CN109694879A - General unmarked LIC carrier pMF-LIC and its construction method and application - Google Patents
General unmarked LIC carrier pMF-LIC and its construction method and application Download PDFInfo
- Publication number
- CN109694879A CN109694879A CN201910126282.2A CN201910126282A CN109694879A CN 109694879 A CN109694879 A CN 109694879A CN 201910126282 A CN201910126282 A CN 201910126282A CN 109694879 A CN109694879 A CN 109694879A
- Authority
- CN
- China
- Prior art keywords
- lic
- pmf
- late blight
- carrier
- unmarked
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Abstract
It is to carry out PCR amplification using plasmid pJG100 as template by primer pair of SEQ ID No.1 and SEQ ID No.2, obtain target fragment LIC sequence the present invention relates to a kind of general unmarked LIC carrier pMF-LIC and its construction method and application；It is connect by target fragment LIC sequence restriction enzyme Xba I and Sac I double digestion, then with the pMF-Npt II plasmid through same double digestion, obtains general unmarked LIC carrier pMF-LIC.PMF-LIC carrier provided by the invention is free of the frame sequence of any carrier using safe in addition to introducing target gene；Simplicity, external source wait for that clone PCR segment does not need digestion and connection reaction；Efficiently, ligase is not depended on, DNA regrouping process is largely simplified, and completely by cohesive end pairing annealing, carrier is low from background is connected；It can be processed in batches；It is at low cost.
Description
Technical field
The present invention relates to gene engineering technology fields, and in particular to the general unmarked LIC carrier pMF-LIC of one kind and its structure
Construction method and application.
Background technique
Transgenic technology is spoken of, the problem of everybody just will recognize that GMO bio-safety.Now, public raw to transgenosis
The safety issue of object is paid special attention to, and concern is focused primarily upon to some riddled basins used in transgenic protocol, this
A little marker gene majorities are the gene of some coding antibiotic resistances and Herbicid resistant.Therefore, some marker-frees are obtained
Genetically modified plants, may be to improve the public acceptance to transgenic product.Up to the present, some nothings are had been obtained for
The conversion plant of marker gene, but certain methods are all still to use marker gene in conversion, after then obtaining positive transformant
Riddled basins are removed again by various means, it is time-consuming and laborious.Other scholar just uses during genetic transformation
The conversion system of marker-free gene, settles the transformant that marker-free can be obtained at one go.
But it regardless of which kind of obtains the carrier of marker-free transformation body, is dependent on during exogenous gene cloning in restricted
Then enzyme cutting relies on ligase again and connects foreign gene with carrier.In this way by the method for exogenous gene cloning to carrier by
The limitation of original restriction enzyme site in gene order, in the application by certain limitation.Meanwhile if think will be different in laboratory
Gene is cloned into carrier it is necessary to consider the restriction enzyme site of each gene and carrier, it is necessary to utilize different restriction enzyme sites, need
Different restriction endonucleases is bought, different genes, time-intensive, expensive are cloned by multiple digestion and connection.
Summary of the invention
For the defects in the prior art, it is necessary to construct one not only in the conversion process, be introduced only into external source purpose base
Cause does not carry the unmarked carrier of the bio-safety of selectable marker gene, and the unmarked carrier should be in cloned foreign base
Because during, do not limited by restriction enzyme site, it can be with the general unmarked carrier of any foreign gene of once-through operation rear clone.
It is using plasmid pMF-Npt II it is an object of that present invention to provide a kind of general unmarked LIC carrier pMF-LIC
It is formed with LIC sequence construct.
The construction method of general unmarked LIC carrier pMF-LIC is comprising steps of using plasmid pJG100 as template, with SEQ
ID No.1(LICR: 5 '-GACTCTAGAGGTACCTTCGACGACAAGAC CGG-3 ') and SEQ ID No.2 (LICF: 5 '-
TGGGAGCTCGAGGAGAAGAGCCGGG CCCCTAC-3 ') it is that primer pair carries out PCR amplification, obtain target fragment LIC sequence；
By target fragment LIC sequence restriction enzyme Xba I and Sac I double digestion, then with the pMF-Np t through same double digestion
The connection of II plasmid, obtains general unmarked LIC carrier pMF-LIC.
Another kind of the present invention is designed to provide a kind of recombinant vector for carrying anti-late blight ospc gene R1, is using general
Unmarked LIC carrier pMF-LIC and anti-late blight ospc gene R1 are built-up.
The construction method of the recombinant vector of anti-late blight ospc gene R1 is carried comprising steps of to carry anti-late blight ospc gene R1's
PCLD04541-R1 is template, with SEQ ID No.3 (R1R: 5 '-CGACGACAA GACCGTACCATGAATTTCAACAATGA
ATTGTCTGATC-3 ') and SEQ ID No.4 (R1F: 5 '-GAGGAGAAGAGCCGTCTATCTTATTTCTGCAAGAATATTT
TTTAC-3 ') it is that primer pair carries out PCR amplification, obtain anti-late blight ospc gene R1；By anti-late blight ospc gene R1 restriction enzyme
Enzyme Apa I digestion, then connect with the general unmarked LIC carrier pMF-LIC through same digestion, it obtains and carries anti-late blight ospc gene
The recombinant vector of R1.
The microorganism that another kind of the invention is designed to provide a kind of recombinant vector for carrying anti-late blight ospc gene R1 turns
Change body, is to convert to obtain using Agrobacterium as receptor；Preferably, Agrobacterium is Agrobacterium AGL0.
The construction method of the microbial transformant of the recombinant vector of anti-late blight ospc gene R1 is carried comprising steps of using three parents
The recombinant vector for carrying anti-late blight ospc gene R1 is transferred in Agrobacterium by the method for fusion, obtains carrying anti-late blight ospc gene R1
Recombinant vector microbial transformant.
The present invention also protects general unmarked LIC carrier pMF-LIC, carries the recombinant vector of anti-late blight ospc gene R1 or take
The microbial transformant of recombinant vector with anti-late blight ospc gene R1 is improving the application in Genes For Plant Tolerance late blight effect.
Preferably, plant is potato, preferably Potato Cultivars Desiree.
Another kind of the invention is designed to provide a kind of method cultivated and improve the plant of anti-late blight effect, including makes
The step of with general unmarked LIC carrier pMF-LIC；Alternatively, including using the recombinant vector for carrying anti-late blight ospc gene R1
Step；Alternatively, including the steps that the microbial transformant using the recombinant vector for carrying anti-late blight ospc gene R1.
Another kind of the invention is designed to provide a kind of construction method of transgenic potato kind, comprising steps of will
The microbial transformant for carrying the recombinant vector of anti-late blight ospc gene R1 infects Potato Cultivars using the method for mediated by agriculture bacillus
Desiree obtains transgenic potato kind.
PCR fragment and the carrier condition existing for 3 ' -5 ' 5 prime excision enzyme activities and a kind of specific dNTP of T4DNA polymerase
Lower reaction generates the cohesive end of 10~15 bases at its end.Therefore, processed PCR fragment and carrier can be by lifes
At cohesive end recombination, do not use ligase in this process.It is eliminated using this cloning process to Insert Fragment
The considerations of sequence, can clone any desired gene on carrier.And entire connection procedure is not all needed using restricted
Restriction endonuclease and ligase, PCR fragment and carrier are to connect under in vitro conditions, and the cohesive end annealing generated after the two processing is mutual
Benefit forms double-stranded circular molecule, it is inverted enter Bacillus coli cells after, the repair system of bacterium is repaired these and is protruded and notch
And obtain correct recon.
General unmarked LIC carrier pMF-LIC provided by the invention, have it is following the utility model has the advantages that
(1) safety: genetic transformation is carried out with the carrier, obtained transgenic line is free of other than introducing target gene
The frame sequence of any carrier；
(2) easy: external source PCR fragment to be cloned does not need digestion and connection reaction, simplifies various restriction enzyme sites and exists
Thinking trouble when design of primers；
(3) batch processing: multiple genes during the experiment can be with a biconditional operation, while equally handling all samples, saves
Shi Shengli；
(4) efficiently: this method does not depend on ligase, greatlies simplify DNA regrouping process, and completely by viscosity end
End pairing annealing, carrier are low from background is connected；In addition, without statuses such as the phosphorylations for considering carrier end；
(5) save money: this method only needs T4DNA polymerase and dATP and dTTP, and has additional 10-15bp additional base
Primer, and ligase is eliminated in cloning procedure, also without using expensive special recombinase.
Additional aspect and advantage of the invention will be set forth in part in the description, and will partially become from the following description
Obviously, or practice through the invention is recognized.
Detailed description of the invention
Fig. 1 is that pMF-LIC constructs schematic diagram in the embodiment of the present invention；
Fig. 2 is LIC sequence PCR amplification result figure in the embodiment of the present invention；
Fig. 3 is pMF-LIC plasmid Xba I/Sac I double digestion and Sac I single endonuclease digestion qualification result in the embodiment of the present invention
Figure；
Fig. 4 is carrier pMF-LIC cleavage map in the embodiment of the present invention；
Fig. 5 is the single, double cleavage map of pMF-LIC-R1 plasmid in the embodiment of the present invention；
Fig. 6 is inoculated with disease symptom result figure with (ck) aseptic seedling is compareed for transfer of embodiment of the present invention R1 gene (R1).
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation description.The following examples are only intended to illustrate the technical solution of the present invention more clearly, therefore is intended only as example, without
It can be limited the scope of the invention with this.
Experimental method in following embodiments is unless otherwise specified conventional method.Examination as used in the following examples
Material is tested, is to be commercially available from conventional reagent shop unless otherwise specified.Quantitative test in following embodiment, is all provided with
Three repeated experiments are set, data are the average value or mean+SD of three repeated experiments.
(1) general unmarked LIC carrier pMF-LIC is constructed
The building schematic diagram of general unmarked LIC carrier pMF-LIC is as shown in Figure 1.
1, amplification, recycling, the purifying of target fragment LIC sequence
Using plasmid pJG100 as template, primer pair LIC is utilizedR/LICF(sequence is as shown in table 1) carries out PCR amplification, amplification
Target fragment LIC sequence, size 1.8kb, LIC sequence PCR amplification result are as shown in Figure 2, wherein 1:pJG100 amplification；M:
1kb DNA Maker。
1 primer table of table
| Primer | Sequence |
| LICR | 5’-GACTCTAGAGGTACCTTCGACGACAAGACCGG-3’ |
| LICF | 5’-TGGGAGCTCGAGGAGAAGAGCCGGGCCCCTAC-3’ |
| R1R | 5’-CGACGACAAGACCGTACCATGAATTTCAACAATGAATTGTCTGATC-3’ |
| R1F | 5’-GAGGAGAAGAGCCGTCTATCTTATTTCTGCAAGAATATTTTTTAC-3’ |
| MFR1R | 5’-ATGAATTTCAACAATGAATTGTCTGATCTG-3’ |
| MFR1F | 5’-GAAGGTTGGCCATTTGATCACTCAAACCAACC-3’ |
2, plasmid pMF-Npt II and LIC sequence double digestion
PMF-Npt II plasmid is extracted referring to day with plasmid extraction kit, bis- with restriction enzyme Xba I and Sac I
The recovery product of digested plasmid pMF-Npt II and target fragment LIC sequence.
3, plasmid and LIC sequence are connected and are converted
Using T4DNA Ligase enzyme, by the LIC sequence of recycling and pMF-Npt II digestion carrier in 16 DEG C of connections overnight.
Then DB3.1 competent cell, and spread plate are converted with heat shock method.
4, general unmarked carrier pMF-LIC positive colony screening
Using the single colonie on plate as template, with primer pair LICR/LICF(sequence is as shown in table 1) carries out bacterium colony PCR screening
Positive colony out.The positive clone molecule filtered out through bacterium colony PCR extracts plasmid after cultivation, carries out plasmid PCR detection and plasmid
Xba I/Sac I double digestion and Sac I single endonuclease digestion detection.PMF-LIC plasmid Xba I/Sac I double digestion and the mono- enzyme of Sac I
It is as shown in Figure 3 to cut qualification result, wherein 1: water；2-9: positive clone molecule double digestion, single endonuclease digestion are followed successively by；M:1kb plus
DNA Maker.Recombinant vector pMF-LIC is obtained through bacterium colony PCR, plasmid PCR and the single, double digestion identification of plasmid.
(2) building carries the recombinant vector of anti-late blight ospc gene R1
To carry the pCLD04541-R1 of anti-late blight ospc gene R1 as template, with primer pair R1R/R1F(sequence such as 1 institute of table
Show) carry out the anti-late blight ospc gene R1 of PCR amplification.PMF-LIC is subjected to digestion (carrier pMF-LIC with restriction enzyme A pa I
Cleavage map is as shown in Figure 4, wherein 1:pMF-LIC plasmid；2:Apa I digested plasmid), and it polymerize enzyme pretreatment with T4DNA, this
Sample once pretreated carrier can any foreign gene of high-flux clone, not by the limit of gene and carrier restriction enzyme site
System.Foreign gene will also carry out T4DNA polymerization enzyme pretreatment, and system for handling is as shown in table 2.
2 T4 archaeal dna polymerase pretreatment system of table
| Reagent | Volume (μ L) |
| Carrier pMF-LIC/ sequence | 1.00/X (~50ng) |
| 5×Buffer | 1.00 |
| 100mM dTTP | 0.25 |
| T4DNA polymerase | 0.10 |
| dd H2O | Up to 5.00 |
System adds respectively with complete rear progress LIC connection, and operation program is as follows:
After, it takes in 5 μ L LIC connection product heat shock methods conversion Escherichia coli TOP10 competent cell.37 DEG C are fallen
It sets and is incubated overnight, obtain monoclonal bacterial plaque.Single colonie on picking LB plate carries out bacterium colony PCR detection, and (detection primer is
MFR1R/MFR1F, sequence is as shown in table 1), plasmid enzyme restriction (the single, double digestion of pMF-LIC-R1 plasmid such as Fig. 5, wherein 1:pMF-R1
Plasmid；2: single endonuclease digestion；3: double digestion；M:1kb DNA Maker) positive colony of the verifying acquisition containing foreign gene.
(3) genetically modified plants obtain and detect
Using the method for three parent's fusions, the recombinant vector for carrying anti-late blight ospc gene R1 is transferred in Agrobacterium AGL0.So
Potato Cultivars Desiree is infected using the method for mediated by agriculture bacillus afterwards, and is detected by PCR and obtains positive transformant.
(4) transgenic potato evaluation of resistance
The positive transgenic seedling and wild type control for expanding numerous PCR identification, taken when expanding numerous seedling and growing to 3~4 weeks part seedling into
Row early stage aseptic seedling inoculated identification.Late blight pathogen zoospore is first prepared, by the sporangium for each biological strain for growing 2 weeks
With aseptic water washing into sterilizes culture dish, 4 DEG C of refrigerators, which place 4~6h, makes it discharge zoospore, then microscopy zoospore
Concentration and dilute be adjusted to final concentration of 5 × 104A/mL.Turn R1 gene strain and is inoculated with compatibility biological strain 99018 respectively
(1.4) and non-compatibility biological strain 89148-9 (0), wild type are inoculated with biological strain 89148-9 (0).Inoculation counts after 6 days
Incidence, as a result as shown in Figure 6.Fig. 6 is to turn R1 gene (R1) to be inoculated with disease symptom result figure with (ck) aseptic seedling is compareed,
In, A is that control ck is inoculated with compatibility biological strain 89148-9, and B is that transgenic line R1 is inoculated with non-affine biological strain 89148-
9, C are inoculated with affine biological strain 99018 for transgenic line, and height susceptible (Sp) is all shown as after the inoculation of compatibility microspecies, non-
Affine microspecies then show as disease-resistant (HR).Every group of processing of above-mentioned test is repeated 3 times.It can be illustrated by Fig. 6, anti-late blight ospc gene R1
Succeed and be transferred in Potato Cultivars Desiree by pMF-LIC carrier, and anti-late blight effect is obvious.
It should be noted that unless otherwise indicated, technical term or scientific term used in this application should be this hair
The ordinary meaning that bright one of ordinary skill in the art are understood.Unless specifically stated otherwise, it otherwise illustrates in these embodiments
Component and opposite step, numerical expression and the numerical value of step are not limit the scope of the invention.It is illustrated and described herein
In all examples, unless otherwise prescribed, any occurrence should be construed as merely illustratively, not as limitation, because
This, other examples of exemplary embodiment can have different values.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
It is so possible to modify the technical solutions described in the foregoing embodiments or some or all of the technical features carries out
Equivalent replacement；And these are modified or replaceed, it does not separate the essence of the corresponding technical solution various embodiments of the present invention technical side
The range of case should all cover in protection scope of the present invention.
SEQUENCE LISTING
<110>University Of Science and Technology of the Inner Mongol
<120>general unmarked LIC carrier pMF-LIC and its construction method and application
<130> 1
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 32
<212> DNA
<213>artificial sequence
<400> 1
gactctagag gtaccttcga cgacaagacc gg 32
<210> 2
<211> 32
<212> DNA
<213>artificial sequence
<400> 2
tgggagctcg aggagaagag ccgggcccct ac 32
<210> 3
<211> 46
<212> DNA
<213>artificial sequence
<400> 3
cgacgacaag accgtaccat gaatttcaac aatgaattgt ctgatc 46
<210> 4
<211> 45
<212> DNA
<213>artificial sequence
<400> 4
gaggagaaga gccgtctatc ttatttctgc aagaatattt tttac 45
<210> 5
<211> 30
<212> DNA
<213>artificial sequence
<400> 5
atgaatttca acaatgaatt gtctgatctg 30
<210> 6
<211> 32
<212> DNA
<213>artificial sequence
<400> 6
gaaggttggc catttgatca ctcaaaccaa cc 32
Claims (10)
1. a kind of general unmarked LIC carrier pMF-LIC, it is characterised in that:
The general unmarked LIC carrier pMF-LIC is formed using plasmid pMF-Npt II and LIC sequence construct.
2. a kind of construction method of general unmarked LIC carrier pMF-LIC described in claim 1, which is characterized in that including step
It is rapid:
Using plasmid pJG100 as template, PCR amplification is carried out by primer pair of SEQ ID No.1 and SEQ ID No.2, obtains purpose
Segment LIC sequence；
By target fragment LIC sequence restriction enzyme Xba I and Sac I double digestion, then with through same double digestion
The connection of pMF-Npt II plasmid, obtains the general unmarked LIC carrier pMF-LIC.
3. a kind of recombinant vector for carrying anti-late blight ospc gene R1, it is characterised in that:
The recombinant vector is using general unmarked LIC carrier pMF-LIC described in claim 1 and anti-late blight ospc gene R1
It is built-up.
4. a kind of construction method of the recombinant vector as claimed in claim 3 for carrying anti-late blight ospc gene R1, which is characterized in that packet
Include step:
To carry the pCLD04541-R1 of anti-late blight ospc gene R1 as template, using SEQ ID No.3 and SEQ ID No.4 as primer
To PCR amplification is carried out, anti-late blight ospc gene R1 is obtained；
By anti-late blight ospc gene R1 restriction enzyme A pa I digestion, then with described in the claim 1 through same digestion
General unmarked LIC carrier pMF-LIC connection, obtain the recombinant vector for carrying anti-late blight ospc gene R1.
5. a kind of microbial transformant containing the recombinant vector as claimed in claim 3 for carrying anti-late blight ospc gene R1, special
Sign is:
The microbial transformant is to convert to obtain using Agrobacterium as receptor；Preferably, the Agrobacterium is Agrobacterium AGL0.
6. the building side of the microbial transformant of the recombinant vector of the anti-late blight ospc gene R1 of carrying described in a kind of claim 5
Method, which is characterized in that comprising steps of
Using the method for three parent's fusions, the recombinant vector as claimed in claim 3 for carrying anti-late blight ospc gene R1 is transferred to agriculture bar
In bacterium, the microbial transformant of the recombinant vector for carrying anti-late blight ospc gene R1 is obtained.
7. general unmarked LIC carrier pMF-LIC described in claim 1, the anti-late blight ospc gene of carrying as claimed in claim 3
The microbial transformant of the recombinant vector of the anti-late blight ospc gene R1 of carrying described in the recombinant vector or claim 5 of R1 is improving
Application in Genes For Plant Tolerance late blight effect.
8. application according to claim 7, it is characterised in that:
The plant is potato, preferably Potato Cultivars Desiree.
9. a kind of cultivate the method for improving the plant of anti-late blight effect, it is characterised in that:
Include the steps that using general unmarked LIC carrier pMF-LIC described in claim 1；
Alternatively, including the steps that the recombinant vector using the anti-late blight ospc gene R1 of carrying as claimed in claim 3；
Alternatively, including the microbial transformant using the recombinant vector of the anti-late blight ospc gene R1 of carrying described in claim 5
Step.
10. a kind of construction method of transgenic potato kind, which is characterized in that comprising steps of
The microbial transformant of the recombinant vector of the anti-late blight ospc gene R1 of carrying described in claim 5 is used into mediated by agriculture bacillus
Method infect Potato Cultivars Desiree, obtain the transgenic potato kind.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910126282.2A CN109694879A (en) | 2019-02-20 | 2019-02-20 | General unmarked LIC carrier pMF-LIC and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910126282.2A CN109694879A (en) | 2019-02-20 | 2019-02-20 | General unmarked LIC carrier pMF-LIC and its construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109694879A true CN109694879A (en) | 2019-04-30 |
Family
ID=66234881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910126282.2A Pending CN109694879A (en) | 2019-02-20 | 2019-02-20 | General unmarked LIC carrier pMF-LIC and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109694879A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1545554A (en) * | 2001-05-31 | 2004-11-10 | ֲ���о����ʹ�˾ | Modification of plant genomes |
| CN105039367A (en) * | 2015-07-09 | 2015-11-11 | 湖南大学 | Tobacco NbFER gene and application thereof in tobacco planting |
-
2019
- 2019-02-20 CN CN201910126282.2A patent/CN109694879A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1545554A (en) * | 2001-05-31 | 2004-11-10 | ֲ���о����ʹ�˾ | Modification of plant genomes |
| CN105039367A (en) * | 2015-07-09 | 2015-11-11 | 湖南大学 | Tobacco NbFER gene and application thereof in tobacco planting |
Non-Patent Citations (2)
| Title |
|---|
| L. RIGHETTI • S. DJENNANE ET AL: "Elimination of the nptII marker gene in transgenic apple and pear with a with a chemically inducible R/Rs recombinase", 《PLANT CELL TISS ORGAN CULT》 * |
| 肖欢欢: "无选择标记抗晚疫病转基因马铃薯的获得", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hernanz-Koers et al. | FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology | |
| CN109321584B (en) | Report system for simply qualitatively/quantitatively detecting working efficiency of single-base gene editing technology | |
| CN110317828B (en) | Method for cultivating broad-spectrum bacterial leaf blight resistant rice by modifying rice OsSWEET gene promoter | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN107338266A (en) | A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN105296534A (en) | Method of establishing Lycium Ruthenicum genetic transformation system and application of method | |
| CN103966257B (en) | A kind of Agrobacterium transformation vector compositions for obtaining marker-free transgenic plants and application thereof | |
| CN103952426B (en) | A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application | |
| CN109694879A (en) | General unmarked LIC carrier pMF-LIC and its construction method and application | |
| Vlaardingerbroek et al. | Fluorescence assisted selection of transformants (FAST): using flow cytometry to select fungal transformants | |
| CN101760555B (en) | Method for identifying single-copy transgenic tobacco based on PCR technology | |
| CN107365772B (en) | Plant pollen specific promoter PSP1 and application thereof | |
| CN114480388B (en) | Screening and application of novel promoter element responding to explosive molecules | |
| CN106520766B (en) | Seaweed endogenous constitutive promoter and application thereof | |
| CN105823888B (en) | A kind of Subcellular Localization kit built using sugarcane stripe mosaic virus P3N-PIPO | |
| CN111394491B (en) | Mushroom mating type molecular marker and application thereof in identification of mushroom mating type | |
| CN106883291A (en) | Plant plant type GAP-associated protein GAP PROG2 and its encoding gene and application | |
| CN1330756C (en) | Gene for anti mosaic virus of tomato, and separation method | |
| WO2023179794A1 (en) | Mycobacterium dna detection primer and detection method | |
| CN112391400B (en) | Agrobacterium-mediated genetic transformation method suitable for morinda officinalis endophytic fungus A761 | |
| CN106755581A (en) | The method that one-step method real-time quantitative fluorescence PCR detects carnation mottle virus | |
| CN111560452B (en) | Identification of wheat TaDEP1 gene transcription enhancement cis-acting element, molecular marker and application thereof | |
| Rani et al. | A forward genetics approach identifies pathogenicity genes in Fusarium oxysporum f. sp. carthami, a fungus causing vascular wilt disease of safflower | |
| Shahid et al. | The function of the a-rich region of the alphasatellite associated with the cotton leaf curl disease in Pakistan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190430 |