CN109679961A - A kind of tree-shaped nano-complex of self assembly and its application - Google Patents
A kind of tree-shaped nano-complex of self assembly and its application Download PDFInfo
- Publication number
- CN109679961A CN109679961A CN201811348118.8A CN201811348118A CN109679961A CN 109679961 A CN109679961 A CN 109679961A CN 201811348118 A CN201811348118 A CN 201811348118A CN 109679961 A CN109679961 A CN 109679961A
- Authority
- CN
- China
- Prior art keywords
- chain
- tree
- complex
- shaped nano
- triggering
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N2021/6432—Quenching
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Optics & Photonics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The present invention provides a kind of tree-shaped nano-complex of self assembly and its application, and triggering chain includes cog region, trigger region.The present invention is based on aptamers identifications and catalytic dna probe to be self-assembled into tree-shaped nano-complex, the assembling synthetic method of the compound is simple, stability is good, DNA chain can be self-assembled into tree-shaped nano-complex in the presence of being catalyzed chain, without harsh reaction condition and valuable instrument；It also can image tumors cell surface membrane protein while DNA tree-shaped nano combined analyte detection tumor cell surface Membrane protein's amount；It being capable of specific recognition and active targeting cancer cell membrane albumen and fluorescence imaging by being combined using aptamers and catalysis link；The tree-shaped nano-complex of the DNA is formed by DNA chain self assembly, has lower bio-toxicity and immunogenicity, is conducive to its biologic applications.
Description
Technical field
The present invention relates to field of biotechnology, are based on aptamers identification and catalytic dna probe from group more particularly to one kind
The tree-shaped nano-complex dressed up and its application in detection and in situ imaging circulating tumor cell memebrane protein.
Background technique
Tumourassociated membrane proteins (TMP) are a kind of protein of unconventionality expression in cancer cell.They are usually as identification
In cancer the mark with the physiological status in malignant progression occurs for cancer cell.It is estimated that the 30% of human genome is to compile
Code memebrane protein, the marketed drugs target cell surface memebrane protein of about 30-40%.Therefore, analysis TMP is to diagnosing tumor, drug
Targeting transhipment and cell type classification are most important.Memebrane protein usually contains hydrophobic region, the heterojunction structure of interaction and multiple
Miscellaneous environment therefore causes the analysis program of memebrane protein complicated, cumbersome and depend on so that they separate and purify very troublesome
Expensive instrument.In addition to this, many tumor cell membrane protein abundances are extremely low.The main policies of detection tumour cell memebrane protein at present
It is membrane protein labelling, separation and purifying, then using the technology based on immunofluorescence, Western blotting (WB) or mass spectrum (MS)
Carry out protein determination.WB in terms of half-quantitative detection specific protein although achieve success, but still have some disadvantages:
Sensitivity is low, in fact it could happen that non-specific band, and need complicated operation.Immunofluorescence is most representative and the most frequently used
One of imaging method, but also reach satisfactory degree far away at present.DNA nano-probe technology is due to highly sensitive
Degree, non-damage, can in situ detection the advantages that and have been a great concern.It has been reported that detection method it is most of be all base
In antibody specificity tumor cell surface membrane protein, antibody generally all has price high, not easy to maintain, and potency is unstable etc.
Disadvantage, it would be highly desirable to design new method to overcome drawbacks described above.
Summary of the invention
In view of the foregoing deficiencies of prior art, the purpose of the present invention is to provide one kind is identified and is urged based on aptamers
Change DNA probe be self-assembled into tree-shaped nano-complex for detect in situ imaging circulating tumor cell memebrane protein, for solving
The detection sensitivity of tumourassociated membrane proteins is low in the prior art, poor specificity, it is complicated for operation, at high cost the problems such as.
In order to achieve the above objects and other related objects, first aspect present invention provides a kind of for tumourassociated membrane proteins
The triggering chain of detection and in situ imaging, including cog region, trigger region, the identification region sequence include 5 '-
GGTGGTGGTGGTTGTGGTGGTGGTGG-3 ', the triggering region sequence include 5 '-TGACGAACTAGTTGATGAAGCTG-
3’。
In some embodiments of the invention, the triggering chain further includes isolated area.
In some embodiments of the invention, the isolated area base number is at least one.
In some embodiments of the invention, the isolated area base number is 3.
In some embodiments of the invention, the isolation region sequence is 5 '-TTT-3 '.
Second aspect of the present invention provides a kind of tree-shaped to be received for tumourassociated membrane proteins detection and the self assembly of in situ imaging
Rice compound is obtained by F chain, Q chain, auxiliary chain 1, F ' chain, Q ' chain, auxiliary 2 self assembly of chain,
The nucleotide sequence of the F chain includes:
5’-GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTC
GTCA-3'；
The nucleotide sequence of the Q chain includes:
5'-AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC-3'；
It is described auxiliary chain 1 nucleotide sequence include:
5'-GTGTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT-3'；
The nucleotide sequence of the F ' chain includes:
5'-AGGAGGAGACATAATAGGCACACTGACGAACTAGTTGATGAAGCTG-3'；
The nucleotide sequence of the Q ' chain includes 5 '-CAGCTTCATCAACTAGGTGTGCCTATTATGTCTC-3 '；
The nucleotide sequence of the auxiliary chain 2 includes 5 '-GCACACCTAGTTGATGAAGCTGTG-3 '.
In some embodiments of the invention, the tree-shaped nano-complex of the self assembly is also connected with the triggering chain.
When carrying out tumourassociated membrane proteins detection, triggering chain is first reacted with cell suspension to be detected, then by not connected touching
The tree-shaped nano-complex of self assembly of hair chain is added thereto, and after reaction, by fluorescence intensity, and then calculates membrane egg
Bai Hanliang.
When carrying out tumourassociated membrane proteins imaging, will be connected with triggering chain the tree-shaped nano-complex of self assembly be added to
It detects in cell suspension, after reaction, image is obtained by fluorescence microscope, laser confocal microscope etc..
In some embodiments of the invention, 5 ' ends of the F chain, 3 ' ends of F ' chain, 5 ' ends of auxiliary chain 1, auxiliary chain 2
3 ' ends be respectively connected with fluorophor, 5 ' ends of the Q ' chain, 3 ' ends of Q chain are respectively connected with quenching group.
In some embodiments of the invention, the fluorophor is selected from any one of FAM, HEX.
In some embodiments of the invention, the quenching group is selected from BHQ1.
It is of course also possible to use other fluorophors or quenching group.
Third aspect present invention provides the preparation method of the tree-shaped nano-complex of above-mentioned self assembly, includes the following steps:
1) F chain, F ' chain, Q chain, Q ' chain, auxiliary chain 1, auxiliary chain 2 are dissolved to respectively in buffer, are made containing corresponding
The solution of nucleotide chain；
2) solution containing F chain is mixed with the solution containing Q chain, denaturation annealing is made the first substrate, will contain
The solution of F ' chain is mixed with the solution for containing Q ' chain, denaturation annealing, be made the second substrate, by the first substrate of annealing with contain
There is the solution mixing of auxiliary chain 1, the second substrate of annealing is mixed with the solution containing auxiliary chain 2, after reaction, by two kinds
The tree-shaped nano-complex of the self assembly is made in solution mixing, reaction.
In some embodiments of the invention, in the step 2), by mol, F chain: Q chain=2:3, F ' chain: Q ' chain=
3:4 assists chain 1: auxiliary chain 2=1:2, F chain: F ' chain: auxiliary chain 1=12:27:20.
In some embodiments of the invention, after two kinds of solution mixing, the triggering chain is added, is made and is connected with triggering chain
The tree-shaped nano-complex of self assembly.
In some embodiments of the invention, in the step 2), after the triggering chain is added, the triggering chain is being mixed
Concentration in liquid is 5nM-150nM.
Fourth aspect present invention provides above-mentioned triggering chain or the tree-shaped nano-complex of self assembly is followed in detection and in situ imaging
Application in ring tumour cell memebrane protein.
In some embodiments of the invention, the F chain, F ' chain are used in situ imaging tumour cell memebrane protein.
In some embodiments of the invention, the auxiliary chain 1, auxiliary chain 2 are for detecting tumour cell memebrane protein.
Fifth aspect present invention, which provides, utilizes above-mentioned triggering chain or the tree-shaped nano combined analyte detection of self assembly and in situ imaging
The method of circulating tumor cell memebrane protein, comprising: take cell suspension to be measured, the self assembly that addition is connected with the triggering chain is tree-shaped
Nano-complex, after reaction, centrifugation removes supernatant, obtains image by microscope.The microscope includes but unlimited
In fluorescence microscope, laser confocal microscope.
In some embodiments of the invention, further includes: cell suspension to be measured is taken, triggering chain is added, after reaction, from
The heart removes supernatant, and the tree-shaped nano-complex of self assembly of not connected triggering chain is added, detects fluorescence after reaction, according to
Fluorescence intensity level calculates Membrane protein's amount.
In some embodiments of the invention, tumor cell membrane protein standard curve equation is Y=748.38-
275.96lgX, R2=0.989, Y are fluorescence intensity, and X is tumour cell concentration, unit cell*mL-1.It can be according to tumour cell
Memebrane protein average content, further calculate membrane protein content.
As described above, of the invention is a kind of tree-shaped nano combined based on aptamers identification and the self assembly of catalytic dna probe
Object and its application have the advantages that 1. the present invention is based on aptamers identifications and catalytic dna probe to be self-assembled into tree-shaped receive
Rice compound, the assembling synthetic method of the compound is simple, stability is good, and DNA chain can be self-assembled into the presence of being catalyzed chain
Tree-shaped nano-complex, without harsh reaction condition and valuable instrument；2. the tree-shaped nano combined analyte detection tumour of DNA
It also can image tumors cell surface membrane protein while cell surface membrane protein content；3. by being chained using aptamers and catalysis
Being combined being capable of specific recognition and active targeting cancer cell membrane albumen and fluorescence imaging；4. the tree-shaped nano-complex of the DNA
It is to be formed by DNA chain self assembly, there is lower bio-toxicity and immunogenicity, is conducive to its biologic applications.
Detailed description of the invention
Fig. 1 is shown as the tree-shaped nano-complex experimental principle figure of DNA of the embodiment of the present invention 1.
Fig. 2 is shown as polyacrylamide gel electrophoresis (PAGE) the characterization tree-shaped nano-complex of DNA of the embodiment of the present invention 1
Assembling figure.
Fig. 3 is shown as the triggering tree-shaped nano-complex self assembly of chain catalytic dna of various concentration in the embodiment of the present invention 1
Fluorescence intensity figure.
Fig. 4 is shown as the tree-shaped nano-complex in situ imaging tumour cell memebrane protein figure of DNA of the embodiment of the present invention 1.
Fig. 5 is shown as the laser confocal microscope image tumors cytological map of the embodiment of the present invention 1.
Fig. 6 is shown as the tree-shaped nano combined analyte detection tumor cell membrane protein standard curve of DNA of the embodiment of the present invention 2
Figure.
Specific embodiment
Illustrate embodiments of the present invention below by way of specific specific example, those skilled in the art can be by this specification
Other advantages and efficacy of the present invention can be easily understood for disclosed content.The present invention can also pass through in addition different specific realities
The mode of applying is embodied or practiced, the various details in this specification can also based on different viewpoints and application, without departing from
Various modifications or alterations are carried out under spirit of the invention.
It should be clear that in the following example not specifically dated process equipment or device be all made of conventional equipment in the art or
Device；All pressure values and range all refer to absolute pressure.
In addition, it should also be understood that, one or more method and step mentioned in the present invention does not repel before and after the combination step
It can also be inserted into other methods step there may also be other methods step or between these explicitly mentioned steps, unless separately
It is described；It should also be understood that the combination connection relationship between one or more equipment/device mentioned in the present invention is not repelled
The two equipment/devices specifically mentioned before and after the unit equipment/device there may also be other equipment/device or at these it
Between can also be inserted into other equipment/device, unless otherwise indicated.Moreover, unless otherwise indicated, the number of various method steps is only
Identify the convenient tool of various method steps, rather than for the arrangement order of limitation various method steps or limits the enforceable model of the present invention
It encloses, relativeness is altered or modified, and without material changes in technical content, when being also considered as, the present invention is enforceable
Scope.
Aptamers are the random oligonucleotides synthesized outside human body with the Fas lignand system evolution technology (SELEX) of index concentration
The one section of oligonucleotides (DNA or RNA) that can be interacted with target specificity that repeated screening obtains in sequence library.It is adapted to physical efficiency
With high-affinity and a variety of targets of specific recognition, including protein, small molecule even entire cell.Compared with antibody, adaptation
Body, which has, to be readily synthesized and modifies, and at low cost, compound has many advantages, such as controllability and extremely low immunogenicity.In the present invention,
We are self-assembled into tree-shaped sample DNA using aptamers specific recognition and in conjunction with tumor cell surface memebrane protein catalytic dna probe
Nano-complex is used for while detecting and in situ imaging tumor cell surface memebrane protein, substitution traditional detection tumor cell proteins
Western Blot and the methods of immunohistochemistry.
The present invention is suitable for nucleolin and expresses higher cell imaging and detection.
Embodiment 1
Experimental design principles are as shown in Figure 1, detailed process is as follows: substrate chain A by mark fluorescent group (FAM) DNA chain
(F chain) and DNA chain (Q chain) composition for marking quenching group (BHQ1).When F chain and Q chain are in 95 DEG C of denaturation 5min, then exist
Slow cooling is to room temperature in 30min, and according to base pair complementarity principle, F chain and Q chain form complementary double-strand.Due to fluorophor
It is very close with quencher, cause the fluorescence of substrate chain A that " being quenched " state is presented.Auxiliary chain 1 is designed to substrate corresponding to its
Specific region on Q chain in chain A is complementary.Similarly, substrate chain B by mark fluorescent group (FAM) DNA chain (F ' chain) and label
The DNA chain (Q ' chain) of quenching group (BHQ1) forms.When F ' chain and Q ' chain are after 95 DEG C of denaturation are annealed, according to base pair complementarity
Principle, F ' chain and Q ' chain form complementary double-strand.Since fluorophor and quencher are very close, lead to the fluorescence of substrate chain B
" being quenched " state of presentation.Auxiliary chain 2 is designed to the complementation of the specific region on the Q ' chain in substrate chain B corresponding to its.It is touched when introducing
When sending out chain AS1411-1, bases oneself upon dot blot with substrate chain A exposure and dock, cause branch migration to react, from F strand displacement portion
Divide Q chain and open first ring, then assists chain 1 by being docked to newly exposed foothold for Q strand displacement, and generate by-product
Object A.The Q chain of quenching group is had by dissociating from F chain, the fluorescence in F chain is restored.F chain in substrate chain A exposes
The identical sequence of two series connections can be hybridized by the foothold of two substrate chain B therewith simultaneously.Similarly, in auxiliary chain 2
With the help of by Q ' strand displacement, and generate by-product B, more fluorescent reporter groups are released, and by with triggering chain DNA
Two single-stranded regions of identical sequence composition are exposed reacts hence into a new round.It is ultimately formed by circular response tree-shaped
Nano-complex, and generate more by-product A and by-product B.By-product A is detected by luminoscope and by-product B fluorescence is strong
Degree reduces to detect the amount of tumor cell membrane protein expression, and AS1411-1 is catalyzed the tree-shaped nano-complex to be formed and tumour is thin
The nucleolin of cellular surface combines, thus image tumors epicyte protein.
The sequence that the above process is related to is as follows:
AS1411-Trigger:
(SEQ ID NO.1), lower stroke of single straight line portion are cog region, and lower stroke of wave part is isolated area, and lower stroke of bilinear part is
Trigger region；
F strand:
FAM-GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTT
CGTCA(SEQ ID NO.2)；
Q strand:
AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC-BHQ1(SEQ ID NO.3)；
Assistant1:HEX-GTGTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT (SEQ ID NO.4)；
F'strand:
AGGAGGAGACATAATAGGCACACTGACGAACTAGTTGATGAAGCTG-FAM(SEQ ID NO.5)；
Q'strand:BHQ1-CAGCTTCATCAACTAGGTGTGCCTATTATGTCTC (SEQ ID NO.6)；
Assistant 2:GCACACCTAGTTGATGAAGCTGTG-HEX (SEQ ID NO.7).
The building process that aptamers identification and catalytic dna probe are self-assembled into tree-shaped nano-complex is as follows:
The preparation of hybridization buffer Tris-HCl buffer: pH 7.4, by Tris, NaCl, MgCl2With deionized water group
At wherein Tris, NaCl and MgCl2Final concentration be followed successively by 20mmol*L-1、100mmol*L-1、5mmol*L-1。
1xTE buffer: pH 8.0, ingredient is 10mM Tris, 1mM EDTA (is bought in Yu Shenggong bioengineering (Shanghai)
Co., Ltd) Lot:6703569.
1. after Sangon Biotech (Shanghai) Co., Ltd. synthesizes above-mentioned sequence, by specification TE buffer solution,
Dissolved concentration is 10 μM, and is dispensed into the EP pipe of 200 μ L by the 10 every pipes of μ L, is placed in -20 DEG C and saves backup.
F chain and F ' chain are made into the solution that concentration is 3.0 μM respectively with Tris-HCl buffer；With Tris-HCl buffer
Q chain and Q ' chain are made into the solution that concentration is 4.5 μM respectively；Auxiliary chain 1 and auxiliary chain 2 are matched respectively with Tris-HCl buffer
It is 5.0 μM at concentration.
2. the mixture of F chain (2 μ L, 3 μM) and Q chain (2 μ L, 4.5 μM) is added in the EP pipe of 200 μ L, concussion is mixed
Then it is put into PCR instrument and is heated to 95 DEG C of effects 5 minutes, the first substrate of preparation is then slowly cooled to room temperature in 30 minutes；Together
Reason, by the way that F ' chain (3 4.5 μM of μ L) and Q ' chain (4 4.5 μM of μ L) to be added in the EP pipe of another 200 μ L, concussion mixes right
After be put into PCR instrument be heated to 95 DEG C act on 5 minutes, be then slowly cooled to room temperature in 30 minutes preparation the second substrate.It will move back
The first substrate and the second substrate of fire are separately added into corresponding auxiliary chain 1 (2 5 μM of μ L), auxiliary chain 2 (4 5 μM of μ L), and concussion is mixed
It is incubated at room temperature after even 30 minutes.Finally, the reaction solution in two EP pipes is mixed, AS1411-1 is added, makes it
Final concentration reaches 150nM, incubates 30 minutes at room temperature.By the product after reaction with polyacrylamide gel electrophoresis (PAGE) into
The tree-shaped nano-complex assembling of row characterization DNA, as a result joined aptamers-as shown in Fig. 2, can be seen that from PAGE electrophoretogram
The band for causing first substrate of chain (AS1411-1) disappears, and occurs having the band of much lower mobility, shows the first bottom
Object is assembled into the product with higher molecular weight, and then shows that DNA nano-complex can be self-assembly of tree-shaped form.And do not have
When AS1411-1 is added, the band of the first substrate does not disappear, and also without occurring having the band of much lower mobility, shows
DNA chain can not form tree-shaped nano-complex.
3. by the way that the mixture of F chain (2 3 μM of μ L) and Q chain (2 4.5 μM of μ L) is heated to 95 DEG C and is kept for 5 minutes, and
The first substrate of preparation is cooled to room temperature in 30 minutes.Similarly, by by F ' chain (3 4.5 μM of μ L) and Q ' chain (4 4.5 μM of μ L)
Mixture be heated to 95 DEG C effect 5 minutes and be cooled to room temperature in 30 minutes preparation the second substrate.Then, by the first substrate
It is mixed respectively with corresponding auxiliary chain 1 (2 5 μM of μ L), auxiliary chain 2 (4 5 μM of μ L) with the second substrate and incubates 30 points at room temperature
Clock.Finally, the two is mixed and various concentration (5nm, 10nm, 25nm, 50nm, 100nm, 150nm) is added
AS1411-1 is incubated 30 minutes at room temperature.Then its fluorescent value is detected with luminoscope, as a result as shown in figure 3, curvilinear equation is
Y=748.38-275.96lgX, R2=0.989.With the increase of trigger concentration, the fluorescence intensity of chain is assisted to reduce, and
It is linear.
4. specific image tumors epicyte protein: MCF-7 cell, the MDA- of exponential phase of growth will be in culture dish
MB-231 cell, MCF-10A cell, 16HBE cell take out from incubator, are washed 2 times with PBS buffer solution, are then disappeared with pancreatin
Change cell, 1000rpm is centrifuged 3min, takes a certain number of cells and is prepared into cell suspension in conjunction with liquid.It is added according to step
2. the assembled tree-shaped nano-complex of DNA is placed in and sets concussion 1 hour of hybridization instrument of 37 DEG C.Then 1000rpm is centrifuged
3min discards supernatant (the tree-shaped nano-complex of free DNA).It is washed repeatedly 3 times with PBS, it is ensured that upper tumour could not be combined
The tree-shaped nano-complex of the DNA of cell is washed.Finally, fluorescence is observed under inverted fluorescence microscope, as a result such as Fig. 4 institute
Show, breast cancer MCF-7, MDA-MB-231 cell is observed that fluorescence, and normal galactophore epithelial cell MCF-10A cell and
Bronchial epithelial cell 16HBE cell is barely perceivable fluorescence, shows that this method being capable of specific recognition height expression kernel egg
White tumour cell.
5. laser confocal microscope image tumors cell: thin by the MCF-7 of exponential phase of growth is in 24 hole culture dishes
Born of the same parents, MDA-MB-231 cell, MCF-10A cell, 16HBE cell take out from incubator, are washed 2 times with PBS buffer solution.It is added 1
The serum free medium of milliliter and according to the step 2. tree-shaped nano-complex of assembled DNA, is placed in carbon dioxide incubator (37
Degree, CO2Concentration is 5%) to continue culture 3 hours.Then culture medium is discarded, is washed 2 times with PBS, in laser confocal microscope
Lower observation.
It is illustrated in figure 5 laser confocal microscope image tumors cytological map, the MCF-7 cell of height expression kernel fibroin
Green fluorescence has been observed that with MDA-MB-231 cell, and low expression or does not express the 16HBE of paranuclein and adaptation is not added
The MCF-7 of body is barely perceivable green fluorescence, shows that the tree-shaped nanometer of DNA of assembling being capable of specific recognition height expression kernel egg
White tumour cell.
Embodiment 2
It is taken out the MCF-7 cell of exponential phase of growth is in culture dish from incubator, washs 2 times with PBS buffer solution, so
Trypsin digestion cell is used afterwards, and 1000rpm is centrifuged 3min, takes a certain number of cells and is prepared into cell suspension in conjunction with liquid.Add
Enter aptamers-initiation chain (AS1411-1), is placed in the hybridization instrument for set 37 DEG C and shakes 1 hour.Then 1000rpm is centrifuged
3min discards supernatant (free AS1411-1).It is washed repeatedly 3 times with PBS, it is ensured that could not be in conjunction with upper tumour cell
AS1411-1 is sufficiently removed.By step 2. in the first substrate react with auxiliary chain 1, the second substrate with assist obtained by chain 2 reacts
Reaction solution mixing, the tree-shaped nano-complex of DNA of not connected AS1411-1 is formed, then by the tree-shaped nano-complex of the DNA
It is added in the aforementioned cell liquid for being combined with AS1411-1, after reacting 30min, detects fluorescence with luminoscope, fluorescence intensity level and swollen
Memebrane protein on oncocyte is inversely proportional.
It is illustrated in figure 6 the tree-shaped nano combined analyte detection tumor cell membrane protein standard curve figure of DNA, curvilinear equation Y
=748.38-275.96lgX；R2=0.989,18 cells of minimum detection limit, it is seen then that it is sensitive that the present invention effectively improves detection
Degree.
In conclusion the present invention is based on aptamers identifications and catalytic dna probe to be self-assembled into tree-shaped nano-complex, this is multiple
The assembling synthetic method of conjunction object is simple, stability is good, and DNA chain can be self-assembled into tree-shaped nano combined in the presence of being catalyzed chain
Object, without harsh reaction condition and valuable instrument；The tree-shaped nano combined analyte detection tumor cell surface memebrane protein of DNA
It also can image tumors cell surface membrane protein while content；It can be special by being combined using aptamers and catalysis link
Property identification and active targeting cancer cell membrane albumen and fluorescence imaging；The tree-shaped nano-complex of the DNA be by DNA chain self assembly and
At with lower bio-toxicity and immunogenicity, conducive to its biologic applications.
The above-described embodiments merely illustrate the principles and effects of the present invention, and is not intended to limit the present invention.It is any ripe
The personage for knowing this technology all without departing from the spirit and scope of the present invention, carries out modifications and changes to above-described embodiment.Cause
This, institute is complete without departing from the spirit and technical ideas disclosed in the present invention by those of ordinary skill in the art such as
At all equivalent modifications or change, should be covered by the claims of the present invention.
SEQUENCE LISTING
<110>Hospital of Southern Medical University
<120>a kind of tree-shaped nano-complex of self assembly and its application
<130> PCQNF185685
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 52
<212> DNA
<213> Artificial
<220>
<223> AS1411-Trigger
<400> 1
ggtggtggtg gttgtggtgg tggtggtttt gacgaactag ttgatgaagc tg 52
<210> 2
<211> 69
<212> DNA
<213> Artificial
<220>
<223> F strand
<400> 2
gtgtgcctat tatgtctcct cctgtgtgcc tattatgtct cctcctcagc ttcatcaact 60
agttcgtca 69
<210> 3
<211> 50
<212> DNA
<213> Artificial
<220>
<223> Q strand
<400> 3
aactagttga tgaagctgga cataataggc acacgacata ataggcacac 50
<210> 4
<211> 38
<212> DNA
<213> Artificial
<220>
<223> assistant A
<400> 4
gtgtgcctat tatgtcgtgt gcctattatg tccagctt 38
<210> 5
<211> 46
<212> DNA
<213> Artificial
<220>
<223> F' strand
<400> 5
aggaggagac ataataggca cactgacgaa ctagttgatg aagctg 46
<210> 6
<211> 34
<212> DNA
<213> Artificial
<220>
<223> Q' strand
<400> 6
cagcttcatc aactaggtgt gcctattatg tctc 34
<210> 7
<211> 24
<212> DNA
<213> Artificial
<220>
<223> assistant B
<400> 7
gcacacctag ttgatgaagc tgtg 24
Claims (10)
1. it is a kind of for tumourassociated membrane proteins detection and in situ imaging triggering chain, which is characterized in that including cog region, triggering
Area, the identification region sequence include 5 '-GGTGGTGGTGGTTGTGGTGGTGGTGG-3 ', and the triggering region sequence includes 5 '-
TGACGAACTAGTTGATGAAGCTG-3’。
2. triggering chain according to claim 1, it is characterised in that: the triggering chain further includes isolated area, the isolated area
Base number is at least one, it is preferable that the isolated area base number is 3, it is highly preferred that the isolation region sequence is 5 '-
TTT-3’。
3. a kind of for tumourassociated membrane proteins detection and the tree-shaped nano-complex of self assembly of in situ imaging, by F chain, Q chain, auxiliary
Chain 1, F ' chain, Q ' chain, auxiliary 2 self assembly of chain is helped to obtain,
The nucleotide sequence of the F chain includes:
5’-GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTCGTCA-
3'；
The nucleotide sequence of the Q chain includes:
5'-AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC-3'；
It is described auxiliary chain 1 nucleotide sequence include:
5'-GTGTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT-3'；
The nucleotide sequence of the F ' chain includes:
5'-AGGAGGAGACATAATAGGCACACTGACGAACTAGTTGATGAAGCTG-3'；
The nucleotide sequence of the Q ' chain includes 5 '-CAGCTTCATCAACTAGGTGTGCCTATTATGTCTC-3 '；
The nucleotide sequence of the auxiliary chain 2 includes 5 '-GCACACCTAGTTGATGAAGCTGTG-3 '.
4. the tree-shaped nano-complex of self assembly according to claim 3, it is characterised in that: the tree-shaped nanometer of self assembly is multiple
It closes object and is also connected with triggering chain described in claim 1-2 any one；
And/or the F chain 5 ' end, F ' chain 3 ' end, auxiliary chain 15 ' end, auxiliary chain 23 ' end be respectively connected with fluorescent base
Group, 5 ' ends of the Q ' chain, 3 ' ends of Q chain are respectively connected with quenching group, it is preferable that the fluorophor is in FAM, HEX
It is any, the quenching group be selected from BHQ1.
5. according to the preparation method of the tree-shaped nano-complex of self assembly described in claim 3-4 any one, which is characterized in that packet
Include following steps:
1) F chain, F ' chain, Q chain, Q ' chain, auxiliary chain 1, auxiliary chain 2 are dissolved to respectively in buffer, are made and contain corresponding nucleosides
The solution of sour chain；
2) solution containing F chain is mixed with the solution containing Q chain, denaturation annealing is made the first substrate, will contain F ' chain
Solution mixed with the solution for containing Q ' chain, denaturation annealing, be made the second substrate, by the first substrate of annealing with contain it is auxiliary
It helps the solution of chain 1 to mix, the second substrate of annealing is mixed with the solution containing auxiliary chain 2, after reaction, by two kinds of solution
The tree-shaped nano-complex of the self assembly is made in mixing, reaction.
6. the preparation method of the tree-shaped nano-complex of self assembly according to claim 5, it is characterised in that: the step 2)
In, by mol, F chain: Q chain=2:3, F ' chain: Q ' chain=3:4 assists chain 1: auxiliary chain 2=1:2, F chain: F ' chain: auxiliary chain 1
=12:27:20；
And/or in the step 2), after two kinds of solution are mixed, the triggering chain is added, be made be connected with triggering chain from group
Fill tree-shaped nano-complex, it is preferable that concentration of the triggering chain in mixed liquor is 5nM-150nM.
7. triggering chain described in -2 any one or self assembly tree as claimed in any one of claims 3 to 4 according to claim 1
Application of the shape nano-complex in detection and in situ imaging circulating tumor cell memebrane protein.
8. application according to claim 7, it is characterised in that: F chain, F ' chain are used in situ imaging tumour cell memebrane protein；
And/or auxiliary chain 1, auxiliary chain 2 are for detecting tumour cell memebrane protein.
9. a kind of using triggering chain described in claim 1-2 any one or as claimed in any one of claims 3 to 4 from group
The method for filling tree-shaped nano combined analyte detection and in situ imaging circulating tumor cell memebrane protein characterized by comprising take to be measured
The tree-shaped nano-complex of self assembly for being connected with the triggering chain is added in cell suspension, and after reaction, supernatant is removed in centrifugation
Liquid obtains image by microscope.
10. according to the method described in claim 9, addition triggers chain, instead it is characterized by further comprising: taking cell suspension to be measured
After answering, supernatant is removed in centrifugation, and the tree-shaped nano-complex of self assembly of not connected triggering chain is added, examines after reaction
Fluorescence is surveyed, Membrane protein's amount is calculated according to fluorescence intensity level, it is preferable that tumor cell membrane protein standard curve equation is Y=
748.38-275.96lgX, R2=0.989, Y are fluorescence intensity, and X is tumour cell concentration, unit cell*mL-1, according to tumour
The memebrane protein average content of cell, further calculates membrane protein content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811348118.8A CN109679961A (en) | 2018-11-13 | 2018-11-13 | A kind of tree-shaped nano-complex of self assembly and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811348118.8A CN109679961A (en) | 2018-11-13 | 2018-11-13 | A kind of tree-shaped nano-complex of self assembly and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109679961A true CN109679961A (en) | 2019-04-26 |
Family
ID=66184721
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811348118.8A Pending CN109679961A (en) | 2018-11-13 | 2018-11-13 | A kind of tree-shaped nano-complex of self assembly and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109679961A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023221384A1 (en) * | 2022-05-16 | 2023-11-23 | 南京邮电大学 | In-situ membrane protein dimerization state detection kit and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107860912A (en) * | 2017-11-08 | 2018-03-30 | 南方医科大学南方医院 | A kind of A549 tumour cell detection methods of difunctionalization aptamer mediation |
| US20180344863A1 (en) * | 2016-11-02 | 2018-12-06 | Sichuan University | TDNs-AS1411-Nucleic Acid Drug Nanocomposite Based Drug Delivery System and Preparation Method Thereof |
| US20190048347A1 (en) * | 2016-11-02 | 2019-02-14 | Sichuan University | Nucleic acid aptamer as1411 modified dna tetrahedron and preparation method thereof |
-
2018
- 2018-11-13 CN CN201811348118.8A patent/CN109679961A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180344863A1 (en) * | 2016-11-02 | 2018-12-06 | Sichuan University | TDNs-AS1411-Nucleic Acid Drug Nanocomposite Based Drug Delivery System and Preparation Method Thereof |
| US20190048347A1 (en) * | 2016-11-02 | 2019-02-14 | Sichuan University | Nucleic acid aptamer as1411 modified dna tetrahedron and preparation method thereof |
| CN107860912A (en) * | 2017-11-08 | 2018-03-30 | 南方医科大学南方医院 | A kind of A549 tumour cell detection methods of difunctionalization aptamer mediation |
Non-Patent Citations (7)
| Title |
|---|
| JUMEILIU等: "Bifunctional aptamer-mediated catalytic hairpin assembly for the sensitive and homogenous detection of rare cancer cells", 《ANALYTICA CHIMICA ACTA》 * |
| XUAN F等: "Triggering Hairpin-Free Chain-Branching Growth of Fluorescent DNA Dendrimers for Nonlinear Hybridization Chain Reaction", 《J AM CHEM SOC》 * |
| ZHIZHONG HAN等: "A photoelectrochemical biosensor for determination of DNA based on flower rod-like zinc oxide heterostructures", 《MICROCHIMICA ACTA》 * |
| 吕彬等: "Cell-SELEX技术在肿瘤诊治中的应用进展", 《复旦学报(医学版)》 * |
| 堵玉林等: "基于Cell-SELEX的核酸适配体在生化分析与生物成像中的应用", 《分析化学》 * |
| 贾永梅等: "核酸荧光探针在单细胞成像中的应用研究", 《分析化学》 * |
| 邓家荔等: "核酸适配体AS1411肽缀合物发挥药效的结构模式研究", 《中国药物化学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023221384A1 (en) * | 2022-05-16 | 2023-11-23 | 南京邮电大学 | In-situ membrane protein dimerization state detection kit and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Nucleic acid tests for clinical translation | |
| ES2739430T3 (en) | Assays for the detection of a single molecule and their use | |
| CN102887479B (en) | High polymer-nanoparticle conjugates and method for their stabilization, analysis system and therapeutic agent carrier | |
| JP5964746B2 (en) | DNA-cell conjugate | |
| US9816129B2 (en) | Bioprobes and methods of use thereof | |
| JP2017520251A (en) | Staining on glass slides by primer extension | |
| CN102703601B (en) | Multifunctional magnetic fluorescent microsphere and preparation method and application thereof | |
| Zavoiura et al. | Quantum dot-PNA conjugates for target-catalyzed RNA detection | |
| JPH05508323A (en) | Detection of DNA/RNA by fluorescence polarization | |
| CN108103151A (en) | A kind of method and its application based on the protein-bonded detection of nucleic acids of sequence-specific nucleic acid and parting | |
| WO2022266513A2 (en) | Devices, systems, and methods for analysis of nucleic acids | |
| CN108588252A (en) | A kind of parasite detection kit and its detection method | |
| CN116356079A (en) | RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application | |
| JP2022530981A (en) | Programmable nuclease and usage | |
| TW201321566A (en) | Method and system for determining the status of health of a human subject | |
| Kantak et al. | Integration of DNA barcoding and nanotechnology in drug delivery | |
| CN109679961A (en) | A kind of tree-shaped nano-complex of self assembly and its application | |
| CN111801350A (en) | Sequential staining for multiplex analysis of tissues and cells | |
| KR20190105785A (en) | Pepetide nucleicacid probe for detecting foot-and-mouth disease virus and Uses thereof | |
| JP4301941B2 (en) | Nucleic acid probe immobilization substrate | |
| CN109207555A (en) | A kind of DNase I activity colorimetric detection method | |
| CN110331190A (en) | A kind of method and its application of mercapto-functionalized peptide nucleic acid enhancing silver nanoclusters fluorescence signal detection single nucleotide polymorphism | |
| CN102134596B (en) | Nucleic acid cross flow test strip-based method for detecting single nucleotide polymorphism | |
| WO2005028647A1 (en) | Nucleic acid probe, nucleic acid chip, method of detecting target nucleic acid, method of screening drug, apparatus for detecting target nucleic acid and gene diagnosis method | |
| JP3454847B2 (en) | Hybridization method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190426 |
|
| RJ01 | Rejection of invention patent application after publication |