 _gi. J3 -0.77438825 0.546630323 0.633150092 c6456 _gi. _il -0.002911557 5.69446525 1 c8162 _gi. _il 0.092795618 5.023035883 0.892585348 c8301 _gi. _il 0.753160735 5.314873711 0.266200783

data extracted from 'A29_Trinity trans. counts. matrix. A29-3d_vs d.edgeR.DE results'

logFC logCPM p-Value FDR c3220_gl_i l 0.895492388 8.980195882 0.174858964 0.91884472 c5041_gl_il -0.119139314 6.509493179 0.862152561 1 c5041_gl_i2 0.262088577 5.456017364 0.699421021 1 c8151_gl_il -0.793023192 6.167243167 0.238576604 1 c3068_gl_i l -0.097315378 7.01692888 0.884787975 1 c3037_gl_i l -0.525876255 5.723552048 0.438424992 1 c3723_gl_i l -0.269557286 5.538181698 0.687970335 1 c6816_gl_il 1.223573259 6.95150487 0.067358505 0.604949383 c6277_gl_il 0.8114807 6.44270998 0.22377323 1 c4086_gl_i l -0.048274928 7.062156298 0.942804753 1 c3281_gl_i l -0.60934969 6.238310246 0.364282889 1 c3885_gl_i l 0.47746382 7.043680283 0.470949702 1 c4190_gl_il -0.371634692 6.428098534 0.576871494 1 c4374_gl_il -0.260523754 4.791920621 0.710354317 1 c6138_gl_i l -0.622864785 0.367532532 0.79990005 1 c6138_gl_i2 0.832861796 2.549239977 0.293827715 1 c6138_gl_i3 -0.171 129555 2.1 17331453 0.931075375 1 c6456_gl_i l 0.599583832 5.0251 1037 0.378998124 1 c8162_gl_il -0.277515685 4.316703892 0.696787698 1 c8301_gl_il 1.690004219 5.772471963 0.013711861 0.24171472 c3220 ERG10 (3-hydroxy-3-methyl-glutaryl-CoA reductase)

c5041 ERG13 (hydroxymethylglutaryl-CoA synthase)

c5041 ERG13 (hydroxymethylglutaryl-CoA synthase)

c8151 HMG1 (hydroxymethylglutaryl-CoA reducase)

c3068 _gi. il = ERG12 (mevalonate kinase)

c3037^~ _gi. ^"il = ERG8 (phosphomevalonate kinase)

c3723^~ _gi. ^"il = MVDl (diphosphomevalonate kinase)

c6816^~ _gi. ^"il = IDIl (isopentenyl -diphosphate isomerase)

c6277^~ _gi. ^"il = ERG20 (farnesyl-diphosphate synthase)

c4086^~ _gi_ ^"i l = ERG9 (Squalene synthase)

c3281^~ _gi_ il = BTS1 1 (farnesyl-diphosphate synthase, bacterial type) c3885^~ _gi_ il = LPP1 type 2/haloperoxidase3 phosphatide

c4190^~ _gi_ il = LPP 1 lysophosphatidic

c4374^~ _gi_ il = LPP1 type 2/haloperoxidase3 phosphatide

c6138^~ _gi_ il = LPPl_type_2_beta|type

c6138^~ _gi_ i2 = LPP1 type 2/haloperoxidase2 phosphatide

c6138^~ _gi_ i3 = LPPl_type_2_beta|type

c6456^~ _gi_ il = LPP 1 lysophosphatidic

c8162^~ _gi. i l = DPPl (bifunctional haloperoxidase/phosphatidic acid phosphatase c830l^" _gi. il = LPP1 type 2 haloperoxidase/phosphatidic acid phosphatase

EXAMPLE 5

Validation of Terpene-Induction of Genes by qRT-PCR

[0108] To confirm the RNA-seq results, qRT-PCR was performed. These DE genes of interest were selected from Table 6, including two stress response genes: c7986_gl_il (aldo/keto reductase) and cl0565_gl_il (response to drug/mutagen-related protein); two DNA repair genes: c2947_gl_il (priA) and c4387_gl_il (uracil-DNA glycosylase-like protein); nice metabolic genes: c8954_gl_il (salivary gland secretion 1), c4046_gl_il (salivary gland secretion 1), cl623_gl_il (kynurenine 3-monooxygenase), c4760_gl_il (glycoside hydrolase family 16 protein), c3369_gl_i4 (NAD dependent oxidoreductase), c7313_gl_il (glycosyltransferase-like protein), cl576_gl_il (phosphatidylserine decarboxylase), c4018_gl_il (arylsulfotransf erase), and c9467_gl_il (beta-lactamase); four membrane/wall genes: c459_gl (MFS transporter mirC), cl39_gl_il (Cas3p), c5009_g2_il (low affinity iron transporter, Fet4) and c3252_gl_il (adenosine 3'-phospho 5'-phosphosulfate transporter 1); six regulators: cl930_gl_il/i2 (extracellular membrane protein, CFEM domain, fungi protein), c944_gl_il (phosphatidylethanolamine-binding protein PEBP), c9624_gl_il (glyoxylate pathway regulator), c2369_gl_il (fungal specific transcription factor / C6 transcription factor Mut3), c503_gl_il (velvet factor family protein), and c5018_g2 (Proteophosphoglycan ppg4). Comparisons of transcription levels (by AACT) of DE genes between Wt and A29 showed consistent results to RNA-seq results: all the 14 up-regulated transcripts selected were significantly up-regulated (Figure 5a) and all the 9 down-regulated transcripts selected were significantly down-regulated (Figure 5b) on day 2.

[0109] The production and cytotoxicity of terpene and its precursor can induce the transcriptome changes. To further confirm the terpene inducibility of the DE genes, qRT-PCR was performed using Wt cells cultured in the presence of monoterpene or sesquipterpene. Induction was performed at about the minimal inhibitory concentrations (MIC₀). Before qRT- PCR analysis, MICo value for menthol, linalool, caryophyllene and farnesol was individually determined (Figure 6). The MICo value of menthol and linalool was similar at -32 mg L^"1 while it was -250 mg L^"1 for caryophyllene and 12.5 mg L^"1 for farnesol. qRT-PCR analysis of 23 DE transcripts showed a complex pattern of induction or repression. Both compound type and sampling time affected the expression (Figure 7). Generally speaking, -80% genes (18-19 of 23) response to menthol or farnesol within 1 hour, to linalool within 2 hours, or to caryophyllene within 5 hours; and became depressed in expression after long exposure except with menthol. EXAMPLE 6

Effects of Over-Expression and Deletion of Terpene-Inducible Genes

[0110] The P450 family genes, cl623_gl_il (kynurenine 3-monooxygenase and c3369_gl_i4 (NAD dependent oxidoreductase), may probably account for the degradation of the toxic FPP and the desired product, amorphadiene, therefore were most interesting targets. Other interesting ones were the toxic compound response gene cl0565_gl_il and the PA phosphatase gene c8301_gl_il (LPP1/DPP1). These genes were subjected to gene deletion and over- expression studies. We used a Aku70 mutant of Wt (RtlCK) as a starting point in order to get a much higher gene deletion frequency [36] - A29 was RtlCE background so it was much harder to manipulate genes further.

[0111] Compared to A29 which was the highest amorphadiene producer selected from a random insertion mutant library, a direct URA3-site specific knock-in of ADS-FPP cassette only induced an amorphadiene titer around 1 mg/1 (Figure 8; Table 8). This titer was much less but it benefits to compare different gene deletion mutants. Knock-out of cl623_gl_il (kynurenine 3- monooxygenase) significantly increased both growth and amorphadiene titer by 2-3 folds, while knock-out of c8301_gl_il (LPP1) also increased amorphadiene production -50%. No effect was found for KO mutants of c3369_gl_i4 (NAD dependent oxidoreductase) and cl0565_gl_il (toxic compound response protein) (unpublished data).

TABLE 8

Comparison Of Sesquiterpene Titers In Engineered Strains

Strain Related Enzymes Yield (mg/L) Control Change

(RtlCK) (%)

(mg/L)

Amorphadiene

Ac 1623 kynurenine 3- 5.60±1.15 1.00±0.09 +460

monooxygenase

Ac8301 LPPl_type_2 1.54±0.31 1.00±0.09 +54

hal operoxi dase/phosphati di c

acid phosphatase

Santalene

Ac 1623 kynurenine 3- 2.00±0.05 0.58±0.01 +243 monooxygenase

Ac8301 LPPl_type_2 0.91±0.02 0.58±0.01 +56

hal operoxi dase/phosphati di c

acid phosphatase

There were 3 runs and each run with 3 replicates for each gene mutant. Here is shown the result of one representative run.

[0112] Santalene, a famous aromatic fragrance produced by Santalwood, was another sesquiterpene we tested. Santalene produced included three compounds (three GC-MS peaks), a- santalene, β-santalene and bergamotene. A direct URA3-site specific knock-in of SaSSY cassette induced a santalene titer around 0.6 mg/1 (Figure 8). Similarly, knock-out of cl623_gl_il (encoding a putative kynurenine 3 -monooxygenase) significantly increased both growth and santalene titer by 2-3 folds while knock-out of c8301_gl_il (LPP1), Ac459 (MFS transporter), Ac8162 DPP1 (bifunctional haloperoxidase/phosphatidic acid phosphatase) and Acl873 (related to amorphadiene oxidase) also significantly increased santalene production (Table 8).

[0113] The kynurenine 3 -monooxygenase gene is actually 1.9 kb, which was amplified from cDNA of A29 and over-expression it in the knock-out mutant. The growth and santalene production seem not difference compared with the control. Kynurenine 3 -monooxygenase in model yeast was directly related to protein aggregation that caused Huntington disease in human [95]. In our system, knock-out of kynurenine 3 -monooxygenase gene may have indirect effect to reduce protein aggregation and hence increase enzyme activity. Blastx of cl623_gl_il have also found another possible homologies like geranylgeranyl reductase family (E-value = 5.06e-3) and C-3,4 desaturase (E-value = 3.12e-05), which possibly more relevant to our context. Geranylgeranyl reductases are enzymes responsible for modification of isoprenoids (saturation of a prenyl group to various levels) [96], and C-3,4 desaturase is related to carotenoid biosynthesis.

[0114] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non- claimed element as essential to the practice of the invention.

[0115] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

BIBLIORAPHY

[0116] 1. Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM, Ho KA, Eachus RA, Ham TS, Kirby J, et al: Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 2006, 440:940-943.

[0117] 2. Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH: Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rearrangement. Proc Natl Acad Sci USA 1997, 94: 10600-10605.

[0118] 3. Takahashi S, Kuzuyama T, Watanabe H, Seto H: A 1-deoxy-D-xylulose 5- phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4- phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad Sci USA 1998, 95:9879-9884.

[0119] 4. Asadollahi MA, Maury J, Moller K, Nielsen KF, Schalk M, Clark A, Nielsen J: Production of plant sesquiterpenes in Saccharomyces cerevisiae: effect of ERG9 repression on sesquiterpene biosynthesis. Biotechnol Bioeng 2008, 99:666-677.

[0120] 5. Paddon CJ, Westfall PJ, Pitera DJ, Benjamin K, Fisher K, McPhee D, Leavell MD, Tai A, Main A, Eng D, et al: High-level semi-synthetic production of the potent antimalarial artemisinin. Nature 2013, 496:528-532.

[0121] 6. Khalil AS, Collins JJ: Synthetic biology: applications come of age. Nature Reviews Genetics 2010, 11:367-379.

[0122] 7. Paddon CJ, Keasling JD: Semi-synthetic artemisinin: a model for the use of synthetic biology in pharmaceutical development. Nature Reviews Microbiology 2014, 12:355-367. [0123] 8. Tsuruta H, Paddon CJ, Eng D, Lenihan JR, Horning T, Anthony LC, Regentin R, Keasling JD, Renninger NS, Newman JD: High-level production of amorpha-4, 11-diene, a precursor of the antimalarial agent artemisinin. Escherichia coli 2009, 4: 1-12.

[0124] 9. Koppisch AT, Fox DT, Blagg BS, Poulter C: E. coli MEP synthase: steady- state kinetic analysis and substrate binding. Biochemistry 2002, 41:236-243.

[0125] 10. Wanke M, Skorupinska-Tudek K, Swiezewska E: Isoprenoid biosynthesis via 1-deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol 4-phosphate (DOXP MEP) pathway. ACTA BIOCHIMICA POLONICA-ENGLISH EDITION- 2001, 48:663-672.

[0126] 11. Hintz M, Reichenberg A, Altincicek B, Bahr U, Gschwind RM, Kollas A-K, Beck E, Wiesner J, Eberl M, Jomaa H: Identification of (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate as a major activator for human γδ T cells in Escherichia coli. FEBS letters

2001, 509:317-322.

[0127] 12 Brown MS, Goldstein JL: Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth. Journal of lipid research 1980, 21:505-517.

[0128] 13. Polakowski T, Stahl U, Lang C: Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Applied microbiology and biotechnology 1998, 49:66-71.

[0129] 14. Hampton RY, Rine J: Regulated degradation of HMG-CoA reductase, an integral membrane protein of the endoplasmic reticulum, in yeast. The Journal of cell biology 1994, 125:299-312.

[0130] 15. Wright R, Basson M, D'Ari L, Rine J: Increased amounts of HMG-CoA reductase induce" karmellae": a proliferation of stacked membrane pairs surrounding the yeast nucleus. The Journal of Cell Biology 1988, 107: 101-114.

[0131] 16. Anthony JR, Anthony LC, Nowroozi F, Kwon G, Newman JD, Keasling JD: Optimization of the mevalonate-based isoprenoid biosynthetic pathway in Escherichia coli for production of the anti-malarial drug precursor amorpha-4,ll-diene. Metab Eng 2009, 11: 13-19.

[0132] 17. Dahl RH, Zhang F, Alonso-Gutierrez J, Baidoo E, Batth TS, Redding- Johanson AM, Petzold CJ, Mukhopadhyay A, Lee TS, Adams PD, Keasling JD: Engineering dynamic pathway regulation using stress-response promoters. Nature Biotechnology 2013, 31: 1039.

[0133] 18. Ma SM, Garcia DE, Redding- Johanson AM, Friedland GD, Chan R, Batth TS, Haliburton JR, Chivian D, Keasling JD, Petzold CJ, et al: Optimization of a heterologous mevalonate pathway through the use of variant HMG-CoA reductases. Metab Eng 2011, 13:588-597.

[0134] 19. Withers ST, Gottlieb SS, Lieu B, Newman JD, Keasling JD: Identification of isopentenol biosynthetic genes from Bacillus subtilis by a screening method based on isoprenoid precursor toxicity. Appl Environ Microbiol 2007, 73:6277-6283.

[0135] 20. Pitera DJ, Paddon CJ, Newman JD, Keasling JD: Balancing a heterologous mevalonate pathway for improved isoprenoid production in Escherichia coli. Metab Eng 2007, 9: 193-207.

[0136] 21. Kizer L, Pitera DJ, Pfleger BF, Keasling JD: Application of functional genomics to pathway optimization for increased isoprenoid production. Appl Environ Microbiol 2008, 74:3229-3241. [0137] 22. Zhao X, Hu C, Wu S, Shen H, Zhao ZK: Lipid production by Rhodosporidium toruloides Y4 using different substrate feeding strategies. J Ind Microbiol Biotechnol 2011, 38:627-632.

[0138] 23. Li Y, Zhao Z, Bai F: High-density cultivation of oleaginous yeast Rhodosporidium toruloides Y4 in fed-batch culture. Enzyme and Microbial Technology 2007, 41:312-317.

[0139] 24. Pan J, Kwak M, Rhee J: High density cell culture of Rhodotorula glutinis using oxygen-enriched air. Biotechnology Letters 1986, 8:715-718.

[0140] 25. Liu H, Zhao X, Wang F, Li Y, Jiang X, Ye M, Zhao ZK, Zou H: Comparative proteomic analysis of Rhodosporidium toruloides during lipid accumulation. Yeast 2009,

26:553-566.

[0141] 26. Zhu Z, Zhang S, Liu H, Shen H, Lin X, Yang F, Zhou YJ, Jin G, Ye M, Zou H, Zhao ZK: A multi-omic map of the lipid-producing yeast Rhodosporidium toruloides. Nat

Commun 20\2, 3: 1112.

[0142] 27. Shi J, Feng H, Lee J, Ning Chen W: Comparative proteomics profile of lipid- cumulating oleaginous yeast: an iTRAQ-coupled 2-D LC-MS MS analysis. PLoS One 2013, 8:e85532.

[0143] 28. Zhu Z, Ding Y, Gong Z, Yang L, Zhang S, Zhang C, Lin X, Shen H, Zou H, Xie Z, et al: Dynamics of the Lipid Droplet Proteome of the Oleaginous Yeast Rhodosporidium toruloides. Eukaryot Cell 2015.

[0144] 29. Bommareddy RR, Sabra W, Maheshwari G, Zeng A-P: Metabolic network analysis and experimental study of lipid production in Rhodosporidium toruloides grown on single and mixed substrates. Microbial cell factories 2015, 14:36.

[0145] 30. Frengova GI, Beshkova DM: Carotenoids from Rhodotorula and Phaffia: yeasts of biotechnological importance. J Ind Microbiol Biotechnol 2009, 36: 163-180.

[0146] 31. Buzzini P, Innocenti M, Turchetti B, Libkind D, van Broock M, Mulinacci N: Carotenoid profiles of yeasts belonging to the genera Rhodotorula, Rhodosporidium, Sporobolomyces, and Sporidiobolus. Can J Microbiol 2007, 53: 1024-1031.

[0147] 32. Freitas C, Parreira TM, Roseiro J, Reis A, da Silva TL: Selecting low-cost carbon sources for carotenoid and lipid production by the pink yeast Rhodosporidium toruloides NCYC 921 using flow cytometry. Bioresour Technol 2014, 158:355-359.

[0148] 33. Mannazzu I, Landolfo S, da Silva TL, Buzzini P: Red yeasts and carotenoid production: outlining a future for non-conventional yeasts of biotechnological interest.

World Journal o Microbiology and Biotechnology 2015, 31: 1665-1673.

[0149] 34. Bohlmann J, Meyer-Gauen G, Croteau R: Plant terpenoid synthases: molecular biology and phylogenetic analysis. Proceedings of the National Academy of Sciences 1998, 95:4126-4133.

[0150] 35. McGarvey DJ, Croteau R: Terpenoid metabolism. The Plant Cell 1995, 7: 1015.

[0151] 36. Koh CM, Liu Y, Moehninsi, Du M, Ji L: Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol 2014, 14:50. [0152] 37. Liu Y, Koh C, Ngoh S, Ji L: Engineering an efficient and tight d-amino acid- inducible gene expression system in Rhodosporidium Rhodotorula species. Microbial Cell Factories 2015, 14: 170.

[0153] 38. Liu Y, Koh C, Sun L, Hlaing M, Du M, Peng N, Ji L: Characterization of glyceraldehyde-3-phosphate dehydrogenase gene RtGPDl and development of genetic transformation method by dominant selection in oleaginous yeast Rhodosporidium toruloides. Appl Microbiol Biotechnol 2013, 97:719 - 729.

[0154] 39. Abbott EP, Ianiri G, Castoria R, Idnurm A: Overcoming recalcitrant transformation and gene manipulation in Pucciniomycotina yeasts. Applied microbiology and biotechnology 2013, 97:283-295.

[0155] 40. Lin X, Wang Y, Zhang S, Zhu Z, Zhou YJ, Yang F, Sun W, Wang X, Zhao ZK: Functional integration of multiple genes into the genome of the oleaginous yeast Rhodosporidium toruloides. FEMS yeast research 2014, 14:547-555.

[0156] 41. Komatsu M, Uchiyama T, Omura S, Cane DE, Ikeda H: Genome-minimized Streptomyces host for the heterologous expression of secondary metabolism. Proc Natl AcadSci USA 2010, 107:2646-2651.

[0157] 42. Van Aken B, Peres CM, Doty SL, Yoon JM, Schnoor JL: Methylobacterium populi sp. nov., a novel aerobic, pink-pigmented, facultatively methylotrophic, methane- utilizing bacterium isolated from poplar trees (Populus deltoides x nigra DN34). Int J Syst Evol Microbiol 2004, 54: 1191 - 1196.

[0158] 43. Madhaiyan M, Alex THH, Ngoh TS, Prithiviraj B, Ji L: Leaf-residing Methylobacterium species fix nitrogen and promote biomass and seed production in Jatropha curcas. Biotechnology for Biofuels 2015, 8: 1-14.

[0159] 44. Scalcinati G, Partow S, Siewers V, Schalk M, Daviet L, Nielsen J: Combined metabolic engineering of precursor and co-factor supply to increase alpha-santalene production by Saccharomyces cerevisiae. Microb Cell Fact 2012, 11: 117-117.

[0160] 45. Westfall PJ, Pitera DJ, Lenihan JR, Eng D, Woolard FX, Regentin R, Horning T, Tsuruta H, Melis DJ, Owens A, et al: Production of amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the antimalarial agent artemisinin.

Proc Natl Acad Sci USA 2012, 109:E111-118.

[0161] 46. Kuroda M, Kimizu M, Mikami C: A simple set of plasmids for the production of transgenic plants. Biosci Biotechnol Biochem 2010, 74:2348-2351.

[0162] 47. Chang Q, Griest TA, Harter TM, Petrash JM: Functional studies of aldo-keto reductases in Saccharomyces cerevisiae. Biochim Biophys Acta 2007, 1773:321-329.

[0163] 48. Grey M, Pich CT, Haase E, Brendel M: SNGl-a new gene involved in nitrosoguanidine resistance in Saccharomyces cerevisiae. Mutat Res 1995, 346:207-214.

[0164] 49. Luhtala N, Parker R: T2 Family ribonucleases: ancient enzymes with diverse roles. Trends Biochem Sci 2010, 35:253-259.

[0165] 50. Thompson DM, Parker R: The RNase Rnylp cleaves tRNAs and promotes cell death during oxidative stress in Saccharomyces cerevisiae. J Cell Biol 2009, 185:43-50.

[0166] 51. Macintosh GC, Bariola PA, Newbigin E, Green PJ: Characterization of Rnyl, the Saccharomyces cerevisiae member of the T2 RNase family of RNases: unexpected functions for ancient enzymes? Proc Natl Acad Sci USA 2001, 98: 1018-1023. [0167] 52. Koekemoer TC, Litthauer D, Oelofsen W: Isolation and characterization of adipose tissue glycerol-3-phosphate dehydrogenase. Int J Biochem Cell Biol 1995, 27:625- 632.

[0168] 53. Lee YJ, Jeschke GR, Roelants FM, Thorner J, Turk BE: Reciprocal phosphorylation of yeast glycerol-3-phosphate dehydrogenases in adaptation to distinct types of stress. Mol Cell Biol 2012, 32:4705-4717.

[0169] 54. Ansell R, Granath K, Hohmann S, Thevelein JM, Adler L: The two isoenzymes for yeast NAD+-dependent glycerol 3-phosphate dehydrogenase encoded by GPD1 and GPD2 have distinct roles in osmoadaptation and redox regulation. EMBO J 1997, 16:2179- 2187.

[0170] 55. Ness F, Aigle M: RTM1: a member of a new family of telomeric repeated genes in yeast. Genetics 1995, 140:945-956.

[0171] 56. Soustre I, Letourneux Y, Karst F: Characterization of the Saccharomyces cerevisiae RTA1 gene involved in 7-aminocholesterol resistance. Curr Genet 1996, 30: 121- 125.

[0172] 57. Pereira H, Azevedo F, Rego A, Sousa MJ, Chaves SR, Corte-Real M: The protective role of yeast cathepsin D in acetic acid-induced apoptosis depends on ANT (Aac2p) but not on the voltage-dependent channel (Porlp). FEBSLett 2013, 587:200-205

[0173] 58. Pereira C, Chaves S, Alves S, Salin B, Camougrand N, Manon S, Sousa MJ, Corte-Real M: Mitochondrial degradation in acetic acid-induced yeast apoptosis: the role of Pep4 and the ADP/ATP carrier. Mol Microbiol 2010, 76: 1398-1410.

[0174] 59. Mason DA, Shulga N, Undavai S, Ferrando-May E, Rexach MF, Goldfarb DS: Increased nuclear envelope permeability and Pep4p-dependent degradation of nucleoporins during hydrogen peroxide-induced cell death. FEMS Yeast Res 2005, 5: 1237- 1251.

[0175] 60. Chatterjee A, Singh KK: Uracil-DNA glycosylase-deficient yeast exhibit a mitochondrial mutator phenotype. Nucleic Acids Res 2001, 29:4935-4940.

[0176] 61. Paques F, Haber JE: Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 1999, 63:349- 404.

[0177] 62. Holliday R: A mechanism for gene conversion in fungi. Genet Res 2007, 89:285-307.

[0178] 63. Leach DR: Holliday junctions, heteroduplex DNA and map expansion: a commentary on Ά mechanism for gene conversion in fungi' by Robin Holliday. Genet Res

2007, 89:281-283.

[0179] 64. Zakharyevich K, Tang S, Ma Y, Hunter N: Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase. Cell 2012, 149:334- 347.

[0180] 65. Takayama Y, Kamimura Y, Okawa M, Muramatsu S, Sugino A, Araki H: GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 2003, 17: 1153-1165.

[0181] 66 Aparicio T, Ibarra A, Mendez J: Cdc45-MCM-GINS, a new power player for DNA replication. Cell Div 2006, 1: 18. [0182] 67. Cadman CJ, McGlynn P: PriA helicase and SSB interact physically and functionally. Nucleic Acids Res 2004, 32:6378-6387.

[0183] 68. Jones JM, Nakai H: Escherichia coli PriA helicase: fork binding orients the helicase to unwind the lagging strand side of arrested replication forks. J Mol Biol 2001,

312:935-947.

[0184] 69 Manhart CM, McHenry CS: The PriA replication restart protein blocks replicase access prior to helicase assembly and directs template specificity through its ATPase activity. J Biol Chem 2013, 288:3989-3999.

[0185] 70. Haddad R, Maurice F, Viphakone N, Voisinet-Hakil F, Fribourg S, Minvielle- Sebastia L: An essential role for Clpl in assembly of polyadenylation complex CF IA and Pol II transcription termination. Nucleic Acids Res 2012, 40: 1226-1239.

[0186] 71. Holbein S, Scola S, Loll B, Dichtl BS, Hubner W, Meinhart A, Dichtl B: The P-Loop Domain of Yeast Clpl Mediates Interactions Between CF IA and CPF Factors in Pre-mRNA 3' End Formation. PLoS ONE 2011, 6:e29139.

[0187] 72. Morello LG, Coltri PP, Quaresma AJ, Simabuco FM, Silva TC, Singh G, Nickerson JA, Oliveira CC, Moore MJ, Zanchin NI: The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing. PLoS One 2011, 6:e29174.

[0188] 73. Yamashita A, Sugiura T, Waku K: Acyltransf erases and transacylases involved in fatty acid remodeling of phospholipids and metabolism of bioactive lipids in mammalian cells. J Biochem 1997, 122: 1-16.

[0189] 74. Upton C, Buckley JT: A new family of lipolytic enzymes? Trends Biochem Sci 1995, 20: 178-179.

[0190] 75. Panozzo C, Nawara M, Suski C, Kucharczyka R, Skoneczny M, Becam AM, Rytka J, Herbert CJ: Aerobic and anaerobic NAD+ metabolism in Saccharomyces cerevisiae. FEBS Lett 2002, 517:97-102.

[0191] 76. Davies G, Henrissat B: Structures and mechanisms of glycosyl hydrolases.

Structure 1995, 3:853-859.

[0192] 77. Haas H, Schoeser M, Lesuisse E, Ernst JF, Parson W, Abt B, Winkelmann G, Oberegger H: Characterization of the Aspergillus nidulans transporters for the siderophores enterobactin and triacetylfusarinine C. Biochem J 2003 , 371:505-513.

[0193] 78. Moyrand F, Chang YC, Himmelreich U, Kwon-Chung KJ, Janbon G: Cas3p belongs to a seven-member family of capsule structure designer proteins. Eukaryot Cell

2004, 3: 1513-1524.

[0194] 79. Kim RH, Wang D, Tsang M, Martin J, Huff C, de Caestecker MP, Parks WT, Meng X, Lechl eider RJ, Wang T, Roberts AB: A novel smad nuclear interacting protein, SNIP1, suppresses p300-dependent TGF-beta signal transduction. Genes Dev 2000, 14: 1605-1616.

[0195] 80. Kulkarni RD, Kelkar HS, Dean RA: An eight-cysteine-containing CFEM domain unique to a group of fungal membrane proteins. Trends Biochem Sci 2003, 28: 118- 121.

[0196] 81. Buck V, Quinn J, Soto Pino T, Martin H, Saldanha J, Makino K, Morgan BA, Millar JB: Peroxide sensors for the fission yeast stress-activated mitogen-activated protein kinase pathway. Mol Biol Cell 2001, 12:407-419. [0197] 82 Milner MJ, Pence NS, Liu J, Kochian LV: Identification of a novel pathway involving a GATA transcription factor in yeast and possibly in plant Zn uptake and homeostasis. J Integr Plant Biol 2014, 56:271-280.

[0198] 83. Wilson WA, Roach PJ: Nutrient-regulated protein kinases in budding yeast. Cell 2002, 111: 155-158.

[0199] 84. Miyake A, Mochizuki S, Yokoi H, Kohda M, Furuichi K: New ether-a-go-go K(+) channel family members localized in human telencephalon. J Biol Chem 1999, 274:25018-25025.

[0200] 85. Gutman GA, Chandy KG, Grissmer S, Lazdunski M, McKinnon D, Pardo LA, Robertson GA, Rudy B, Sanguinetti MC, Stuhmer W, Wang X: International Union of Pharmacology. LIII. Nomenclature and molecular relationships of voltage-gated potassium channels. Pharmacol Rev 2005, 57:473-508.

[0201] 86. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH: Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 2001 , 22: 153 - 183.

[0202] 87. Novick P, Zerial M: The diversity of Rab proteins in vesicle transport. Curr Opin Cell Biol 1997, 9:496-504.

[0203] 88. Strom M, Vollmer P, Tan TJ, Gallwitz D: A yeast GTPase-activating protein that interacts specifically with a member of the Ypt Rab family. Nature 1993, 361:736-739.

[0204] 89. Richardson PM, Zon LI: Molecular cloning of a cDNA with a novel domain present in the tre-2 oncogene and the yeast cell cycle regulators BUB2 and cdcl6. Oncogene

1995, 11: 1139-1148.

[0205] 90. Paiva S, Devaux F, Barbosa S, Jacq C, Casal M: Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast 2004, 21:201-210.

[0206] 91. Augstein A, Barth K, Gentsch M, Kohlwein SD, Barth G: Characterization, localization and functional analysis of Gprlp, a protein affecting sensitivity to acetic acid in the yeast Yarrowia lipolytica. Microbiology 2003, 149:589-600.

[0207] 92. Piani A, Ilg T, Elefanty AG, Curtis J, Handman E: Leishmania major proteophosphoglycan is expressed by amastigotes and has an immunomodulatory effect on macrophage function. Microbes and Infection 1999, 1:589-599.

[0208] 93. Robinson MD, Oshlack A: A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 2010, 11:R25.

[0209] 94. Faulkner A, Chen X, Rush J, Horazdovsky B, Waechter CJ, Carman GM, Sternweis PC: The LPP1 and DPP1 gene products account for most of the isoprenoid phosphate phosphatase activities in Saccharomyces cerevisiae. J Biol Chem 1999, 274: 14831-14837.

[0210] 95. Giorgini F, Guidetti P, Nguyen Q, Bennett SC, Muchowski PJ: A genomic screen in yeast implicates kynurenine 3-monooxygenase as a therapeutic target for Huntington disease. Nat Genet 2005, 37:526-531.

[0211] 96. Tanaka R, Oster U, Kruse E, Rudiger W, Grimm B: Reduced activity of geranylgeranyl reductase leads to loss of chlorophyll and tocopherol and to partially geranylgeranylated chlorophyll in transgenic tobacco plants expressing antisense RNA for geranylgeranyl reductase. Plant Physiol 1999, 120:695-704. [0212] 97. Ji L, Jiang Z-D, Liu Y, Koh CMJ, Zhang L-H: A simplified and efficient method for transformation and gene tagging of Ustilago maydis using frozen cells. Fungal Genetics and Biology 2010, 47:279-287.

[0213] 98 Patel RK, Jain M: NGS QC Toolkit: a toolkit for quality control of next generation sequencing data. PLoS One 2012, 7: e30619.

[0214] 99. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q, et al: Full-length transcriptome assembly from RNA- Seq data without a reference genome. Nat Biotechnol 2011, 29:644-652.

[0215] 100. Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, Couger MB, Eccles D, Li B, Lieber M, et al: De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc 2013, 8: 1494-1512.

[0216] 101. Robinson MD, McCarthy DJ, Smyth GK: edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26: 139- 140.

[0217] 102 Li B, Dewey CN: RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011, 12:323.

[0218] 103. Cock PJ, Griming BA, Paszkiewicz K, Pritchard L: Galaxy tools and workflows for sequence analysis with applications in molecular plant pathology. PeerJ

2013, l:el67.

[0219] 104. Paul D, Magbanua Z, Arick M, 2nd, French T, Bridges SM, Burgess SC, Lawrence ML: Genome Sequence of the Oleaginous Yeast Rhodotorula glutinis ATCC 204091. Genome Announc 2014, 2.

[0220] 105. Lee L, Gelvin S: T-DNA binary vectors and systems. Plant Physiol 2008, 146:325 - 332

[0221] 106 Wesley, S.V. et al (2001) Construct design for efficient, effective and high- throughput gene silencing in plants. Plant J 27:581-590.

[0222] 107 Mysara, M et al (201 1) MysiRNA-designer: a workflow for efficient siRNA design. PLOS one 6(10):e25642.

[0223] 108. Yan, P. et al. (2012). High-throughput construction of intron-containing hairpin RNA vectors for RNAi in plants. PLOS one 7(5):e38186

[0224] 109 Koh et al (2014) Molecular characterization of KU70 and KU80 homologues and exploitation of a JTt/70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC microbiology 14.1 : 1.)

[0225] 110 Ran, F Ann, et al (2013) Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154: 1380-1389.

Claims

WHAT IS CLAIMED IS:

1. A genetically modified fungal cell useful for producing a desired terpene that comprises (a) a nucleic acid construct that overexpresses a heterologous farnesyl pyrophosphate synthase (FPPS), (b) a nucleic acid construct that overexpresses a heterologous terpene synthase involved in the production of a desired terpene and (c) either (i) one or more nucleic acid constructs each down-regulating one or more terpene-induced genes or (ii) one or more knocked-out terpene induced genes or a combination of (i) and (ii).

2. The genetically modified fungal cell of claim 1, wherein the terpene synthase is selected from the group consisting of an amorphadiene synthase (ADS), a santalene synthase (SSY), beta-eudesmol synthase, bisabolene synthase, farnesene synthase, humulene synthase, zingiberene synthase, caryophyllene synthase, vetivazulene synthase, guaiazulene synthase or patchoulene synthase.

3. The genetically modified fungal cell of claim 1 or 2, wherein the terpene is selected from the group consisting of amorphadiene, santalene, beta-eudesmol, bisabolenes, farnesene, humulene, zingiberene, caryophyllene, vetivazulene, guaiazulene or patchoulene.

4. The genetically modified fungal cell of any one of claims 1-3, wherein the terpene- induce gene is a kynurenine 3-monoxygenase, a phosphatidic acid (PA) phosphatase/ diacyl glycerol diphosphate phosphatase, a major facilitator superfamily (MFS) transporter or a P450 cytochrome oxidase.

5. The genetically modified fungal cell of any one of claims 1-4, wherein the fungal cell is from a Rhodosporidium species or a Rhodotorula species, preferably a strain of Rhodosporidium toruloides.

6. The genetically modified fungal cell of any one of claims 1-5, wherein the FPPS has the amino acid sequence set forth in SEQ ID NO: 5.

7. The genetically modified fungal cell of 6, wherein the FPPS is encoded by a nucleic acid having the nucleotide sequence set forth in SEQ ID NO:4.

8. The genetically modified fungal cell of any one of claims 1-7, wherein the terpene synthase is ADS having the amino acid sequence set forth in SEQ ID NO:3.

9. The genetically modified fungal cell of 8, wherein the ADS is encoded by a nucleic acid having the nucleotide sequence set forth in SEQ ID NO:2.

10. The genetically modified fungal cell of any one of claims 1-7, wherein the terpene synthase is SSY having the amino acid sequence set forth in SEQ ID NO: 128.

11. The genetically modified fungal cell of 9, wherein the SSY is encoded by a nucleic acid having the nucleotide sequence set forth in SEQ ID NO: 127.

12. A method of producing a desired terpene comprising culturing the genetically modified fungal cell of any one of claims 1-7 under conditions suitable for growth of the modified fungal cell and for production of the desired terpene.

13. A method of producing amorphadiene comprising culturing the genetically modified fungal cell of claim 8 or 9 under conditions suitable for growth of the modified fungal cell and for production of the amorphadiene.

13. A method of producing santalene comprising culturing the genetically modified fungal cell of claim 10 or 11 under conditions suitable for growth of the modified fungal cell and for production of the santalene.

14. The method of any one of claims 12-13, wherein the culturing is performed using a medium comprising glucose, peptone, yeast extract, (NH₄)₂S0₄, KH₂P0₄ and MgS0₄.

15. The method of claim 14, wherein the medium comprises 100 g L^"1 glucose, 15.7 g L^"1 peptone, 15.7 g L^"1 yeast extract, 12 g L^"1 (NH₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.75 g L^"1 MgS0₄. The method of claim 14 or 15, wherein isoproply myristate is added at a concentration from about 5% v/v to about 15% v/v after 24 hours of culturing.

The method of any one of claims 14-16, wherein the culture is fed daily with glucose solution with isopropyl myristate, wherein the glucose solution comprises glucose at about 50%) to about 80%> and isopropyl myristate at about 5% to about 15%>.

A culture medium comprising 100 g L^"1 glucose, 15.7 g L^"1 peptone, 15.7 g L^"1 yeast extract, 12 g L^"1 ( H₄)₂S0₄, 1 g L^"1 KH₂P0₄, 0.75 g L^"1 MgS0₄.

The culture medium of claim 18, further comprising isoproply myristate is at a concentration from about 5% v/v to about 15%> v/v.