CN109700824A - Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury - Google Patents
Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury Download PDFInfo
- Publication number
- CN109700824A CN109700824A CN201910015995.1A CN201910015995A CN109700824A CN 109700824 A CN109700824 A CN 109700824A CN 201910015995 A CN201910015995 A CN 201910015995A CN 109700824 A CN109700824 A CN 109700824A
- Authority
- CN
- China
- Prior art keywords
- mir
- blood vessel
- expression
- vessel endothelium
- rasa1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to field of biotechnology, application of the specifically miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury.The present invention also provides the purposes of RASA1 inhibitor, and the method for screening the potential substance for the treatment of of vascular endothelial injuries.The invention firstly discloses the expression of vascular endothelial cell miR-31 and blood vessel endothelium injury are closely related, and disclosing miR-31 and the like for the first time can be by inhibiting the expression of RASA1 gene to inhibit the vascular endothelial cell damage as caused by Angiotensin II, so that the prevention and treatment for blood vessel endothelium injury provides new target spot.
Description
Technical field
The present invention relates to field of biotechnology, specifically, being a kind of miR-31 and the like in preparation prevention or controlling
Treat the application in the drug of blood vessel endothelium injury.
Background technique
Microrna (microRNA, miRNA) is that one kind of discovered in recent years is non-with active small molecule is adjusted after transcription
Coding RNA.Most of miRNAs is located in the introne of gene, transcribes with the transcription of host gene, has with host gene
Similar express spectra；Another part clusters existing miRNAs, can individually transcribe.MiRNAs gene is through II turn of RNA polymerase
Record forms Pri-miRNA, then shears through Drosha, forms the Pre-miRNA with hairpin structure；Exportin 5 by its
After endochylema is transported to from karyon, sheared through Dicer enzyme, Cheng Shuanlian miRNA molecule；Finally, double-strand separates, one is degraded, separately
One become maturation miRNAs, and with other molecules together form RNA induce silencing complex (RISC), RISC by with
Said target mrna 3 ' end noncoding region (3'untranslation region, 3'UTR) interaction, make its translation process block or
Cause the degradation of said target mrna, thus in the expression of post-transcriptional level negativity regulatory protein matter.Currently with the development of sequencing technologies
With the building of miRNA cDNA library, the mankind have grasped the sequence information of a large amount of miRNA, by giving birth to these sequences
Object informatics compares analysis, and discovery major part miRNA is highly conserved between species, in upper very high homology of evolving.
Existing lot of documents reports miRNA and can be given birth to by apoptosis, proliferation, metabolism, the differentiation etc. for influencing cell in recent years
Object process participates in the occurrence and development for adjusting cardiovascular disease.The past research demonstrates miRNA can be by influencing withering for cell
The occurrence and development that biological processes regulate and control a variety of diseases with this such as die, be proliferated, being metabolized, breaking up.MiR-31 is in numerous Cancerous diseases
In played important function.There are some researches prove miR-31 to have regulated and controled cell Proliferation, migration and invasion in breast cancer and oophoroma
Biological process.Also some researches show that miR-31 to have participated in epithelial cell proliferation and the tumour generation of lung cancer and colon cancer
To play carcinogenesis.MiR-31 is not only the important regulator of generally acknowledged tumor development, in terms of other diseases
Also no small effect is played.The expressing promoting with miR-31 during skin wound healing is formed in cirrhosis according to research reports
Into the development of fibrosis.In terms of cardiovascular disease, existing research finds miR-31 in myocardial fibrosis, and vascular smooth muscle is thin
Born of the same parents' (vascular smooth muscle cells, VSMCs) Phenotypic Change and myocardial ischemia/reperfusion injury, which have, to be adjusted
Section effect.And miR-31 is not yet illustrated in the effect of endothelial dysfunction and mechanism.
Summary of the invention
The purpose of the present invention is to provide the purposes of miR-31 and the like a kind of, at the same provide a kind of screening prevention or
Treat the method for the potential substance of blood vessel endothelium injury and the side of a kind of prevention or treatment mammalian Vascular Endothelial damage
Method.
The invention firstly discloses miR-31 skin lesion in the blood vessels wound effect and and mechanism, to cause for a variety of causes
Blood vessel endothelium injury so that the prevention of disease that participates in of most of blood vessel endothelium injuries or treatment effective way is provided
Diameter.
The first aspect of the present invention provides miR-31 and the like in preparation prevention or the medicine for the treatment of blood vessel endothelium injury
Application in object.
Further, the miR-31 has the sequence as shown in AGGCAAGATGCTGGCATAGCT (SEQ ID NO.1)
Column.
Further, the miR-31 analog includes the short nucleotide etc. synthesized in vitro.
Further, the analog of the miR-31 is also possible to the form by modification.
As preferred embodiment of the invention, the miR-31 analog is the nucleotide sequence synthesized in vitro；Or sequence
It arranges and (preferably has 85% or more the phase same sex with 80% or more the phase same sex with its nucleotide sequence, more preferably have
90% or more the phase same sex most preferably has 95% or more the phase same sex, as with 96%, 97%, 98% or 99% or more
The phase same sex)；They all have the identical function of miR-31 nucleotide sequence.
In another preference of the invention, table of described miR-31 and the like in preparation regulation RASA1 gene
The application in drug reached.
In another preference of the invention, described miR-31 and the like reduces the damage of vascular endothelial cell.
In another preference of the invention, the blood vessel endothelium injury is selected from vascular endothelial cell damage.
In another preference of the invention, the blood vessel endothelium injury is selected to be caused by the stimulation of Angiotensin II
Vascular endothelial cell damage.
The second aspect of the present invention provides a kind of RASA1 inhibitor in preparation prevention or the medicine for the treatment of blood vessel endothelium injury
Application in object.
In a preference of the invention, the RASA1 inhibitor is miR-31 and the like.
Further, the seed sequence of 3 ' UTR region of the miR-31 and RASA1 is bound directly.
The third aspect of the present invention provides the expression for increasing miR-31 or active reagent in preparation prevention or treatment blood vessel
Application in the drug of endothelial injuries.
Further, the expression of the increase miR-31 or active reagent include following any: can increase miR-31
Activity, enhancing miR-31 stability, promote miR-31 expression, increase miR-31 effective acting time or promote miR-
31 transcription and the substance of processing.
The fourth aspect of the present invention, provides a kind of pharmaceutical composition, and the pharmaceutical composition contains a effective amount of described
MiR-31 or its analog and pharmaceutically acceptable carrier.
The fifth aspect of the present invention provides a kind of method of screening prevention or the potential substance for treating blood vessel endothelium injury,
The method includes:
(A) system of expression miR-31 is handled with candidate substances；With
(B) expression or activity of miR-31 in the system are detected；
Wherein, if the candidate substances can increase the expression or activity of miR-31, show that the candidate substances are preventions or control
Treat the potential substance of blood vessel endothelium injury.
In a preference of the invention, step (A) includes: that candidate substances are added to expression or suppression in test group
In the system of miR-31 processed；And/or
Step (B) includes: the expression or activity of miR-31 in the system for detect test group, and compared with the control group, wherein
The control group is the expression for not adding the candidate substances or the system for inhibiting miR-31；
If in test group miR-31 expression or activity statistically be higher than (be preferably significantly higher than, such as high 1 times with
On) control group, indicate that the candidate is the potential substance of prevention or treatment blood vessel endothelium injury.
In another preference of the invention, the method further include: the potential substance of acquisition is carried out further
Cell experiment and/or animal experiment, further to select and determine for preventing or treating intravascular skin lesion from candidate substances
Hurt useful substance.
The sixth aspect of the present invention provides a kind of method prevented or treatment mammalian Vascular Endothelial damages, the side
Method includes: the expression of the up-regulation miR-31 in the mammalian body to inhibit the generation of blood vessel endothelium injury.
In the present invention:
MiR-31
MiRNA-31 (miR-31) is a kind of miRNA small molecule known in the art, is useful for rna regulation.
However, not known at present for the specific biological function in miR-31 in the blood vessels chrotoplast in the prior art.
MiR-31 has the sequence as shown in AGGCAAGATGCTGGCATAGCT (SEQ ID NO.1).It can come from by
Cell is separated, or can be obtained by artificial synthesized mode.After knowing the sequence of miR-31, those skilled in the art can be square
Just miR-31 and the like is prepared.
The purposes of MiR-31
Research finds that miR-31 participates in the stress reaction of heart by insulin -1, adjusts external membrane of heart mesothelium epithelium to filling
Qualitative change promotees the myofibroblast like cell of fibrosis development to generate；MiR-31 can directly with E1A stimulated gene (CREG)
Cell repressor combine, cell differentiation is retained in this by mature phenotypic status, thus adjusting vascular smooth muscle cells
(VSMC) it is played a crucial role in phenotype, coronary artery is narrow again after patients with coronary artery disease percutaneous coronary intervention (pci)
Narrow generation is related with VSMC Phenotypic Change, and VSMC at this time is converted after injury of blood vessel from shrinkage type to synthesis type, and PCI is postoperative
MiR-31 level increases in patients serum；Recent studies have found that by targeting bindin kinase C ε (PKC ε), miR-31 expression
Lower has cardioprotection during ischaemic/reperfusion injury.However the chrotoplast damage side in the blood vessels miR-31
The effect in face and mechanism have not been reported.The present invention establishes vascular endothelial cell using Ang II induced medium culture HUVECs
The cell model of damage, discovery Ang II can cause the decline of HUVECs vigor, increasing apoptosis more, illustrate endothelial cell damage；Together
When qRT-PCR detection discovery miR-31, miR-384 and miR-590 expression is obvious lowers, the obvious up-regulation of miR-155 expression, miR-
126, miR-200 and miR-221 are without significant change.Wherein miR-31 upon administration 24 hours when cellular damage most serious.
The present inventor is by tri- kinds of forecasting softwares of PicTar, TargetScan and miRDB to the potential target gene of miR-31
It is predicted.There are binding sites in 3 ' UTR sequences of many genes by miR-31 as the result is shown, wherein 47 genes can be by 3
Kind bioinformatics predicts jointly, as shown in Figure 4 A.Functional analysis is carried out to these target genes by GO analysis.As the result is shown
The potential target gene of miR-31 is primarily targeted for cytoplasm；Be primarily involved in Cellular Signaling Transduction Mediated exchanged with cell-tocell etc. it is raw
Object process；The active molecular function of major regulatory cell trafficking protein (Fig. 4 B).The letter of these target genes is analyzed by KEGG
Number access is as the result is shown: being primarily involved in the transmembrane transport (Fig. 4 C) of active material.Bioinformatic analysis shows RASA1 gene
There are the potential binding site of miR-31 on 3 ' UTR, and affinity with higher (Fig. 5 A)；In people, mouse, rat and black orangutan
In the gene order of the evolution species such as orangutan completely conservative (Fig. 5 B).RASA1 gene (5q13.3) is by 1047 amino acid residue structures
At codified p120GAP albumen belongs to RAS-GAP family.RAS gene mutation causes the state of activation and RAS letter of RAS-GTP
The opening of number pathway enhances cell anti-apoptotic activities and vicious transformation to promote cell Proliferation, in liver cancer, colon
Discovery RASA1 expression significantly reduces in the multiple cancerous tissues such as cancer.
The present invention confirms RASA1 gene by dual-luciferase reporter system and western blot detection jointly
3 ' UTR on there are the binding sites of miR-31.Rescue inhibits Ang the experiment proves that miR-31 is lowered by the expression of RASA1
The apoptotic effect of the HUVECs of II induction.
The invention firstly discloses the effects and mechanism in miR-31 in the blood vessels chrotoplast, thus for the pre- of this kind of disease
Anti- or treatment provides effective approach.
MiR-31 analog and application thereof
The present inventor has found that the abnormal expression of miR-31 participates in blood vessel endothelium injury after extensive studies it.MiR-31 is simulated
Object, miR-31 mortifier and its reference material transfect HUVECs respectively, and identify Successful transfection by qRT-PCR, by Successful transfection
HUVECs carry out biological function detection: plate scratch experiment detection display miR-31 analogies enhance cell migration energy
Power；CCK-8 method detection display miR-31 analogies enhance cells growth activity；Flow cytomery shows miR-31 simulation
Object reduces Apoptosis, and the effect of miR-31 mortifier is opposite.
As used in the present invention, the miR-31 analog includes the short nucleotide etc. synthesized in vitro.It is any to increase
Add miR-31 activity, enhancing miR-31 stability, promote miR-31 expression, increase miR-31 effective acting time or
The substance of transcription and processing of miR-31 is promoted to be used equally for the present invention, as can be used for preventing or treating blood vessel endothelium injury
Active principle.The analog of the miR-31 is also possible to the form by modification.
After knowing miR-31 for the effect of blood vessel endothelium injury, those skilled in the art learn in which can be convenient to lead to
Cross generation or development that miR-31 analog carrys out treatment of vascular endothelial injuries.Therefore, any miR-31 analog can be used in this
Invention.According to the characteristic of miR-31, those skilled in the art can obtain a variety of miR-31 analogs.
The analog of the miR-31 for example including but be not limited to short nucleotide.
As preferred embodiment of the invention, the miR-31 analog is the nucleotide sequence synthesized in vitro；Or sequence
It arranges and (preferably has 85% or more the phase same sex with 80% or more the phase same sex with its nucleotide sequence, more preferably have
90% or more the phase same sex most preferably has 95% or more the phase same sex, as with 96%, 97%, 98% or 99% or more
The phase same sex)；They all have the identical function of miR-31 nucleotide sequence.
Screening technique
After the correlation for knowing the miR-31 and blood vessel endothelium injury, adjusting can be screened based on this feature
The expression or activity of miR-31, and then prevention can be made or treat the substance of blood vessel endothelium injury.
Therefore, the present invention provides a kind of method screened and can be used for preventing or treating the potential substance of blood vessel endothelium injury,
The method includes: to contact candidate substances with the system of expression miR-31；Influence with detection candidate substances to miR-31；
If the candidate substances can increase the expression or activity of miR-31, indicate that the candidate is prevention or treatment blood vessel endothelium injury
Potential substance.In a preferred embodiment of the present invention, when being screened, in order to be more easily observable the expression or work of miR-31
Property change, also settable control group, the control group can be do not add the candidate substances expression miR-31 body
System.
The system includes but is not limited to: solution system, subcellular system, cell system, organizational framework, organ body
System or animal system.
As preferred embodiment of the invention, the method further include: the potential substance of acquisition is carried out further thin
Born of the same parents' experiment and/or animal experiment, further to select and determine for preventing or treating the actually useful object of blood vessel endothelium injury
Matter.
On the other hand, the present invention also provides what is obtained using the screening technique can be used for preventing or treating blood vessel endothelium
The potential substance of damage.The substance that these preliminary screenings go out may make up a screening library, in order to which people may finally therefrom sieve
Select actually useful substance.
Pharmaceutical composition
The present invention also provides a kind of pharmaceutical composition, the pharmaceutical composition contains a effective amount of miR-31
Analog and pharmaceutically acceptable carrier.
" pharmaceutically acceptable " ingredient is suitable for people and/or animal and without excessively bad side reaction (such as poison
Property, stimulation and allergy), that is, there is the substance of reasonable benefit/risk ratio.
" effective quantity " refers to can generate function or active and can be connect by people and/or animal to people and/or animal
The amount received.
" pharmaceutically acceptable carrier " refers to the carrier for Therapeutic Administration, including various excipient and dilution
Agent.The term refers to medicament carriers some in this way: themselves not being necessary active constituent, and does not have excessive poison after applying
Property.Suitable carrier is well known to those of ordinary skill in the art.In Remington ' s Pharmaceutical
Discussing fully about pharmaceutically acceptable excipient can be found in Sciences (Mack Pub.Co., N.J.1991).?
The upper acceptable carrier of combination of traditional Chinese medicine can contain liquid, such as water, salt water, glycerol and ethyl alcohol.In addition, may be used also in these carriers
Can there are complementary substance, such as filler, lubricant, glidant, wetting agent or emulsifier, pH buffer substance.
The effective quantity of miR-31 analog of the invention can be with the mode of administration and the severity of disease to be treated etc.
And change.Preferred a effective amount of selection can be determined depending on various factors by those of ordinary skill in the art (such as to be passed through
Clinical test).The factor includes but is not limited to: the pharmacokinetic parameter of miR-31 analog such as bioavailability,
Metabolism, half-life period etc.；Patient disease to be treated, the weight of patient, the immune state of patient, the approach of administration etc..It is adjustable
Dosage is saved to provide optimal treatment response.For example, can be given once daily separated several times by an urgent demand for the treatment of situation
Dosage, or dosage is reduced pari passu.
Any applicable administration route is all possible, including but not limited to: oral, intravenous injection, subcutaneous injection, flesh
Meat is given, administers locally to, being implanted into, being sustained and give, give in heart；Preferably, the administration mode is that non-bowel is given.
The invention has the advantages that:
The present inventor passes through in-depth study, and RASA1 gene expression can specifically be inhibited by disclosing miR-31 for the first time, and
And disclose for the first time miR-31 expression and blood vessel endothelium injury it is closely related, high-level AngII can reduce the expression of miR-31,
And then the inhibiting effect of RASA1 gene is weakened, the damage of vascular endothelial cell is caused, a series of diseases are caused.The present invention is
Blood vessel endothelium injury and new target spot is provided with the prevention and treatment of its disease mainly to show.
Detailed description of the invention
The HUVECs Establishing an injured model of Fig. 1 .Ang II induction.A is after flow cytomery Ang II is acted on
The case where HUVECs apoptosis, Ang II and Control respectively indicate the HUVECs of experimental group and control group, * * P < 0.01；B is
The variation of HUVECs apoptosis-related protein after Ang II effect；C is that CCK8 detects Ang II effect to the active shadow of HUVECs
It rings.Ang II and Control respectively indicate the HUVECs, OD: absorbance of experimental group and control group.* P < 0.01；D is Ang
The expression of miR-31 changes after HUVECs different time at II, * P < 0.05, * * P < 0.01.
Fig. 2 .Ang II handles miRNA expression pattern analysis after HUVECs, * * P < 0.01.MiR-126, miR-200 and miR-
221 without significant change (P > 0.05)；The obvious up-regulation (P < 0.01) of miR-155 expression；MiR-31, miR-384 and miR-590 expression
It is obvious to lower (P < 0.01).
Fig. 3 adjusts the expression of the miR-31 in HUVECs, and the cell function of HUVECs generates significant change.A cell scratch
Experiment, HUVECs transfer ability can be enhanced by prompting to be overexpressed miR-31, on the contrary then weaken；B is the inspection of CCK-8 cells growth activity
It surveys, Ang II can be enhanced treated the growth vigor of HUVECs by prompting to be overexpressed miR-31, on the contrary then weaken；C, D is streaming
Cell instrument detection, wherein C prompt is overexpressed the apoptosis for the HUVECs that miR-31 can inhibit Ang II to induce, and D prompt inhibits miR-
31 expression can strengthen the effect of the apoptosis of Ang II induction HUVECs.
The prediction result and correlation analysis of the potential target gene of Fig. 4 .miR-31.A is PicTar, TargetScan and miRDB
The prediction result of three kinds of forecasting softwares；B and C is respectively GO analysis result and KEGG analysis result.MiR-31's is latent as the result is shown
Cytoplasm is primarily targeted in target gene；It is primarily involved in Cellular Signaling Transduction Mediated and the biological processes such as exchanges with cell-tocell；
The active molecular function of major regulatory cell trafficking protein；It is primarily involved in the transmembrane transport of active material.
Bindingsite assay of Fig. 5 .miR-31 to RASA1.A is the prediction result of bioinformatics；B discloses miR-31
Potential binding site on 3 ' UTR of RASA1 gene, and it is completely conservative in the gene order of the site evolution species.Has is intelligence
People, rno are rat, and mmu is mouse, and ppa is chimpanzee.
Verifying of Fig. 6 .miR-31 to the potential binding site of 3 ' UTR of RASA1.A is the wild of 3 ' UTR of gene containing RASA1
The luciferase carrier of type and mutant sequences；B is dual-luciferase reporter system testing result, Mock, NC and mimic
Respectively represent blank control group, control group and miR-31 overexpression group, 3 ' UTR-mut of RASA1 3 ' UTR-wt and RASA1 difference
Represent wild type RASA1 gene and saltant type RASA1 gene, P < 0.01 * *, ##P < 0.01；C is that Western blot detects miR-
The influence that RASA1 is expressed in 31 couples of HUVEC, GAPDH are internal reference albumen, and mimic, inhibitor and NC respectively indicate miR-31
P < 0.01 the HUVECs of overexpression group, miR-31 interference group and control group, * *.As a result miR-31 overexpression group (mimic) is prompted
Middle wild type RASA1 uciferase activity is substantially reduced (P < 0.01) compared with saltant type, and control group (NC) and blank control group
(Mock) variation of the uciferase activity of wild type RASA1 and saltant type RASA1 is little in；The prompt of Western blot result,
(P < 0.01) is lowered in mimic group relative comparison group RASA1 expression, and RASA1 expression is apparently higher than pair in inhibitor group
According to group (P < 0.01).
Can Fig. 7 application flow cytomery miR-31 influence Ang II induction by the expression of regulation RASA1
HUVECs apoptosis.NC, inhibitor and Inhibitor/si-RASA1 respectively indicate control group HUVEC, inhibitor and
Rescue group HUVEC, the * * P of interference group HUVEC and inhibitor and the si-RASA1 cotransfection of si-NC cotransfection <
0.01,##P<0.01.As a result it prompts, after Ang II stimulates 48h, cellular control unit apoptosis rate is 19.18 ± 0.61%, interference group
Apoptosis rate is 27.90 ± 1.02%, and rescue group apoptosis rate is 22.35 ± 0.81%；The apoptosis rate of rescue group HUVEC
Substantially less than interference group (P < 0.01), the apoptosis rate (P < 0.01) of a little higher than control group of apoptosis rate of rescue group HUVECs.
Specific embodiment
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as Sambrook et al., molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory
Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and
Number is calculated by weight.Unless otherwise defined, all professional and scientific terms as used herein and one skilled in the art institute
Known meaning is identical.In addition, any method similar to or equal to what is recorded and material all can be applied in the present invention.
The preferred methods and materials described herein are for illustrative purposes only.
I. material and method
MiR-31 preparation
The analogies (mimic) and mortifier (inhibitor) and reference material (NC and inh-NC) of miR-31 are by upper
The synthesis of Hai Jima pharmaceutical technology company, and with green fluorescence.Illustrated to carry out cell transfecting according to the Lipofectamine 2000.
Human umbilical vein endothelial cell (HUVECs) preparation
The same day fresh umbilical cord is taken, after rinsing umbilical vein, with collagenase type I infusion umbilical vein, continues to inject clostridiopetidase A
Solution collects all enzyme solutions so that endothelial cell digests after digestion, with PBS repeated flushing umbilical vein and collect clear
Washing lotion merges with aforementioned enzyme solution, and supernatant is abandoned in centrifugation, and cell is resuspended with ECM complete medium, moves to culture bottle culture.2-5 generation
Well-grown endothelial cell is inoculated in 24 orifice plates, and it is that blood vessel endothelium is thin that CD-31 antibody, which carries out the clear cell of immunofluorescence dyeing,
Born of the same parents.
Ang II induces the foundation of the vascular endothelial cell injury model of HUVECs
Using the digestion of 0.25% pancreatin, HUVECs is resuspended, the ECs of digestion is inoculated into 6 orifice plates and is cultivated, its cell is melted
It is right to reach 70%-80%, culture medium is discarded, is stimulated with the ECM culture medium containing 1 μm of ol/L AngII, 37 DEG C, 5%CO2's
Cell is collected after cultivating 48h in constant incubator.
Liposome transfection ECs cell
Take 2000 lipofectamine of Lipofectamine, be added miR-31 analogies/miR-31 mortifier/
The combination of RASA1 specific siRNA or both is incubated for, transfection liquid is made.The transfection liquid being incubated for addition degrees of fusion is existed
The ECs of 80%-90% or so is added without double antibody and serum OPTI culture medium, the culture version with cell is put into training later
It supports and continues to cultivate 6h in case.The ECM culture medium with or without 1 μm of ol/L AngII, 37 DEG C, 5%CO are according to circumstances added afterwards2After
Continuous culture.
Real-time fluorescence quantitative PCR
Then conventional method extract RNA is carried out real by the corresponding miRNA of specific primer reverse transcription of neck ring structure
When fluorescence quantitative PCR detection, it is quantitative in double standard curve methods, analyze the miRNA concentration of each sample, and by solubility curve and
Agarose gel electrophoresis determines the specificity of gene magnification.
The detection of endothelial cell growth vigor
Cells growth activity is detected using Cell Counting Kit-8 (CCK-8) method, the specific steps are as follows: take out training
The ECs in case is supported, waste and old culture medium is sucked out, the 100 μ L culture solutions containing 10 μ L CCK-8 solution, cell training are added in every hole
It supports case and is incubated for 2h.Microplate reader measures the absorbance value (wavelength selection 450nm) in each hole, and different groups of absorbance value is united
Meter analysis.
Cell scratch experiment
The transfer ability of HUVECs is detected by cell scratch experiment.With 2 × 10 in the 6 orifice plates for finish lines5It is thin
Born of the same parents' density cell in good condition that will grow up uniformly is inoculated with, and after cell processing (transfection etc.) is incubated for, pipettor gun head is existed
Board bottom marks the scratch of a horizontal line, and PBS buffer solution is cleaned 3 times and removed the cell crossed out in scoring processes with this, taken pictures.It is added
ECM culture medium containing 1 μm of ol/L Ang II is incubated in incubator, and clapped at 24 hours the same area taken pictures before
According to two straight lines of picture on the basis of the cell scratch width of first time calculate the number of cells between 24 hours two straight lines, survey
Amount migration distance is simultaneously compared.
Flow cytometry
Divide the apoptosis using Flow cytometry ECs: taking out ECs (transfection, Ang II processing handled well in incubator
Deng), old culture solution is drawn, PBS buffer solution gently rinse 2 times, cell is resuspended in 0.25% trypsin digestion cell, is centrifuged repeatedly
Supernatant is abandoned, cell suspension is made with the Binding Buffer of 300 μ L in centrifuge tube, corresponding reagent is added in by specification
Afterwards, it gently shakes up, 15min is protected from light under room temperature state, carry out the detection of streaming apoptosis.
Western blot
HUVECs albumen is extracted using SDS lysate, each sample is detected by BCA (bicinchonininc acid) method
The PBS buffer solution of corresponding amount is added according to the uniform concentration of calibration sample in the protein solution concentration of this product in each sample,
PAGE gel electrophoresis, transferring film, antibody hybridization, development are then carried out, the picture of preservation is analyzed with Image J software.
Cellular immunofluorescence
4% paraformaldehyde cell is used 0.1%Triton X-100 penetrating 15 minutes after fixing 15 minutes, 5% lowlenthal serum
Room temperature is closed 1 hour, and 4 DEG C of CD31 antibody overnight incubations are added.It is washed after three times with PBS and secondary antibody is added, be incubated at room temperature 1 hour.Carefully
Karyon is marked with 4 ', 6-diamidino-2-phenylindole (DAPI), last mounting.
The target gene of bioinformatics method prediction miRNAs
Three kinds of miRNA forecasting softwares search downstream target gene relevant to miR-31.Pass through in predicting candidate target gene
Pubmed retrieves relevant to apoptosis document, and find out potential target because.The function of target gene is probed into GO analysis and KEGG analysis
Can, the potential binding site of miR-31 and target gene is obtained with bioinformatic analysis.
The building of plasmid
The building of this part plasmid is laboratory building, comprising: (1) saltant type RASA1 luciferase reporter gene table
Up to the building of vector plasmid (Report-mut-RASA1)；(2) wild type RASA1 luciferase reporter gene expression vector plasmid
(Report-wt-RASA1) building.
Luciferase reporter gene method verifies miR-31 target gene
Luciferase reporter gene (Report-mut-RASA1/Report-wt-RASA1 and miR-31- will be contained
Mimic/miR-31-NC plasmid co-transfection 293T cell), to observe whether miR-31 acts on candidate targets RASA1.It is first
293T cell is resuspended in DMEM culture medium first pancreatin digestion, 10%FBS without double antibody, and the cell inoculation of digestion is trained to 96 orifice plates
It supports, when making it cell fusion degree is up to 80%-90% in transfection, in accordance with the operation instructions and not of Lipofectmaine 2000
Luciferase reporter plasmid is transfected respectively with grouping, using the expression of fluorescent reporter gene detection system detection luciferase
Amount, to reflect that can miR-31 regulate and control expression of target gene in vitro system.
Statistical analysis
All measurement datas are indicated using mean ± standard deviation (Mean ± SD) in experiment.All data of this experiment use
19.0 software of SPSS is operated, and P < 0.05 indicates that difference has statistical significance.
II. embodiment
Embodiment 1, injury of blood vessel cell model are established
The present invention is obtained by umbilical vein and the secondary culture HUVECs that succeeds.Flow cytometry shows Ang II stimulation
After 48h, Ang II processing group apoptosis rate is 19.05 ± 0.66%, and control group apoptosis rate is 7.67 ± 0.58%, AngII group
Apoptosis rate is apparently higher than control group (P < 0.01) (Figure 1A).Western blot Ang II processing group Apoptosis as the result is shown
GAP-associated protein GAP Caspase-3 expression significantly up-regulation, the significant downward (Figure 1B) of Bcl-2 expression simultaneously.Ang II induction HUVECs makes
After damage, different periods CCK8 detection display HUVECs growth vigor is substantially less than control group (P < 0.01), illustrates AngII
It is able to suppress the growth activity (Fig. 1 C) of HUVECs.QRT-PCR detect Ang II induction 12h, for 24 hours, after 36h and 48h, miR-
Different degrees of reduction is presented in 31 expression, changes most obvious (P < 0.01) (Fig. 1 D) afterwards for 24 hours wherein acting on.It can be seen that
Ang II induction HUVECs can be used as injury of blood vessel cell model.
Embodiment 2, injury of blood vessel cell model expression pattern analysis
The abnormal expression of MiRNA plays important function in the generating process of cardiovascular disease.Pass through the side of qRT-PCR
The expression of the relevant miRNA of method Human Umbilical Vein Endothelial Cells function is detected, and miR-31, miR-384 and miR-590 are expressed as the result is shown
Obvious to lower (P < 0.01), the obvious up-regulation (P < 0.01) of miR-155 expression, miR-126, miR-200 and miR-221 become without obvious
Change (P > 0.05) (Fig. 2).
Embodiment 3, miR-31 analog/mortifier transfect HUVECs
There is green fluorescence in 80% or more endothelial cell after miR-31 analog/mortifier transfection HUVECs.Meanwhile it applying
QRT-PCR method detect HUVECs in miR-31 expression, transfect miR-31 in the HUVECs of mimic expression be higher than pair
According to group (P < 0.01), the expression of miR-31 in the HUVECs of inhibitor is transfected lower than control group HUVECs (P < 0.01), explanation
Cell can be transfected effectively.
Embodiment 4, overexpression miR-31 can enhance HUVECs transfer ability
Cell scratch experiment show (Fig. 3 A) transfection after HUVECs through Ang II processing after inhibitor group compared with control group
Transfer ability weakens, and mimic group enhances compared with control group transfer ability, and miR-31 analog is prompted to improve as caused by Ang II
The decline of endothelial cell migration ability, the effect of miR-31 mortifier are opposite, that is to say, that miR-31 analog helps to enhance endothelium
Cell migration ability.
Embodiment 5, overexpression miR-31 can enhance HUVECs growth vigor
After detection display (Fig. 3 B) the Ang II processing of CCK-8 kit, the endothelial cell OD value of miR-31mimic group is higher than
Control group (P < 0.01), miR-31inhibitor group OD value are lower than control group (P < 0.01), illustrate that being overexpressed miR-31 can improve
The decline of the endothelial cell growth vigor as caused by Ang II, that is to say, that it is living that miR-31 analog facilitates enhancing endothelial cell
Power.
Embodiment 6, overexpression miR-31 can inhibit HUVECs apoptosis
Influence (Fig. 3 C, Fig. 3 D) of the flow cytomery miR-31 to the Ang II HUVECs apoptosis variation handled, Ang
After II stimulates 48h, mimic group apoptosis rate is 13.40 ± 0.64%, cellular control unit apoptosis rate for 18.17 ±
The apoptosis rate of 0.48%, mimic group is significantly lower than control group (P < 0.01)；Inhibitor group apoptosis rate is 27.97
± 0.67%, cellular control unit apoptosis rate is that the apoptosis rate of 19.38 ± 0.34%, inhibitor group is apparently higher than pair
According to group (P < 0.01), it was demonstrated that miR-31 can inhibit the apoptotic effect of the huve cell of Ang II induction.
The searching of embodiment 7, MiR-31 effect target gene
Pass through bioinformatic analysis, it is predicted that 47 genes have the target spot (Fig. 4 A) to interact with miR-31, lead to
It crosses GO analysis and functional analysis is carried out to these target genes, the potential target gene of miR-31 is primarily targeted for cytoplasm as the result is shown；
It is primarily involved in Cellular Signaling Transduction Mediated and the biological processes such as exchanges with cell-tocell；Major regulatory cell trafficking protein is active
Molecular function (Fig. 4 B).Analyze the signal path of these target genes as the result is shown by KEGG: be primarily involved in active material across
Film transports (Fig. 4 C).
The verifying of embodiment 8, RASA1 as miR-31 target gene
Bioinformatic analysis show RASA1 gene 3 ' UTR on there are the potential binding sites of miR-31, and have compared with
High affinity (Fig. 5 A)；In the gene order of the evolution species such as people, mouse, rat and chimpanzee completely conservative (Fig. 5 B).
Whether bound directly with the seed sequence of 3 ' UTR region of RASA1 with Dual-Luciferase Activity determination experimental verification miR-31,
Wild type RASA1 uciferase activity is substantially reduced compared with saltant type in (Fig. 6 B) miR-31 overexpression group (mimic) as the result is shown
(P < 0.01), and in control group (NC) and blank control group (Mock) wild type RASA1 and saltant type RASA1 fluorescein enzyme activity
Property variation it is little.Western blot has also obtained similar result (Fig. 6 C).Illustrate that miR-31 can be by prediction site and RASA1
It combines, RASA1 is the target gene of miR-31.
Embodiment 9, miR-31 influence the HUVECs apoptosis induced by Ang II by regulation RASA1
Flow cytomery as the result is shown (Fig. 7), Ang II stimulate 48h after, cellular control unit apoptosis rate be 19.18 ±
0.61% (NC), interference group (miR-31inhibitor) apoptosis rate are 27.90 ± 1.02%, rescue group (miR-
31inhibitor+si-RASA1) apoptosis rate is 22.35 ± 0.81%.The apoptosis rate of rescue group HUVEC is substantially less than dry
It disturbs group (P < 0.01), the apoptosis rate (P < 0.01) of a little higher than control group of apoptosis rate of rescue group HUVECs.Prove that miR-31 can lead to
Cross the apoptotic effect for lowering the HUVECs of expression inhibiting Ang II induction of RASA1.
Embodiment 10, screening technique
Setting: test group: Human umbilical vein endothelial cells, and give candidate substances；
Control group: Human umbilical vein endothelial cells do not give candidate substances.
The expression of RASA1 in test group and control group is detected respectively, and is compared.If RASA1 in test group
Expression be statistically lower than (such as low 50% or lower) control group, indicate that the candidate is treatment of vascular endothelial injuries
Potential substance.
Using miR-31 and control sequence as candidate substances, it is added in HUVECs culture, observes RASA1 intracellular
Expression.As a result, it has been found that miR-31 can be effectively reduced the expression of RASA1 albumen, and control sequence cannot effectively drop
The expression of low RASA1.
It discusses
Vascular endothelial cell is not to be a kind of always in the amphicyte of stable state, but has metabolic activity and secretion function
The cell of energy.Normal EC major function has: there is one layer of endothelial cell clothing on 1. intravascular space surfaces, for blood plasma macromolecular substances
With barrier action, in addition, due to endothelial cell have unique structure and metabolic characteristic, can selectivity adjusting small molecule to
Supramolecular substance passes through vascular wall.In the case where acute inflammation, in neutrophil adhesion to ECs, leucocyte is first migrated
After ooze out, then to blood vessel external migration.And the prostacyclin (PGI2) of endothelium synthesis can inhibit the adherency of granulocyte, to prevent
The intrusion of inflammatory cell infiltration and harmful substance.2. endothelial cell has antithrombogenic properties, to be able to maintain blood flow.
It makes blood vessel in damage, by blood coagulation and thrombosis to safeguard the complete of vascular wall there are many more solidifying factor is promoted at the same time
Whole property.3. blood vessel ECs can generate derived relaxing factor such as PGI2, the powerful expansion blood vessel of endothelial cell derived diastolic factor (EDRF) is made
With with inhibit platelet aggregation.Blood vessel ECs can generate contracting Angiogenesis i.e. Endothelin (ET), increase vascular smooth Muscle tensility
Add, vessel retraction, leads to the diseases such as hypertension, atherosclerosis.
Certain types of miRNA has been demonstrated that the function of ECs can be influenced, to participate in the dynamic equilibrium of ECs mediation
Regulation.Poliseno etc. confirms the miRNA of 27 kinds of height expression in HUVECs, and predictive display wherein most is adjustable
The expression (Flt-1, Nrp-2, FGF-R, c-Met, c-Kit) of angiogenesis regulatory factor receptor.It is highly expressed in ECs
MiRNA includes miR-126, miR-221, miR-222, mir-130a, let-7family, miR-21, and miR-27b.
The present invention handles the damage model of Human umbilical vein endothelial cells (HUVECs) using Ang II.Why select
HUVECs is mature because being separately cultured technology at present, and HUVECs is compared with animal blood vessels endothelium, the disease of experimental model
Reason changes closer to human diseases lesion, so domestic and foreign scholars largely apply to HUVECs to establish blood vessel endothelium at present
The cell model of damage.After being read by lot of documents, present invention determine that establishing Human umbilical vein endothelial cells (HUVECs) damage
The Ang II concentration of wound model is 1 μm of ol/L, and has carried out Ang II induction to the HUVECs of originally culture, establishes blood vessel endothelium
Damage model.
Consistent, the of the invention experiment show with domestic and international pertinent literature report: Ang II inhibits HUVECs's
Proliferation, and promote its apoptosis, the method establishes the success of blood vessel endothelium injury model.In further experiment, the present invention is in mRNA water
MiRNA express spectra changes in the flat damage model for comparing Ang II induction, as the result is shown miR-31, miR-155, miR-384
Occurs different degrees of variation with miR-590-5p.The present invention selects wherein to reduce apparent miR-31 as further research
Object, next after mRNA level in-site compares Ang II processing different time, the expression of miR-31 changes, as the result is shown Ang
II act on 12h, for 24 hours, after 36h, 48h, different degrees of reduction is being presented in the expression of miR-31, wherein with processing change for 24 hours
It is the most obvious.
Thus present invention assumes that, miR-31 plays protection inhibiting effect in the HUVECs apoptotic process that Ang II is induced.
In next experiment, by transfecting miR-31mimic and inhibitor in HUVECs, present invention discover that miR-31
Expression increases the growth vigor that can cause Ang II induction HUVEC and transfer ability enhancing, while inhibiting the generation of its apoptosis；
On the contrary after the expression of miR-31 is lowered, growth vigor, the transfer ability of endothelial cell weaken and promote Apoptosis.That is,
MiR-31 is able to suppress the apoptosis of the HUVECs of Ang II induction, and promotes the growth vigor and transfer ability of HUVECs.
Previously studies have shown that miRNA is particularly important for the stable state of cardiovascular system, imbalance of expression can cause many classes
The disease of type.When ECs dysfunction, with the release of inflammatory mediator, procoagulant Factor, the decrease of transfer ability can lead to hair
Thin angiogenesis and blood vessel dilatation are limited, and blood pressure increases.There is scholar to think that miR-27 directly acts on the DNA of angiogenic and promotion
The generation of blood vessel.In addition, research discovery miR-150 can promote thin vessels generation and endothelial cell migration, when various chemical factors
Lead to timing under miR-150, angiogenesis and cell migration ability also weaken.Similar report show miRNA-124 and
MiRNA-135a reduces the signal transduction in RAAS, to participate in the adjusting of blood pressure.Sun etc. observes that miR-155 is endothelium
Nitricoxide synthase (eNOS) expression and endothelium-dependent vasodilatation main regulatory factors, while can mediate hypertension disease in
Inflammatory reaction, the nitric oxide that wherein eNOS is generated plays an important role in terms of maintaining cardiovascular stable state, therefore, inhibits
MiRNA-155 may be a kind of new treatment means for improving endothelial dysfunction in cardiovascular disease development process.
Likewise, the above discovery of the invention, if the HUVECs that miR-31 inhibits Ang II induction can be further clarified
Apoptosis specific molecular mechanism, be also the lesion of vascular endothelial cell, provide a kind of new possibility.
MiRNA as a kind of endogenic non-coding RNA, the 3'UTR of mRNA can be targeted with it in conjunction with, lead to its translation
Process blocks or causes the degradation of targeting mRNA.At present there is increasing evidence that, various miRNA the mankind difference
Occur unconventionality expression in disease and has regulated and controled various biological process, proliferation, activity, differentiation and apoptosis including cell etc..
For the potential target gene for finding miR-31, the present invention passes through three kinds of microRNA target prediction softwares first and is analyzed, in conjunction with
The literature search of pubmed database has primarily determined the potential target gene RASA1 of miR-31.
RASA1 gene (5q13.3) is made of 1047 amino acid residues, and codified p120GAP albumen belongs to RAS-GAP
Family.Up to the present, which has been described 16 members, and in addition to p120GAP (RASA1), other members are further comprised
NF1, DAB2IP, GAP1m (or RASA2), GAP1IP4BP (or RASA3), CAPRI (or RASA4), RASAL1, SYNGAP,
AF9Q34, FLJ21438, IQGAP1, IQGAP2, IQGAP3, PLXNB2 and TUBERIN.
The clinical application of target treatment of colon cancer drug such as Cetuximab or Victibix is mainly for RAS signal at present
The activity of access.RAS albumen is in the RASGTP state of activation and the RASGDP state of inactivation under normal conditions.RAS-GAPs exists
It works in KRAS wild-type cell, rather than works in mutant cell.RAS gene mutation causes the activation of RAS-GTP
The opening of state and RAS signal pathway enhances cell anti-apoptotic activities and vicious transformation to promote cell Proliferation.
It is nearest the study found that downward or efficiency due to RAS-GAPs reduce in KRAS wild type colon cancer, result in RAS letter
The activation of number access, promotes tumour and is formed.It is worth noting that, the RASA1 expression in KRAS wild type colon cancer cell is bright
It is aobvious to be lower than mutant cell.Calvisi etc. has evaluated expression characteristic of the RAS-GAPs in liver cancer tissue, finds DAB2IP,
The expression of RASA1 and NF1 reduces；Wherein, the low expression of DAB2IP and the poor prognosis of KRAS wild type liver cancer are significant related.This
A little discoveries show that RAS-GAPs is the suppressor of tumour, and RASA1 is the important member of RAS-GAP family.There is research to tie
Fruit shows the significant subnormal adjacent tissue of expression of the RASA1 in colon cancer tissue.In addition, Hu etc. discovery with it is neighbouring
Normal tissue is compared, and the RASA1mRNA and protein expression level in stones in intrahepatic bile duct cancerous tissue and cell are decreased obviously.Except Colon and rectum
Outside cancer and liver cancer, the functional disturbance that RASA1 is also demonstrated in the research of breast cancer and progranulocyte leukemia also has cause
Cancer effect.
In the decline of experiment, the present invention further passes through bioinformatic analysis, luciferase reporter gene detection
The relationship that is directly targeted of miR-31 and 3 ' UTR of RASA1, and the transcription pair by influencing RASA1 has been determined with Western blot
It carries out negative regulation.Finally, by the expression of miR-31 in interference HUVECs, the apoptosis of the HUVECs of discovery Ang II induction
It is enhanced, later with rescue experiment, it was confirmed that the HUVECs's that miR-31 inhibits Ang II to induce by lowering RASA1 withers
It dies.
Result of the invention as a result, it is determined that newly square by the prevention and treatment of the blood vessel endothelium injury of clue of miR-31, RASA1
To.It can achieve the purpose that disease prevention and cure by the way that the target spot in the clue is adjusted.
The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described
Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention
Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.
Sequence table
<110>Shanghai Changhai Hospital
<120>application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury
<130> /
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial)
<400> 1
aggcaagatg ctggcatagc t 21
Claims (10)
- Application of the 1.miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury.
- 2. miR-31 according to claim 1 and the like is in the drug of preparation prevention or treatment blood vessel endothelium injury Application, which is characterized in that the miR-31 have the sequence as shown in SEQ ID NO.1.
- 3. miR-31 according to claim 1 and the like is in the drug of preparation prevention or treatment blood vessel endothelium injury Application, which is characterized in that described miR-31 and the like preparation regulation RASA1 gene expression drug in answering With.
- 4. miR-31 according to claim 1 and the like is in the drug of preparation prevention or treatment blood vessel endothelium injury Application, which is characterized in that described miR-31 and the like reduction vascular endothelial cell damage.
- 5. miR-31 according to claim 1 and the like is in the drug of preparation prevention or treatment blood vessel endothelium injury Application, which is characterized in that the blood vessel endothelium injury be selected from by Angiotensin II stimulation cause blood vessel endothelium it is thin Cellular damage.
- 6. a kind of application of RASA1 inhibitor in the drug of preparation prevention or treatment blood vessel endothelium injury, the RASA1 suppression Preparation is miR-31 and the like.
- 7. RASA1 inhibitor according to claim 6 answering in the drug of preparation prevention or treatment blood vessel endothelium injury With, which is characterized in that the seed sequence of 3 ' UTR region of the miR-31 and RASA1 is bound directly.
- 8. increasing the application of the expression or active reagent of miR-31 in the drug of preparation prevention or treatment blood vessel endothelium injury.
- 9. the expression according to claim 8 for increasing miR-31 or active reagent are in preparation prevention or treatment blood vessel endothelium Application in the drug of damage, which is characterized in that the expression of the increase miR-31 or active reagent include following any: When can increase the activity, enhancing miR-31 stability, the expression for promoting miR-31, the useful effect of increase miR-31 of miR-31 Between or promote miR-31 transcription and processing substance.
- 10. a kind of method of the potential substance of screening prevention or treatment blood vessel endothelium injury, which is characterized in that the method packet It includes:(A) system of expression miR-31 is handled with candidate substances；With(B) expression or activity of miR-31 in the system are detected；Wherein, if the candidate substances can increase the expression or activity of miR-31, show that the candidate substances are prevention or treatment blood The potential substance of endothelial tube damage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910015995.1A CN109700824A (en) | 2019-01-08 | 2019-01-08 | Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910015995.1A CN109700824A (en) | 2019-01-08 | 2019-01-08 | Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109700824A true CN109700824A (en) | 2019-05-03 |
Family
ID=66261044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910015995.1A Pending CN109700824A (en) | 2019-01-08 | 2019-01-08 | Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109700824A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106460053A (en) * | 2014-05-13 | 2017-02-22 | 罗塞塔金诺米克斯有限公司 | MIRNA expression signature in classification of thyroid tumors |
| CN108535236A (en) * | 2018-03-30 | 2018-09-14 | 华南师范大学 | A method of based on dual amplification SERS signal system super sensitivity detection miRNA |
-
2019
- 2019-01-08 CN CN201910015995.1A patent/CN109700824A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106460053A (en) * | 2014-05-13 | 2017-02-22 | 罗塞塔金诺米克斯有限公司 | MIRNA expression signature in classification of thyroid tumors |
| CN108535236A (en) * | 2018-03-30 | 2018-09-14 | 华南师范大学 | A method of based on dual amplification SERS signal system super sensitivity detection miRNA |
Non-Patent Citations (1)
| Title |
|---|
| 褚恒: "miR-31抑制血管紧张素2诱导的内皮细胞凋亡的作用和机制研究", 《万方学位论文》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9862949B2 (en) | Method for the inhibition of angiogenesis | |
| Wang et al. | miR‐222 inhibits cardiac fibrosis in diabetic mice heart via regulating Wnt/β‐catenin‐mediated endothelium to mesenchymal transition | |
| Guan et al. | MicroRNA-18a-5p administration suppresses retinal neovascularization by targeting FGF1 and HIF1A | |
| CN104548134A (en) | Application of miR-144 and inhibitor thereof | |
| Fu et al. | CircMAPK1 promotes the proliferation and migration of vascular smooth muscle cells through miR-22-3p/methyl-CpG binding protein 2 axis | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| Fang et al. | Role of DJ-1-induced PTEN down-regulation in migration and invasion of human glioma cells | |
| Cao et al. | Long Non-coding RNA TALNEC2 Aggravates Cerebral Ischemia/Reperfusion Injury via Acting as a competing endogenous RNAs for miR-650 to target apoptotic peptidase activating factor 1 | |
| CN109988765B (en) | Targeting inhibitor of FENDRR gene and application thereof | |
| CN101705227B (en) | SiRNA for inhibiting human AP-2alpha gene expression and anti-cervical cancer application thereof | |
| CN107693535A (en) | A kind of microRNA application | |
| CN105457028B (en) | The stress sensitivity microRNA of regulating and controlling effect is played in bon e formation | |
| CN109364249B (en) | Application of MANF-targeted substance in preparation of product for treating intrahepatic bile duct cancer | |
| Jiang et al. | Down-regulation of VCAM-1 in bone mesenchymal stem cells reduces inflammatory responses and apoptosis to improve cardiac function in rat with myocardial infarction | |
| CN111110691A (en) | Application of ginsenoside Rb2 in preparing medicament for preventing and/or treating atherosclerosis | |
| CN108144061B (en) | Application of the microRNA-210 inhibitor on preparation treatment inflammatory skin medicine | |
| CN109700824A (en) | Application of the miR-31 and the like in the drug of preparation prevention or treatment blood vessel endothelium injury | |
| CN107523566B (en) | Targeting inhibitor of MCM3AP-AS1 gene and application thereof | |
| CN102266569B (en) | Application of miR-199a and inhibitor thereof | |
| CN107519489A (en) | Application of the inhibitor of miR 375 in anti-angiogenic senescence drug is prepared | |
| CN114032236A (en) | shRNA of TMEM2 and application thereof | |
| CN108530451B (en) | A kind of cachectic compound of anticancer and application | |
| CN112391385A (en) | siRNA, siRNA plasmid and lentivirus for targeted inhibition of NCEH1 gene expression as well as construction method and application thereof | |
| CN107893119A (en) | Applications of the ZCCHC12 in osteosarcoma | |
| CN107881240A (en) | The diagnosis and treatment mark of osteosarcoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190503 |