CN109705201B - Cotton verticillium wilt resistance related gene GhABC and coding protein and application thereof - Google Patents
Cotton verticillium wilt resistance related gene GhABC and coding protein and application thereof Download PDFInfo
- Publication number
- CN109705201B CN109705201B CN201910144715.7A CN201910144715A CN109705201B CN 109705201 B CN109705201 B CN 109705201B CN 201910144715 A CN201910144715 A CN 201910144715A CN 109705201 B CN109705201 B CN 109705201B
- Authority
- CN
- China
- Prior art keywords
- leu
- ser
- val
- ile
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of agricultural biology, and particularly relates to a cotton verticillium wilt resistance related gene GhABC, and a coding protein and application thereof. The nucleotide sequence of the cotton verticillium wilt resistance related gene GhABC is shown in SEQ ID No.2, and the amino acid sequence of the coded protein is shown in SEQ ID No. 1. After the gene silencing plant is inoculated with the cotton verticillium wilt pathogenic bacterium Vd080 spore suspension, the silencing plant shows more susceptible diseases, and the mechanism research shows that the synthesis of xylem and callose in the silencing plant is reduced, the ROS is reduced, and the down-regulation expression of partial defense genes is realized. The GhABC is proved to be positively correlated with the verticillium wilt resistance of cotton, and the GhABC can be used as a candidate gene for cotton breeding for disease resistance.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a cotton verticillium wilt resistance related gene GhABC, and a coding protein and application thereof.
Background
Cotton is an important textile raw material and an important economic crop, however, cotton verticillium wilt serving as a worldwide disease causes great harm to the yield of cotton, the disease serving as a soil-borne vascular bundle disease has no ideal prevention and treatment measures, and the selection of disease-resistant varieties through genetic engineering becomes an important technical means for solving the cotton verticillium wilt.
Disclosure of Invention
The invention aims to provide a verticillium wilt resistant gene GhABC of cotton.
It is still another object of the present invention to provide a protein encoded by the above gene.
It is still another object of the present invention to provide a recombinant expression vector containing the above gene.
It is still another object of the present invention to provide a recombinant strain containing the above gene.
It is still another object of the present invention to provide use of the above gene.
The invention also aims to provide application of the protein.
The amino acid sequence of the GhABC protein provided by the invention is shown in SEQ ID No. 1:
the nucleotide sequence of the GhABC gene provided by the invention is shown in SEQ ID No. 2:
ATGGATGGTTTAGAAAGAGTTCGAAGTCGAAATCCCAGCAGAAGAACGGGGCATAGCAGCATAGGGAGGAGCTTAAGTAGGAGTAGTTGGAACATGGAAGATGTGTTTTCAGGTTCCAGAAGAAGTAGCCGTGTGGAAGATGATGAAGAAGCTCTAAAATGGGCTGCTATCGAGAGACTACCCACATATGATCGGCTGAGGACAAGCATCATGCAGTCCTTTGTGGATCATGAAATCATTGGCAACAAGATGGAACATAGAGAGGTTGATGTTAGAAACCTTGACATGAACGACAGACAAAAATTCATCGACATGCTCTTCAAGGTTGCTGAGGAAGATAATGAGAAATTCTTGAAGAAGTTCAGAAACAGGATCGATAAGGTTGGGATTACACTTCCAACAGTAGAAGTTAGATTCAACCATCTGACGATTGAAGCCGACTGCTACGTTGGCAGCAGAGCTCTTCCAACTCTTGTAAACTCTGCTAGAAACCTTGCAGAATCGGCTCTTGGCCTCCTTGGAATCAGTTTTGCCAAGAAAGCAAACCTCACAATTCTTAAAGATGCTTCTGGGATTATTAAACCATCAAGGATGACACTCTTACTAGGCCCACCCTCTTCTGGGAAAACAACCCTTTTGCTGGCATTGGCCGATAAGTTGGACCCAAGCTTAAGGGTTAAAGGAGAAGTCACATACAACGGATATAAACTAAAGGAATTTGTTGCTAGAAAGACATCCGCATATATCAGTCAAAATGATGTTCATGTCGGAGAAATGACAGTGAAAGAAACCTTGGATTTCTCAGCAAGATGTCAGGGTGTTGGGACACGATACGATCTGTTAAGTGAGCTTGCTAGAAGGGAAAAAGATGCAGGGATTTTCCCAGAAGCTGATGTAGACCTTTTCATGAAGGCAACTTCAGTGGAAGGAATTGAAAGCAGCCTTATCACTGATTACACACTCAAAATATTGGGGCTCGACATATGCAAGGATATCATCGTTGGAGACGAGATGCAGCGTGGAATTTCCGGAGGTCAAAAGAAAAGAGTAACAACAGGGGAGATGATTGTTGGTCCCACCAAGACACTATTCATGGATGAAATATCAACGGGTCTTGATAGTTCCACGACATACCAGATAGTGAAGTGCTTGCAGCAGGTTGTGCACCTAACAGAGGGCACAATCTTGATGTCACTATTGCAGCCTGCTCCAGAGACTTACGATCTCTTTGATGATATCATCCTCTTATCTGAGGGTCAAATTGTCTATCAAGGTCCACGAGAACACGTTGTTGAGTTCTTTGAGAGCTGTGGTTTCAAATGTCCCGAGAGGAAAGGAACTGCTGACTTTTTGCAAGAGGTTACCTCAAAGAAGGACCAAGAACAATATTGGGCGGACAAAAGAAAGCCATACAGATACATTACAGTAACTGAATTTGCAAACAGGTTCAAGCACTTCCATGTCGGAATGCAGCTACAGAGTGAGCTAGCTGTGCCTTTCGACAAGTCAAGAGGCCACCGAGCGGCATTGGCCTTCCAGAAATACTCTATGTCCAAAATGGAGCTTCTTAAGGCCTGTTGGGACAAAGAATGGCTATTGATCAAAAGGAATTCTTTTATTTATGTGTTTAAGACGGTCCAAATTATCATCGTGGCATTCATCTCGTCTACTGTCTTTTTGAGAACTGAAATGCACCAGAGGGATTTGAACGATGCGCAACTCTATATTGGCTCACTTCTGTTTGGAATGATCATCAACATGTTCAATGGCTTCGCTGAGCTCTCCCTTATGATTAGTAGGCTTCCAGTGTTCTACAAGCAAAGAGACCTCTTATTCCACCCTGTCTGGACTTTCACTCTGCCCACTTTCTTGCTCCGGGTTCCGATATCTATTTTGGAAACAGTTGCTTGGATGGCTGTAACTTATTACACTGTAGGATATGCACCTGAGGCCAGCAGGTTTTTCAAAAACTTCCTGTTGGTGTTTTCAGTACAACAAATGGCATCTGGTCTATTTCGGCTCATTGCCGGATTATGCAGAACAATGATCATAGCTAACACTGGTGGGGTTCTTACACTTCTCCTCGTGTTCTTGCTGGGAGGTTTCATCATTCCTAAACGTGAAATTCCAAGTTGGTGGGAGTGGGCTCACTGGATTTCACCTTTGACTTACGGTTTCAATGCCTTTACTGTGAATGAAATGTTTGCGTCAAGGTGGATGAATAGACAGGTTTCAAACAGTTCGACTAGCCTGGGGCTACAAGTGCTTGATAGCTTTGATGTCCCAAACGATGAAAACTGGTATTGGATTGGTGCAGGTGCTCTTCTAGGGTTCGCAGTGCTCTTCAACATTCTCTTCACCTTTGCGCTTATATACTTAAGCCCCCTTGGAAAGCCGCAGGCTATAATTTCGGAGGAAACGGTGGAAGAGCTAGAGGCTAATAATGTGGATTCTAATGAAGAACCAAGGTTAATGAGACCAGAATCGAGTAAATATTCATTCTCTGCAGATGCAAGCAATGCAGTAGAAATGGAAATCCGAAGAATGAGCAGTCGAGCTGATTCCCACGGAATGAGCAGGAATGATTCTCAAGTTGATGCAGCCACTGGTGTTGCCCCAAAGAGAGGAATGGTTCTTCCCTTCACTCCTCTAGCAATGTCTTTTGACACTGTCGATTACTACGTTGATATGCCACCTGAAATGAAGGCACAAGGAGTTGGTGAGGATAGGTTACAACTACTTCGGGGAGTAACAGGTGCATTTAGGCCTGGAGTGTTGACTGCATTGATGGGAGTCAGTGGAGCAGGGAAGACAACATTGATGGATGTTCTAGCAGGAAGAAAGACCGGTGGATATATTGAGGGTGATATCAGAATATCCGGATTCCCAAAGAAACAAGAAACCTTTGCAAGAATTTCTGGATACTGTGAACAAACTGATATTCACTCACCACAAGTGACTATCAGAGAATCCTTAATTTACTCAGCATTCCTACGACTTCCAAAAGAAATCAGCAACGAGGAAAAGATGATTTTCGTGGATGAAGTAATGGAACTAGTAGAATTAAGCAATCTCAAGGATGCCATAGTAGGGTTGCCTGGAGTCACAGGGTTGTCAACAGAGCAAAGAAAGAGGTTAACAATTGCAGTAGAGCTTGTTGCTAATCCCTCGATCATTTTCATGGATGAACCGACATCCGGTCTTGATGCGAGGGCAGCAGCCATTGTCATGAGGACTGTCAGAAACACCGTGGACACCGGAAGAACGGTTGTCTGCACCATTCATCAGCCTAGTATTGATATCTTTGAAGCCTTTGATGAATTGCTACTAATGAAGAGAGGAGGTCAGGTGATTTACTCCGGACCATTAGGCCGAAATTCTCATAAGATCATCGAATATTTTGAGGCAATTCCTGGAGTTCCCAAAATTAAGGAAAAGTATAATCCAGCTACATGGATGTTAGAAGTGAGCTCTATAGCAGCTGAAGTTAGGCTCGGAATTGATTTTGCTGAACACTACAAATCATCTTCCTTGTATCAGAGAAACAAGGCGTTAGTAAATGAGTTAAGCACACCACCTCCAGGAGCTAAAGACCTCTATTTTGCCACTCAGTACTCACAAACTACATTGGGTCAATTCAAATCATGCTTTTGGAAACAATGGTGGACTTACTGGAGAAGTCCAGATTATAACCTTGTCAGATACTTCTTCACTTTGGTCACTGCTCTCTTGGTTGGTTCTATTTTCTGGCAGATCGGCACTGACAGGAGTAAAGCATCTGATCTTACAATGATCATCGGTGCAATGTATGCTGCAGTCATATTTGTTGGAATCAATAACTGCTCAACAGTTCAACCAGTCATAGCCATTGAAAGAACAGTGTTCTATCGTGAAAGAGCTGCTGGGATGTACTCTGCATTACCTTATGCCCTTGCGCAGGTGCTTTGTGAAATACCTTACGTATTTGGCCAAACCGTATACTATACACTTATAGTGTATGCCATGGTGGGCTTTCAATGGACAGTGGCAAAGTACTTCTGGTTTTTCTTTGTCAGCTTCTTCACCTTCCTTTACTTTACATACTACGGAATGATGACTGTTTCGATCACACCAAACCATCAAATATCATCTATATTTGCTGCAGCATTCTATTCAGTCTTTAATCTTTTCTCCGGCTTCTTCATTCCAAGACCAAGAATTCCTGGTTGGTGGATCTGGTATTACTGGATTTGCCCGGTTGCATGGACAATTTACGGATTGATTGCGTCACAATATGGAGATCTTGAAGACAAAATTAGTGTACCTGGCGTCTCTCCTGACCCTACTATTAAGTCGTATATTAAAGATCAGTACGGCTATGATTCAGACTTCATGGGGCCAGTTGCTGCAGTTTTGGTTGGCTTTGGAGTATTTTTTGCCACTTTGTTTGCCTACTGCATAAGGACACTCAATTTCCAGACCAGATAA
the invention also provides a recombinant expression vector and a cell containing the coding gene.
The invention provides application of GhABC protein and a coding gene thereof in cotton verticillium wilt resistance.
After the plant material is inoculated with cotton verticillium wilt pathogenic bacteria, the serine (Ser, S) at positions 855, 859 and 863 of the GhABC protein is subjected to phosphorylation modification, and the lysine (Lys, K) at position 440 is subjected to ubiquitination modification.
Furthermore, test results show that the protein is up-regulated in cotton body in a key disease-resistant period after inoculation of pathogenic bacteria, the expression of the GhABC gene is activated under the stress of the pathogenic bacteria, and after treatment of hormones (jasmonic acid, ethylene, salicylic acid and hydrogen peroxide), the expression of the GhABC gene is changed, and the GhABC gene is regulated and controlled by the hormones.
The invention constructs a silencing vector of the gene GhABC, and inhibits the expression of the GhABC in cotton by utilizing a virus-mediated gene silencing technology. After the gene silencing plant is inoculated with a cotton verticillium wilt pathogenic bacterium Vd080 spore suspension, the silencing plant shows more susceptible diseases, and the mechanism research finds that the synthesis of xylem and callose in the silencing plant is reduced, the ROS is reduced, and the down-regulation expression of partial defense genes is realized, so that the GhABC gene is proved to be positively correlated with the cotton verticillium wilt resistance, and the GhABC gene can be used for screening cotton disease resistance breeding.
Drawings
FIG. 1 shows GhABC expression in resistant/susceptible varieties under pathogenic stress;
FIG. 2 shows GhABC expression in disease-resistant varieties after hormone treatment;
FIG. 3 shows GhABC expression in susceptible varieties after hormone treatment;
FIG. 4 shows the albinism and morbidity of the leaves of plants after gene silencing;
FIG. 5 shows the accumulation of xylem in plants following gene silencing;
FIG. 6 shows the accumulation of callose in plant leaves after gene silencing;
FIG. 7 shows the burst of reactive oxygen species in the leaves of plants following gene silencing;
FIG. 8 shows the relative expression levels of the relevant defense genes in plants after pathogen treatment.
Detailed Description
Example 1 acquisition of Cotton Gene GhABC
The method comprises the steps of taking cotton No.2 planted in a disease-resistant variety and Ji cotton No. 11 infected by a disease-susceptible variety as plant materials, inoculating pathogen Vd080 of cotton verticillium wilt, extracting cotton holoprotein, and taking cotton which is not inoculated with pathogen as a blank control. Performing enzymolysis on the extracted total protein with trypsin, and using metal oxide TiO2The phosphorylation peptide containing serine (S), threonine (T) and tyrosine (Y) is enriched by utilizing the affinity of the phosphate group, the acetylation peptide in the complex sample is specifically enriched by utilizing the motif antibody with high affinity to the acetylation lysine, the ubiquitination peptide in the complex sample is specifically enriched by utilizing the motif antibody with high affinity to the ubiquitination lysine, the different modified enrichments are subjected to a liquid chromatography mass spectrometry (LC-MS/MS) protein quantitative method, the quantitative analysis of large-scale protein modification is realized, and the biological information analysis is carried out according to the quantitative analysis result.
According to the results of the biogenic analysis, the protein GhABC with the amino acid sequence shown as SEQ ID No.1 is obtained by screening. The phosphorylation intensity of the protein GhABC in a disease-resistant control variety is 15.12, and the phosphorylation intensity in a disease-susceptible variety is 9.60; the ubiquitination intensity in the disease-resistant variety is 5.49, and the ubiquitination intensity in the disease-susceptible variety is 1.35.
Example 2 expression of GhABC in Cotton after pathogen and hormone treatment
The experimental materials are No.2 cotton and No. 11 cotton which are disease-resistant varieties of cotton planted in vermiculite sandy soil paper bowls.
After the root injury, Vd080 spore suspension is inoculated, and root RNA is extracted at 12h, 24h, 48h and 72h respectively.
With 0.5mM hydrogen peroxide (H)2O2) 0.1mM Salicylic Acid (SA), 0.15mM methyl Jasmonate (JA) and 1mM Ethylene (ET) are sprayed on the leaf surface until the leaf surface drips, and root RNA is extracted in 12h, 24h, 48h and 72h respectively.
The fluorescent quantitative primer is designed as follows: GhABC-F: TTCAGCCTGTTGGTCGTG, GhABC-R: GCGGGATTATTATGTCCTTG. Detecting the expression of GhABC after the treatment of pathogenic bacteria and hormone.
As shown in FIG. 1, in susceptible and disease-resistant varieties, GhABC is inhibited from being expressed in the early stage of pathogenic bacteria inoculation, but is greatly increased in the critical stage of disease resistance. It can be seen that GhABC plays an important role in plant disease resistance.
As shown in FIGS. 2 and 3, after hormone treatment, GhABC of the disease-resistant variety was sensitive to all hormones, but expression was suppressed except for ET, and GhABC of the disease-sensitive variety was sensitive to ET and H2O2Sensitive, indicating that the expression of GhABC is probably influenced by ET and H2O2Regulation and control of (1).
Example 3 study of GhABC function Using Virus-mediated Gene silencing technology (VIGS)
1. Silencing gene GhABC in cotton
Primer for designing GhABC silencing vector
ABC-VIGS-F:GCTCTAGATCAGAAACACCGTGGACA,
ABC-VIGS-R:GGGGTACCTTAACTCATTTACTAACGCCTT。
Amplifying a silent segment by taking cDNA of cotton plant No.2 in a disease-resistant variety as a template, transforming pYL-156 vector, transforming escherichia coli DH5 alpha competent cells, extracting pYL-156-GhABC plasmid after sequencing verification is correct, transforming agrobacterium GV3101 competence, carrying out colony PCR verification, carrying out amplification culture, taking pYL-156 idle load as a control, taking pYL-156-PDS as a positive control (after the PDS gene is silenced, the whitening phenomenon of leaves) to mix and stand with helper plasmid pYL-192, and injecting cotton plant No.2 cotton leaves by a needle-free injector. Dark culture is carried out for 24h after injection treatment, and the culture is carried out at 22 ℃ under normal illumination. When the positive control shows a albino phenotype, detecting the expression level of GhABC in the silent plant by using fluorescent quantitative PCR, and selecting the plant with better silent effect for further test.
2. Disease resistance study of silenced plants
Selecting plants with good silencing effect, and inoculating 10mL of Verticillium dahliae spore solution (the concentration is 2 multiplied by 10) when one true leaf is initialized7CFU/mL), placed in a greenhouse at 25 ℃ for growth under normal light. After inoculation, samples were taken at different time periods, and silent plant RNA was extracted for detecting expression of the defense genes shown in table 1. And (3) detecting the accumulation of callose in xylem and leaf callose of the cotton stem and detecting the outbreak of active oxygen in the cotton leaf when inoculating the strain for 3 d. And detecting the necrosis of leaf cells at 15 d. At 20d, the plants were investigated for disease.
TABLE 1 RT-qPCR primers for Cotton defense-related genes
As shown in FIG. 4, the disease index of the silenced plant is calculated to be 60.12 + -0.99 and the disease rate is 100% after counting the disease condition, while the disease index of the control is 21.92 + -2.68 and the disease rate is 83.74 + -2.56%, and the disease index and the disease rate of the silenced plant and the control are very different.
As shown in fig. 5, after cotton seedling stalks were stained with phloroglucinol and incubated with concentrated sulfuric acid, accumulation of xylem of silenced plants was observed to be significantly lower than that of non-silenced plants under an orthographic microscope. As shown in FIG. 6, cotton leaves were stained with aniline blue, and plants visibly silenced under UV excitation had a lower accumulation of callose than controls. As shown in fig. 7, the active oxygen burst experiments showed less brown precipitate in the leaves of the silenced plants, indicating a weaker active oxygen burst. More cell necrosis was observed in silent plants by staining cotton leaves with aniline blue.
The expression levels of defensive enzyme genes or defensive enzyme metabolism genes, such as phenylalanine ammonia lyase (GhPAL), cinnamic acid-4-hydroxylase (GhC4H1), peroxidase (GhPOD) and polyphenol oxidase (GhPOO), in silenced plants are reduced to different degrees after inoculation with pathogenic bacteria at different time intervals after inoculation with pathogenic bacteria. The expression levels of marker genes GhHSR203J and GhHIN1 of anaphylaxis in cotton are lower than those of a control in the whole detection period, and the fact that the silencing of GhABC causes the reduction of active oxygen is shown. GhPR3 is a marker gene of an Ethylene (ET) signal pathway, and the expression of the gene at the initial stage of pathogen inoculation in a silent plant is obviously lower than that of a control, which indicates that ET plays a positive regulation role in the initial stage of GhABC disease resistance. GhJaZ1 is an identification gene of a JA signal channel, and the expression in a silent plant is higher than that of a control, indicating that GhABC is possibly negatively regulated by JA. GhPR1 and GhNPR1 are identification genes of a salicylic acid signal channel, and the expression quantity in a silent plant is higher than that in a control, which indicates that salicylic acid plays a role in negative regulation in GhABC disease resistance. GhNOA1 is a nitric oxide pathway gene, and the expression level in silent plants is obviously lower than that of a control, indicating that GhABC is related to a nitric oxide pathway. Therefore, the GhABC gene has an important positive regulation function in cotton verticillium wilt resistance, and can be used as an important candidate gene for cotton verticillium wilt resistance breeding.
Sequence listing
<110> Cotton research institute of Chinese academy of agricultural sciences
<120> verticillium wilt resistance related gene GhABC of cotton, and coding protein and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1488
<212> PRT
<213> Cotton (Gossypium spp)
<400> 1
Met Asp Gly Leu Glu Arg Val Arg Ser Arg Asn Pro Ser Arg Arg Thr
1 5 10 15
Gly His Ser Ser Ile Gly Arg Ser Leu Ser Arg Ser Ser Trp Asn Met
20 25 30
Glu Asp Val Phe Ser Gly Ser Arg Arg Ser Ser Arg Val Glu Asp Asp
35 40 45
Glu Glu Ala Leu Lys Trp Ala Ala Ile Glu Arg Leu Pro Thr Tyr Asp
50 55 60
Arg Leu Arg Thr Ser Ile Met Gln Ser Phe Val Asp His Glu Ile Ile
65 70 75 80
Gly Asn Lys Met Glu His Arg Glu Val Asp Val Arg Asn Leu Asp Met
85 90 95
Asn Asp Arg Gln Lys Phe Ile Asp Met Leu Phe Lys Val Ala Glu Glu
100 105 110
Asp Asn Glu Lys Phe Leu Lys Lys Phe Arg Asn Arg Ile Asp Lys Val
115 120 125
Gly Ile Thr Leu Pro Thr Val Glu Val Arg Phe Asn His Leu Thr Ile
130 135 140
Glu Ala Asp Cys Tyr Val Gly Ser Arg Ala Leu Pro Thr Leu Val Asn
145 150 155 160
Ser Ala Arg Asn Leu Ala Glu Ser Ala Leu Gly Leu Leu Gly Ile Ser
165 170 175
Phe Ala Lys Lys Ala Asn Leu Thr Ile Leu Lys Asp Ala Ser Gly Ile
180 185 190
Ile Lys Pro Ser Arg Met Thr Leu Leu Leu Gly Pro Pro Ser Ser Gly
195 200 205
Lys Thr Thr Leu Leu Leu Ala Leu Ala Asp Lys Leu Asp Pro Ser Leu
210 215 220
Arg Val Lys Gly Glu Val Thr Tyr Asn Gly Tyr Lys Leu Lys Glu Phe
225 230 235 240
Val Ala Arg Lys Thr Ser Ala Tyr Ile Ser Gln Asn Asp Val His Val
245 250 255
Gly Glu Met Thr Val Lys Glu Thr Leu Asp Phe Ser Ala Arg Cys Gln
260 265 270
Gly Val Gly Thr Arg Tyr Asp Leu Leu Ser Glu Leu Ala Arg Arg Glu
275 280 285
Lys Asp Ala Gly Ile Phe Pro Glu Ala Asp Val Asp Leu Phe Met Lys
290 295 300
Ala Thr Ser Val Glu Gly Ile Glu Ser Ser Leu Ile Thr Asp Tyr Thr
305 310 315 320
Leu Lys Ile Leu Gly Leu Asp Ile Cys Lys Asp Ile Ile Val Gly Asp
325 330 335
Glu Met Gln Arg Gly Ile Ser Gly Gly Gln Lys Lys Arg Val Thr Thr
340 345 350
Gly Glu Met Ile Val Gly Pro Thr Lys Thr Leu Phe Met Asp Glu Ile
355 360 365
Ser Thr Gly Leu Asp Ser Ser Thr Thr Tyr Gln Ile Val Lys Cys Leu
370 375 380
Gln Gln Val Val His Leu Thr Glu Gly Thr Ile Leu Met Ser Leu Leu
385 390 395 400
Gln Pro Ala Pro Glu Thr Tyr Asp Leu Phe Asp Asp Ile Ile Leu Leu
405 410 415
Ser Glu Gly Gln Ile Val Tyr Gln Gly Pro Arg Glu His Val Val Glu
420 425 430
Phe Phe Glu Ser Cys Gly Phe Lys Cys Pro Glu Arg Lys Gly Thr Ala
435 440 445
Asp Phe Leu Gln Glu Val Thr Ser Lys Lys Asp Gln Glu Gln Tyr Trp
450 455 460
Ala Asp Lys Arg Lys Pro Tyr Arg Tyr Ile Thr Val Thr Glu Phe Ala
465 470 475 480
Asn Arg Phe Lys His Phe His Val Gly Met Gln Leu Gln Ser Glu Leu
485 490 495
Ala Val Pro Phe Asp Lys Ser Arg Gly His Arg Ala Ala Leu Ala Phe
500 505 510
Gln Lys Tyr Ser Met Ser Lys Met Glu Leu Leu Lys Ala Cys Trp Asp
515 520 525
Lys Glu Trp Leu Leu Ile Lys Arg Asn Ser Phe Ile Tyr Val Phe Lys
530 535 540
Thr Val Gln Ile Ile Ile Val Ala Phe Ile Ser Ser Thr Val Phe Leu
545 550 555 560
Arg Thr Glu Met His Gln Arg Asp Leu Asn Asp Ala Gln Leu Tyr Ile
565 570 575
Gly Ser Leu Leu Phe Gly Met Ile Ile Asn Met Phe Asn Gly Phe Ala
580 585 590
Glu Leu Ser Leu Met Ile Ser Arg Leu Pro Val Phe Tyr Lys Gln Arg
595 600 605
Asp Leu Leu Phe His Pro Val Trp Thr Phe Thr Leu Pro Thr Phe Leu
610 615 620
Leu Arg Val Pro Ile Ser Ile Leu Glu Thr Val Ala Trp Met Ala Val
625 630 635 640
Thr Tyr Tyr Thr Val Gly Tyr Ala Pro Glu Ala Ser Arg Phe Phe Lys
645 650 655
Asn Phe Leu Leu Val Phe Ser Val Gln Gln Met Ala Ser Gly Leu Phe
660 665 670
Arg Leu Ile Ala Gly Leu Cys Arg Thr Met Ile Ile Ala Asn Thr Gly
675 680 685
Gly Val Leu Thr Leu Leu Leu Val Phe Leu Leu Gly Gly Phe Ile Ile
690 695 700
Pro Lys Arg Glu Ile Pro Ser Trp Trp Glu Trp Ala His Trp Ile Ser
705 710 715 720
Pro Leu Thr Tyr Gly Phe Asn Ala Phe Thr Val Asn Glu Met Phe Ala
725 730 735
Ser Arg Trp Met Asn Arg Gln Val Ser Asn Ser Ser Thr Ser Leu Gly
740 745 750
Leu Gln Val Leu Asp Ser Phe Asp Val Pro Asn Asp Glu Asn Trp Tyr
755 760 765
Trp Ile Gly Ala Gly Ala Leu Leu Gly Phe Ala Val Leu Phe Asn Ile
770 775 780
Leu Phe Thr Phe Ala Leu Ile Tyr Leu Ser Pro Leu Gly Lys Pro Gln
785 790 795 800
Ala Ile Ile Ser Glu Glu Thr Val Glu Glu Leu Glu Ala Asn Asn Val
805 810 815
Asp Ser Asn Glu Glu Pro Arg Leu Met Arg Pro Glu Ser Ser Lys Tyr
820 825 830
Ser Phe Ser Ala Asp Ala Ser Asn Ala Val Glu Met Glu Ile Arg Arg
835 840 845
Met Ser Ser Arg Ala Asp Ser His Gly Met Ser Arg Asn Asp Ser Gln
850 855 860
Val Asp Ala Ala Thr Gly Val Ala Pro Lys Arg Gly Met Val Leu Pro
865 870 875 880
Phe Thr Pro Leu Ala Met Ser Phe Asp Thr Val Asp Tyr Tyr Val Asp
885 890 895
Met Pro Pro Glu Met Lys Ala Gln Gly Val Gly Glu Asp Arg Leu Gln
900 905 910
Leu Leu Arg Gly Val Thr Gly Ala Phe Arg Pro Gly Val Leu Thr Ala
915 920 925
Leu Met Gly Val Ser Gly Ala Gly Lys Thr Thr Leu Met Asp Val Leu
930 935 940
Ala Gly Arg Lys Thr Gly Gly Tyr Ile Glu Gly Asp Ile Arg Ile Ser
945 950 955 960
Gly Phe Pro Lys Lys Gln Glu Thr Phe Ala Arg Ile Ser Gly Tyr Cys
965 970 975
Glu Gln Thr Asp Ile His Ser Pro Gln Val Thr Ile Arg Glu Ser Leu
980 985 990
Ile Tyr Ser Ala Phe Leu Arg Leu Pro Lys Glu Ile Ser Asn Glu Glu
995 1000 1005
Lys Met Ile Phe Val Asp Glu Val Met Glu Leu Val Glu Leu Ser Asn
1010 1015 1020
Leu Lys Asp Ala Ile Val Gly Leu Pro Gly Val Thr Gly Leu Ser Thr
1025 1030 1035 1040
Glu Gln Arg Lys Arg Leu Thr Ile Ala Val Glu Leu Val Ala Asn Pro
1045 1050 1055
Ser Ile Ile Phe Met Asp Glu Pro Thr Ser Gly Leu Asp Ala Arg Ala
1060 1065 1070
Ala Ala Ile Val Met Arg Thr Val Arg Asn Thr Val Asp Thr Gly Arg
1075 1080 1085
Thr Val Val Cys Thr Ile His Gln Pro Ser Ile Asp Ile Phe Glu Ala
1090 1095 1100
Phe Asp Glu Leu Leu Leu Met Lys Arg Gly Gly Gln Val Ile Tyr Ser
1105 1110 1115 1120
Gly Pro Leu Gly Arg Asn Ser His Lys Ile Ile Glu Tyr Phe Glu Ala
1125 1130 1135
Ile Pro Gly Val Pro Lys Ile Lys Glu Lys Tyr Asn Pro Ala Thr Trp
1140 1145 1150
Met Leu Glu Val Ser Ser Ile Ala Ala Glu Val Arg Leu Gly Ile Asp
1155 1160 1165
Phe Ala Glu His Tyr Lys Ser Ser Ser Leu Tyr Gln Arg Asn Lys Ala
1170 1175 1180
Leu Val Asn Glu Leu Ser Thr Pro Pro Pro Gly Ala Lys Asp Leu Tyr
1185 1190 1195 1200
Phe Ala Thr Gln Tyr Ser Gln Thr Thr Leu Gly Gln Phe Lys Ser Cys
1205 1210 1215
Phe Trp Lys Gln Trp Trp Thr Tyr Trp Arg Ser Pro Asp Tyr Asn Leu
1220 1225 1230
Val Arg Tyr Phe Phe Thr Leu Val Thr Ala Leu Leu Val Gly Ser Ile
1235 1240 1245
Phe Trp Gln Ile Gly Thr Asp Arg Ser Lys Ala Ser Asp Leu Thr Met
1250 1255 1260
Ile Ile Gly Ala Met Tyr Ala Ala Val Ile Phe Val Gly Ile Asn Asn
1265 1270 1275 1280
Cys Ser Thr Val Gln Pro Val Ile Ala Ile Glu Arg Thr Val Phe Tyr
1285 1290 1295
Arg Glu Arg Ala Ala Gly Met Tyr Ser Ala Leu Pro Tyr Ala Leu Ala
1300 1305 1310
Gln Val Leu Cys Glu Ile Pro Tyr Val Phe Gly Gln Thr Val Tyr Tyr
1315 1320 1325
Thr Leu Ile Val Tyr Ala Met Val Gly Phe Gln Trp Thr Val Ala Lys
1330 1335 1340
Tyr Phe Trp Phe Phe Phe Val Ser Phe Phe Thr Phe Leu Tyr Phe Thr
1345 1350 1355 1360
Tyr Tyr Gly Met Met Thr Val Ser Ile Thr Pro Asn His Gln Ile Ser
1365 1370 1375
Ser Ile Phe Ala Ala Ala Phe Tyr Ser Val Phe Asn Leu Phe Ser Gly
1380 1385 1390
Phe Phe Ile Pro Arg Pro Arg Ile Pro Gly Trp Trp Ile Trp Tyr Tyr
1395 1400 1405
Trp Ile Cys Pro Val Ala Trp Thr Ile Tyr Gly Leu Ile Ala Ser Gln
1410 1415 1420
Tyr Gly Asp Leu Glu Asp Lys Ile Ser Val Pro Gly Val Ser Pro Asp
1425 1430 1435 1440
Pro Thr Ile Lys Ser Tyr Ile Lys Asp Gln Tyr Gly Tyr Asp Ser Asp
1445 1450 1455
Phe Met Gly Pro Val Ala Ala Val Leu Val Gly Phe Gly Val Phe Phe
1460 1465 1470
Ala Thr Leu Phe Ala Tyr Cys Ile Arg Thr Leu Asn Phe Gln Thr Arg
1475 1480 1485
<210> 2
<211> 4467
<212> DNA
<213> Cotton (Gossypium spp)
<400> 2
atggatggtt tagaaagagt tcgaagtcga aatcccagca gaagaacggg gcatagcagc 60
atagggagga gcttaagtag gagtagttgg aacatggaag atgtgttttc aggttccaga 120
agaagtagcc gtgtggaaga tgatgaagaa gctctaaaat gggctgctat cgagagacta 180
cccacatatg atcggctgag gacaagcatc atgcagtcct ttgtggatca tgaaatcatt 240
ggcaacaaga tggaacatag agaggttgat gttagaaacc ttgacatgaa cgacagacaa 300
aaattcatcg acatgctctt caaggttgct gaggaagata atgagaaatt cttgaagaag 360
ttcagaaaca ggatcgataa ggttgggatt acacttccaa cagtagaagt tagattcaac 420
catctgacga ttgaagccga ctgctacgtt ggcagcagag ctcttccaac tcttgtaaac 480
tctgctagaa accttgcaga atcggctctt ggcctccttg gaatcagttt tgccaagaaa 540
gcaaacctca caattcttaa agatgcttct gggattatta aaccatcaag gatgacactc 600
ttactaggcc caccctcttc tgggaaaaca acccttttgc tggcattggc cgataagttg 660
gacccaagct taagggttaa aggagaagtc acatacaacg gatataaact aaaggaattt 720
gttgctagaa agacatccgc atatatcagt caaaatgatg ttcatgtcgg agaaatgaca 780
gtgaaagaaa ccttggattt ctcagcaaga tgtcagggtg ttgggacacg atacgatctg 840
ttaagtgagc ttgctagaag ggaaaaagat gcagggattt tcccagaagc tgatgtagac 900
cttttcatga aggcaacttc agtggaagga attgaaagca gccttatcac tgattacaca 960
ctcaaaatat tggggctcga catatgcaag gatatcatcg ttggagacga gatgcagcgt 1020
ggaatttccg gaggtcaaaa gaaaagagta acaacagggg agatgattgt tggtcccacc 1080
aagacactat tcatggatga aatatcaacg ggtcttgata gttccacgac ataccagata 1140
gtgaagtgct tgcagcaggt tgtgcaccta acagagggca caatcttgat gtcactattg 1200
cagcctgctc cagagactta cgatctcttt gatgatatca tcctcttatc tgagggtcaa 1260
attgtctatc aaggtccacg agaacacgtt gttgagttct ttgagagctg tggtttcaaa 1320
tgtcccgaga ggaaaggaac tgctgacttt ttgcaagagg ttacctcaaa gaaggaccaa 1380
gaacaatatt gggcggacaa aagaaagcca tacagataca ttacagtaac tgaatttgca 1440
aacaggttca agcacttcca tgtcggaatg cagctacaga gtgagctagc tgtgcctttc 1500
gacaagtcaa gaggccaccg agcggcattg gccttccaga aatactctat gtccaaaatg 1560
gagcttctta aggcctgttg ggacaaagaa tggctattga tcaaaaggaa ttcttttatt 1620
tatgtgttta agacggtcca aattatcatc gtggcattca tctcgtctac tgtctttttg 1680
agaactgaaa tgcaccagag ggatttgaac gatgcgcaac tctatattgg ctcacttctg 1740
tttggaatga tcatcaacat gttcaatggc ttcgctgagc tctcccttat gattagtagg 1800
cttccagtgt tctacaagca aagagacctc ttattccacc ctgtctggac tttcactctg 1860
cccactttct tgctccgggt tccgatatct attttggaaa cagttgcttg gatggctgta 1920
acttattaca ctgtaggata tgcacctgag gccagcaggt ttttcaaaaa cttcctgttg 1980
gtgttttcag tacaacaaat ggcatctggt ctatttcggc tcattgccgg attatgcaga 2040
acaatgatca tagctaacac tggtggggtt cttacacttc tcctcgtgtt cttgctggga 2100
ggtttcatca ttcctaaacg tgaaattcca agttggtggg agtgggctca ctggatttca 2160
cctttgactt acggtttcaa tgcctttact gtgaatgaaa tgtttgcgtc aaggtggatg 2220
aatagacagg tttcaaacag ttcgactagc ctggggctac aagtgcttga tagctttgat 2280
gtcccaaacg atgaaaactg gtattggatt ggtgcaggtg ctcttctagg gttcgcagtg 2340
ctcttcaaca ttctcttcac ctttgcgctt atatacttaa gcccccttgg aaagccgcag 2400
gctataattt cggaggaaac ggtggaagag ctagaggcta ataatgtgga ttctaatgaa 2460
gaaccaaggt taatgagacc agaatcgagt aaatattcat tctctgcaga tgcaagcaat 2520
gcagtagaaa tggaaatccg aagaatgagc agtcgagctg attcccacgg aatgagcagg 2580
aatgattctc aagttgatgc agccactggt gttgccccaa agagaggaat ggttcttccc 2640
ttcactcctc tagcaatgtc ttttgacact gtcgattact acgttgatat gccacctgaa 2700
atgaaggcac aaggagttgg tgaggatagg ttacaactac ttcggggagt aacaggtgca 2760
tttaggcctg gagtgttgac tgcattgatg ggagtcagtg gagcagggaa gacaacattg 2820
atggatgttc tagcaggaag aaagaccggt ggatatattg agggtgatat cagaatatcc 2880
ggattcccaa agaaacaaga aacctttgca agaatttctg gatactgtga acaaactgat 2940
attcactcac cacaagtgac tatcagagaa tccttaattt actcagcatt cctacgactt 3000
ccaaaagaaa tcagcaacga ggaaaagatg attttcgtgg atgaagtaat ggaactagta 3060
gaattaagca atctcaagga tgccatagta gggttgcctg gagtcacagg gttgtcaaca 3120
gagcaaagaa agaggttaac aattgcagta gagcttgttg ctaatccctc gatcattttc 3180
atggatgaac cgacatccgg tcttgatgcg agggcagcag ccattgtcat gaggactgtc 3240
agaaacaccg tggacaccgg aagaacggtt gtctgcacca ttcatcagcc tagtattgat 3300
atctttgaag cctttgatga attgctacta atgaagagag gaggtcaggt gatttactcc 3360
ggaccattag gccgaaattc tcataagatc atcgaatatt ttgaggcaat tcctggagtt 3420
cccaaaatta aggaaaagta taatccagct acatggatgt tagaagtgag ctctatagca 3480
gctgaagtta ggctcggaat tgattttgct gaacactaca aatcatcttc cttgtatcag 3540
agaaacaagg cgttagtaaa tgagttaagc acaccacctc caggagctaa agacctctat 3600
tttgccactc agtactcaca aactacattg ggtcaattca aatcatgctt ttggaaacaa 3660
tggtggactt actggagaag tccagattat aaccttgtca gatacttctt cactttggtc 3720
actgctctct tggttggttc tattttctgg cagatcggca ctgacaggag taaagcatct 3780
gatcttacaa tgatcatcgg tgcaatgtat gctgcagtca tatttgttgg aatcaataac 3840
tgctcaacag ttcaaccagt catagccatt gaaagaacag tgttctatcg tgaaagagct 3900
gctgggatgt actctgcatt accttatgcc cttgcgcagg tgctttgtga aataccttac 3960
gtatttggcc aaaccgtata ctatacactt atagtgtatg ccatggtggg ctttcaatgg 4020
acagtggcaa agtacttctg gtttttcttt gtcagcttct tcaccttcct ttactttaca 4080
tactacggaa tgatgactgt ttcgatcaca ccaaaccatc aaatatcatc tatatttgct 4140
gcagcattct attcagtctt taatcttttc tccggcttct tcattccaag accaagaatt 4200
cctggttggt ggatctggta ttactggatt tgcccggttg catggacaat ttacggattg 4260
attgcgtcac aatatggaga tcttgaagac aaaattagtg tacctggcgt ctctcctgac 4320
cctactatta agtcgtatat taaagatcag tacggctatg attcagactt catggggcca 4380
gttgctgcag ttttggttgg ctttggagta ttttttgcca ctttgtttgc ctactgcata 4440
aggacactca atttccagac cagataa 4467
Claims (2)
1. The application of the silencing vector of the cotton gene GhABC in the aspect of negative regulation of cotton verticillium wilt resistance is characterized in that the cotton gene GhABC encodes a protein with an amino acid sequence shown in SEQ ID No. 1.
2. The use of claim 1, wherein the cotton gene GhABC has the nucleotide sequence shown in SEQ ID No. 2.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2018115093492 | 2018-12-10 | ||
CN201811509349 | 2018-12-10 |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109705201A CN109705201A (en) | 2019-05-03 |
CN109705201B true CN109705201B (en) | 2022-04-08 |
Family
ID=66265342
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910144715.7A Active CN109705201B (en) | 2018-12-10 | 2019-02-27 | Cotton verticillium wilt resistance related gene GhABC and coding protein and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109705201B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110343157B (en) * | 2019-07-31 | 2022-06-28 | 新疆农业科学院核技术生物技术研究所(新疆维吾尔自治区生物技术研究中心) | Cotton verticillium wilt related gene GhBONI and encoding protein and application thereof |
CN110499318B (en) * | 2019-09-05 | 2022-02-25 | 中国农业科学院棉花研究所 | Application of cotton verticillium wilt resistance related gene GhDEK |
CN110592099B (en) * | 2019-09-22 | 2022-02-25 | 中国农业科学院棉花研究所 | Application of cotton verticillium wilt resistance-related gene GhHMGB2 |
CN110923250B (en) * | 2019-11-13 | 2021-12-24 | 中国农业科学院棉花研究所 | Application of cotton verticillium wilt resistance related gene GhSDH1-1 |
CN112851783B (en) * | 2021-04-16 | 2021-08-31 | 中国农业科学院植物保护研究所 | Upland cotton GhCM2 protein and coding gene and application thereof |
CN114381466A (en) * | 2022-01-13 | 2022-04-22 | 新疆农业大学 | Coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton and application |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104805095A (en) * | 2014-12-18 | 2015-07-29 | 中国农业科学院棉花研究所 | Application of cotton verticillium wilt pathogenicity-related gene CYC8 |
CN108103042A (en) * | 2017-12-11 | 2018-06-01 | 中国农业科学院棉花研究所 | Receptor-like protein ki-nase GhPR5K relevant with resisting verticillium and its encoding gene and its application |
-
2019
- 2019-02-27 CN CN201910144715.7A patent/CN109705201B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104805095A (en) * | 2014-12-18 | 2015-07-29 | 中国农业科学院棉花研究所 | Application of cotton verticillium wilt pathogenicity-related gene CYC8 |
CN108103042A (en) * | 2017-12-11 | 2018-06-01 | 中国农业科学院棉花研究所 | Receptor-like protein ki-nase GhPR5K relevant with resisting verticillium and its encoding gene and its application |
Non-Patent Citations (3)
Title |
---|
HISTONE MONOUBIQUITINATION1 Interacts with a Subunit of the Mediator Complex and Regulates Defense against Necrotrophic Fungal Pathogens in Arabidopsis;Rahul Dhawan等;《The Plant Cell》;20090331;第1000-1019页 * |
NCBI Reference Sequence: XM_016822785.1;NCBI;《NCBI》;20160518;第1-3页 * |
NCBI Reference Sequence: XP_016678274.1;NCBI;《NCBI》;20160518;第1-2页 * |
Also Published As
Publication number | Publication date |
---|---|
CN109705201A (en) | 2019-05-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109705201B (en) | Cotton verticillium wilt resistance related gene GhABC and coding protein and application thereof | |
CN109706132B (en) | Cotton verticillium wilt resistance-related protein GhMAPK13 as well as coding gene and application thereof | |
US11920143B2 (en) | Plasmid combination, recombinant agrobacterium tumefaciens, and method for improving Phytophthora resistance of plants | |
CN108314714B (en) | Verticillium dahliae secretory protein elicitor VdPE L1 and application thereof | |
CN101265294A (en) | Disease-resistant correlated wheat MYB albumen, coding gene and application thereof | |
CN110343157B (en) | Cotton verticillium wilt related gene GhBONI and encoding protein and application thereof | |
CN112175056B (en) | OsABCG48 gene and application thereof in improving cadmium stress resistance of unicellular organisms and plants | |
CN110256549A (en) | Plant disease-resistant Protein G hWRKY40 and encoding gene and its application | |
CN106146634B (en) | Plant disease-resistant protein B jMYB9 and its encoding gene and application | |
CN112662692A (en) | Peanut cysteine protease coding gene AhRD21A, and expression vector and application thereof | |
CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
CN110938118B (en) | Plant immune activation protein PC2 secreted by phytophthora infestans and application thereof | |
CN114437188B (en) | Phytophthora litchii secreted protein exciton PlPeL8 and application thereof | |
CN117660478A (en) | Gene for improving resistance of potatoes to late blight and application thereof | |
CN113337536B (en) | Application of RS2Z32 gene as plant immune negative regulatory factor in improving crop resistance | |
CN110923250B (en) | Application of cotton verticillium wilt resistance related gene GhSDH1-1 | |
CN110862996A (en) | Application of isolated soybean gene in improving soybean cyst nematode resistance | |
CN109207483B (en) | Watermelon disease-resistant gene Cltlp3 and coding protein and application thereof | |
CN115073573B (en) | Sweet potato stress resistance related protein IbNAC087, and coding gene and application thereof | |
CN110499318B (en) | Application of cotton verticillium wilt resistance related gene GhDEK | |
CN110592099B (en) | Application of cotton verticillium wilt resistance-related gene GhHMGB2 | |
CN112538107B (en) | Triterpene related protein, encoding gene thereof and application of triterpene related protein in improving content of triterpene compounds in plants | |
KR101460743B1 (en) | Disease resistance-related gene CaChitIV, and transgenic plants using the same | |
CN114805520B (en) | Stress resistance related protein IbGT1, encoding gene and application thereof | |
CN114250230B (en) | Application of soybean histone demethylase GmJMJ30-2 in regulation and control of plant stress tolerance |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |