CN109679923A

CN109679923A - Utilize the method for CRISPR/Cas9 system production VEGF164 transgenic cell line

Info

Publication number: CN109679923A
Application number: CN201910041468.8A
Authority: CN
Inventors: 陈玉林; 金妙函; 师丙波; 蔡蓓; 王小龙
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2019-01-16
Filing date: 2019-01-16
Publication date: 2019-04-26

Abstract

The invention discloses a kind of methods using CRISPR/Cas9 system production VEGF164 transgenic cell line, and steps are as follows: homologous targeting vector PB-G-H-VEGF164-DsRed of the building for the 3 ' areas UTR of hair follicle specific promoter KAP6.1；The sgRNA of synthesis is cloned into pGL3-U6-sgRNA-PGK-puromycin and constitutes sgRNA transcription vector by the sgRNA for designing and synthesizing the CRISPR/Cas9 system cleavage site in the 3 ' areas UTR for KAP6.1；Homologous targeting vector, sgRNA transcription vector and Cas9 expression vector are mixed, down producing goat fetal fibroblast is transfected, the positive down producing goat fetal fibroblast obtained after screening.The present invention solves the more difficult acquisition of homozygous individual, and gene is inserted into the lower problem of efficiency.

Description

Utilize the method for CRISPR/Cas9 system production VEGF164 transgenic cell line

Technical field

The invention belongs to animal genetic engineerings and genetic modification field, specifically, being related to a kind of using CRISPR/Cas9 The method of system production VEGF164 transgenic cell line utilizes CRISPR/Cas9 system production for body more particularly, to a kind of The method of the VEGF164 transgenic cell line of nuclear transplantation.

Background technique

CRISPR/Cas system is obtaining by the RNA specificity cutting exogenous genetic material mediated in bacterium and archeobacteria Obtain property immune system.II type CRISPR/Cas system, that is, CRISPR/Cas9 has been proved to be widely used in internal, external The high efficiency cutting of any given DNA, while also having part research shows that the system can be used for the rite-directed mutagenesis of genome It is inserted into fixed point.CRISPR/Cas9 is high-efficient compared with traditional ZFN and TALEN technology, sequence selection limitation is small, constructed Journey is simple, can target the advantages that multiple genes simultaneously.And the disadvantage of CRISPR/Cas9 maximum is exactly its undershooting-effect, at present It is multiple research shows that this undershooting-effect can be controlled by certain technological means, so the system is still most mainstream at present Gene editing system.

There is Advances in Breeding for traditional breeding method slowly, breeding year limit for length, primary selectable character limited amount The disadvantages of, the theoretical method of molecular marker assisted selection quickly grows practical application difficulty, therefore transgenic breeding technology and biography The combination of system breeding technique is particularly important.VEGF gene can be by promoting the growth of hair papilla cell, and then plays rush The effect of precession object hair growth.In order to improve the suede yield of down producing goat, down producing goat hair follicle development related gene is further studied, For the gene progress gene knock-in test for promoting hair follicle development growth.By CRISPR/Cas9 system in goat genome The VEGF164 of influence production suede character is gene site-directed to be knocked in down producing goat cell, is obtained and is turned for the VEGF164 of body-cell neucleus transplanting Gene cell system is of great significance to the tremendous development of China's animal husbandry.

Summary of the invention

In view of this, the present invention is for the more difficult acquisition of homozygous individual present in transgenic technology, gene be inserted into efficiency compared with Low problem provides a kind of method using CRISPR/Cas9 system production VEGF164 transgenic cell line.

In order to solve the above-mentioned technical problem, turned the invention discloses a kind of using CRISPR/Cas9 system production VEGF164 The method of gene cell system, comprising the following steps:

S1. homologous targeting vector PB-G-H-VEGF164- of the building for the 3 ' areas UTR of hair follicle specific promoter KAP6.1 DsRed；

S2. the sgRNA for designing and synthesizing the CRISPR/Cas9 system cleavage site in the 3 ' areas UTR for KAP6.1, will close At sgRNA be cloned into pGL3-U6-sgRNA-PGK-puromycin constitute sgRNA transcription vector；

S3. the homologous targeting vector of above step, sgRNA transcription vector and Cas9 expression vector are mixed, is utilized3000 transfection down producing goat fetal fibroblasts, after screening the positive down producing goat fetus that obtains at Fibrocyte is the VEGF164 transgenic cell line for being used to produce body-cell neucleus transplanting.

Optionally, homologous targeting vector PB-G-H-VEGF164-DsRed is constructed in step S1 specifically: selection goat base Because for 3 ' UTR region sequence of KAP6.1 gene as homology arm, left homology arm is the KAP6.1 comprising removing terminator codon in group Sequence on the left of gene C DS, right homology arm are the right flanks comprising 3 ' UTR of KAP6.1 gene, realize that foreign gene targets with this Knock in the 3 ' area UTR of KAP6.1 gene and and KAP6.1 gene co-expressing；Using VEGF164 as foreign gene, select DsRed and The series connection of BGH polyA terminator is used as exogenous gene expression box, using the EF1 GFP started and Puro as riddled basins, structure At homologous targeting vector be named as PB-G-H-VEGF164-DsRed.

Optionally, KAP6.1 homology arm PCR amplification primer is KAP-H1-Enzyme and KAP-H2-Enzyme, described KAP-H1-Enzyme includes KAP-H1-Enzyme-F and KAP-H1-Enzyme-R, and nucleotide sequence is respectively SEQ ID Shown in NO.2 and SEQ ID NO.3；The KAP-H2-Enzyme includes KAP-H2-Enzyme-F and KAP-H2-Enzyme-R, Its nucleotide sequence is respectively shown in SEQ ID NO.4 and SEQ ID NO.5.

Optionally, the DNA sequence dna of sgRNA sequence action site is as follows in step S2: shown in SEQ ID NO.32-37.

Optionally, for producing the building of the VEGF164 transgenic cell line of body-cell neucleus transplanting in step S3 specifically: By mass mixings such as homologous targeting vector, sgRNA transcription vector and Cas9 expression vectors, utilize3000 Down producing goat fetal fibroblast is transfected, is after 1 μ g/mL puromycin and 26 road μ g/mL pest rhzomorphs are screened using concentration The positive VEGF164 transgenosis down producing goat fetal fibroblast of acquisition is the VEGF164 for being used to produce body-cell neucleus transplanting Transgenic cell line.

The invention also discloses a kind of VEGF164 transgenic cell lines that above-mentioned method is prepared.

The invention also discloses a kind of above-mentioned methods in the gene editing goat of the production gene site-directed insertion of VEGF164 Application.

Optionally, the sgRNA transcription vector in the 3 ' areas UTR for KAP6.1 is transfected jointly with Cas9 expression vector to thin Born of the same parents use positive cell as donor cell, the gene knocked out by the 3 ' areas UTR that the method for nuclear transfer produces KAP6.1 after screening Edit goat.

Optionally, same after being transcribed in vitro for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 and Cas9 expression vector When be injected into fertilized eggs, then by embryo transfer be used for produce targeting knockout KAP6.1 the 3 ' areas UTR gene editing goat.

Optionally, sgRNA transcription vector, Cas9 expression vector and homologous targeting vector are transfected simultaneously to cell, screening It uses positive cell as donor cell afterwards, the gene editing mountain of the gene site-directed insertion of VEGF164 is produced by the method for nuclear transfer Sheep.

Compared with prior art, the present invention can be obtained including following technical effect:

1) the VEGF164 gene in homologous targeting vector is passed through into molecular biology method (polymerase chain reaction, limitation Property endonuclease digestion, connection the methods of) change other genes (such as T β 4, related to hair follicle development) into, the function for other genes Research and the production of gene editing sheep；

(2) it will transfect jointly for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 and Cas9 expression vector to cell, For studying the function in the 3 ' areas UTR of KAP6.1；

(3) it will transfect jointly for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 and Cas9 expression vector to cell, It uses positive cell as donor cell after screening, is compiled by the gene that the 3 ' areas UTR that the method for nuclear transfer produces KAP6.1 knock out Collect goat；

(4) it is infused simultaneously after being transcribed in vitro for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 with Cas9 expression vector Fertilized eggs are injected, then are used to produce the gene editing goat in the 3 ' areas UTR of targeting knockout KAP6.1 by embryo transfer；

(5) sgRNA transcription vector, Cas9 expression vector and homologous targeting vector are transfected simultaneously to cell, is used after screening Positive cell produces the gene editing goat of the gene site-directed insertion of VEGF164 by the method for nuclear transfer as donor cell；

(6) sgRNA transcription vector, Cas9 expression vector and homologous targeting vector are transfected simultaneously to cell, after screening, The function of the research VEGF164 gene of the positive cell in cellular genome is inserted into using VEGF164 gene.

(7) by obtaining VEGF164 gene knock-in cell, homozygous gene can be obtained by experimental methods such as nuclear transfer and knocked in Individual.

(8) present invention is compared to ZFN (zinc-finger nucleases) and TALEN (transcription before Activator-like effector nucleases) etc. technologies, be better able to it is simple, effectively, convenient and fast " editor " any base Cause.

Certainly, it implements any of the products of the present invention it is not absolutely required to while reaching all the above technical effect.

Detailed description of the invention

The drawings described herein are used to provide a further understanding of the present invention, constitutes a part of the invention, this hair Bright illustrative embodiments and their description are used to explain the present invention, and are not constituted improper limitations of the present invention.In the accompanying drawings:

Fig. 1 is turn that the present invention carries out the insertion of CRISPR/Cas9 system production VEGF164 gene using homologous targeting vector The carrier construction figure of gene cell system；

Fig. 2 is PB-G plasmid construction figure in the embodiment of the present invention 1；

Fig. 3 is PB-G plasmid enzyme restriction qualification figure in the embodiment of the present invention 1, M:1Kb plus DNA ladder；

Fig. 4 is PB-G-T2A plasmid enzyme restriction qualification figure in the embodiment of the present invention 1, M:1kb plus DNA ladder；1,2, 3,4:KpnI, XbaI double digestion；

Fig. 5 is PB-G-T2A in the embodiment of the present invention 1, and PB-G-H1-T2A plasmid enzyme restriction qualification figure, A:M is 1kb plus DNA ladder；1:PB-G-T2A is through ClaI, KpnI double enzyme digestion product；B:M is 1kb Gene Ruler, 2:PB-G-T2A-H1 Through ClaI, KpnI double enzyme digestion product；

Fig. 6 is PB-G-H1-T2A in the embodiment of the present invention 1, and PB-G-H plasmid enzyme restriction qualification figure, A:M1 is 1kb plus DNA ladder；1:PB-G-T2A-H1 is through BamHI, NotI double enzyme digestion product；B:M2:1kb Gene Ruler；2:PB-G-H warp BamHI, NotI double enzyme digestion product；

Fig. 7 is PB-G-H-DsRed plasmid enzyme restriction qualification figure in the embodiment of the present invention 1, and A:M1 is 1kb Gene Ruler, 1:PB-G-H is through NdeI, XbaI double enzyme digestion product；B:M2:DL2000 molecular labeling, 2:DsRed PCR product；C:M1:1kb Gene Ruler, 3:PB-G-H-DsRed are through NdeI, XbaI double enzyme digestion product；

Fig. 8 is homologous targeting vector PB-G-H-VEGF164-DsRed plasmid enzyme restriction qualification figure in the embodiment of the present invention 1, A: M1:1kb Gene Ruler, 1:PB-G-H-VEGF164-DsRed are through KpnI, BamHI double enzyme digestion product；B:M2 is 1kb plus DNA ladder molecular labeling, 2 be PB-G-H-VEGF164-DsRed through XbaI, KpnI double enzyme digestion product；

Fig. 9 is that T7E1 digestion detects Cas9:sgRNA cutting efficiency figure, A:PCR product and T7E1 in the embodiment of the present invention 3 Restriction enzyme digestion and electrophoresis figure；B: gray value analyzes cutting efficiency；

Figure 10 is monoclonal cell VEGF164, GFP the identified for genes result summary view of picking in the embodiment of the present invention 5, In, A:sgRNA3；B:sgRNA4:C:sgRNA5；D:sgRNA12；M is DL2000 molecular labeling；

Figure 11 is the monoclonal cell junction PCR product qualification result figure of picking in the embodiment of the present invention 5, wherein A:sgRNA3；B:sgRNA4:C:sgRNA5；D:sgRNA12；M:1kb plus DNA ladder

Figure 12 is that the monoclonal cell 5 ' of picking in the embodiment of the present invention 5 holds nest-type PRC digestion qualification figure；

Figure 13 is that the present invention 5 ' holds nest-type PRC and digestion identification schematic diagram.

Specific embodiment

Carry out the embodiment that the present invention will be described in detail below in conjunction with embodiment, whereby to the present invention how application technology hand Section solves technical problem and reaches the realization process of technical effect to fully understand and implement.

The building of the homologous targeting vector PB-G-H-VEGF164-DsRed of embodiment 1

(1) homologous targeting vector skeleton PB-G building

Element needed for constructing homologous targeting vector skeleton PB-G has: BGH polyA terminator, EF1-GFP-Puro, AmpR-ori.Three kinds of segments use the method for PCR to obtain from PB513B or PCDNA3.1 (+) amplification respectively.Amplimer is mutual Between have overlapping region, be convenient for later use POE-PCR carrier construction.Primer also added restriction enzyme site, be convenient for later use The position of other segments of digestion connection addition, restriction enzyme site and primer is as shown in Figure 2.Segment after amplification using POE-PCR into Row amplification, product convert DH5 α competent escherichia coli cell, and picking single bacterium falls within the LB liquid medium of the 5mL mycin of benzyl containing ammonia Middle expansion culture, carries out plasmid extraction with plasmid extraction kit (Omega).KpnI single endonuclease digestion is carried out to the plasmid PB-G of extraction Identification, as a result as shown in Figure 3.

(2) T2A sequent synthesis and it is connected into PB-G

Linker (T2A) sequence needed for restriction enzyme site needed for design connection foreign gene and connection foreign gene, sequence Sequence is KpnI-T2A-BglII-EcoRI-T2A-NdeI-XbaI.KpnI, XbaI enzyme cutting PB-G plasmid and linker are used simultaneously (T2A) sequence, with the 16 DEG C of connections overnight of T4DNA ligase after recycling.Connection product converts DH5 α competent escherichia coli cell, Picking single bacterium, which is fallen within, expands culture in the LB liquid medium of the 5mL mycin of benzyl containing ammonia.It is carried out with plasmid extraction kit (Omega) Plasmid extracts, and carries out the identification of KpnI, XbaI double digestion to the plasmid PB-G-T2A of extraction, as a result as shown in Figure 4.

(3) the homologous arm region amplification of KAP6.1 and sequencing

Using the KAP6.1 sequence (NCBI accession number is NM_001193399.1) of sheep in goat genome 1.0 BLAST homologous sequence obtains goat KAP6.1 and is located at No. 1 position chromosome 4409723-4412300.Utilize No. 1 of KAP6.1 440500-4416000 sequence in chromosome, design primer PCR amplification KAP6.1 regional sequence.It is set using KAP6.1 regional sequence Count homology arm primer.Primer sequence and fragment length are as shown in table 1.

1 KAP6.1 homology arm PCR amplification primer of table

KAP-H1-Enzyme is left homology arm, and upstream and downstream adds the restriction enzyme site of ClaI, KpnI respectively.KAP-H2- Enzyme is right homology arm, and upstream and downstream primer adds the restriction enzyme site of BamHI, NotI respectively.

(4) KAP6.1 homology arm is connected into PB-G-T2A

PB-G-T2A and KAP-H1-T-Enzyme is subjected to ClaI/KpnI double digestion simultaneously, with 16 DEG C of T4 DNA ligase Recovery product is connected overnight, and connection product converts DH5 α competent escherichia coli cell.Picking single bacterium falls within the 5mL mycin of benzyl containing ammonia LB liquid medium in expand culture, carries out plasmid extraction with plasmid extraction kit (Omega), to extract plasmid progress The identification of Cla I/KpnI double digestion, isolates two swimming bands, respectively 4916bp, 1100bp and PB-G-T2A and KAP-H1- Enzyme clip size is identical, it was demonstrated that left homology arm is successfully connected into PB-G-T2A plasmid, as a result as shown in Figure 5.Similarly, will PB-G-H1-T2A and KAP-H2-T-Enzyme is linear by KAP-H2 segment and PB-G-H1-T2A after BamHI and NotI digestion Skeleton recycling is connected with T4 ligase, constructs carrier PB-G-H.6A figure is PB-G-H1-T2A after BamHI and NotI digestion Linearized graph shows that plasmid is successfully cut, and 6B figure is PB-G-H after the right homology arm of connection through BamHI, NotI, KpnI digestion Afterwards, the swimming band of 1492bp is isolated, it is in the same size with right homology arm, it was demonstrated that left and right homology arm is successfully connected into PB-G-TA.

(5) DsRed is connected into Pb-G-H using plasmid pDsRed1-N1 as template, uses DsRed-Nde-F (GGGTTTCATATGGCCTCCTCCGAGGACGT)、DsRed-XbaI-R(GCTCTAGACTACAGGAACAGGTGGTGGC)PCR Amplify the DsRed segment with NdeI, XbaI enzyme cutting site, size 675bp.PCR is detected through 1% agarose gel electrophoresis Product recycles DsRed segment with product system QIAquick Gel Extraction Kit (Omega) as a result as shown in Fig. 7 B figure.

The PB-G-H and DsRed of recycling is subjected to NdeI, XbaI double digestion simultaneously, digestion products are connected with T4 ligase, Connection product converts DH5 α competent escherichia coli cell.Picking single bacterium is fallen in the LB liquid medium of the 5mL mycin of benzyl containing ammonia Expand culture, carry out plasmid extraction with plasmid extraction kit (Omega), carries out NdeI, XbaI double digestion mirror to plasmid is extracted Fixed, 7A figure is that PB-G-H is linearized through NdeI, XbaI double digestion as a result, showing that PB-G-H is successfully cut, and 7C figure is that DsRed connects NdeI, XbaI double digestion are as a result, respectively be isolated by two swimming bands of 7508bp and 675bp, with PB-G-H and DsRed after entering PB-G-H It is in the same size, it was demonstrated that DsRed is successfully connected into PB-G-H.

(6) VEGF164 is connected into PB-G-H

Using plasmid VEGF164-PMD19T simple as template, VEGF164-BglII-F is used (gaagatctATGAACTTTCTGCTCTCTTGGG), VEGF-EcoRI-R (ggaattcCCGCC TCGGCTTGTCAC) PCR expands Increase the VEGF segment for having BglII, EcoRI restriction enzyme site out, size 570bp.PCR is detected through 1% agarose gel electrophoresis Product recycles segment with product system QIAquick Gel Extraction Kit (Omega).

The PB-G-H-DsRed and VEGF of recycling is subjected to BglII, EcoRI double digestion simultaneously, digestion products are connected with T4 Enzyme connection, connection product convert DH5 α competent escherichia coli cell.Picking single bacterium falls within the LB liquid training of the 5mL mycin of benzyl containing ammonia It supports and expands culture in base, carry out plasmid extraction with plasmid extraction kit (Omega), plasmid progress XbaI, KpnI are bis- to extracting Two band of 4743bp and 4016bp is isolated in digestion identification, and size and expected consistent and KpnI, BamHI double digestion are identified, Two band of 7386bp and 1373bp is isolated, consistent with expection, digestion result is as shown in Figure 8.

Therefore, the present embodiment 1 selects KAP6.1 gene 3 ' in goat genome according to goat genome sequence in NCBI For UTR region sequence as homology arm, left homology arm is comprising KAP6.1 gene C DS (removing terminator codon) left side sequence, the right side Homology arm is the right flanks comprising 3 ' UTR of KAP6.1 gene, realizes that 3 ' UTR of KAP6.1 gene is knocked in foreign gene targeting with this Area and and KAP6.1 gene co-expressing.Using VEGF164 as foreign gene, the series connection of DsRed and BGH polyA terminator is selected to make For exogenous gene expression box, using the EF1 GFP started and Puro as riddled basins, the homologous targeting vector of composition is named For PB-G-H-VEGF164-DsRed, as shown in Figure 1, its sequence is as shown in SEQ ID NO.1.

Building of the embodiment 2 for the sgRNA transcription vector of the CRISPR/Cas9 system of 3 ' UTR of KAP6.1 gene

(1) 3 ' UTR sequences that KAP6.1 is extracted in the sequencing result in the region KAP6.1 are found for the 3 ' UTR of Kap6.1 To 22 sgRNA target sites, target site of 6 sites as sgRNA is therefrom selected.

(2) for 6 sgRNA target site sgRNA-3, sgRNA-4 of selection, sgRNA-5, sgRNA-12, sgRNA-13, SgRNA-21 designs annealing primer, and anneal upstream primer is the target site sequence that 5 ' -3 ' front ends add accg, and downstream primer is 5 ' -3 ' front ends add the target site reverse complementary sequence of aaac, are shown in Table 2.If first base of target site is G, upstream is drawn It is acc that object, which adds sequence, and downstream primer addition aaac and the C upstream and downstream primer for removing 3 ' ends are passed through annealing and formed and BsaI line Property pGL3-U6-sgRNA-PGK-puromycin stickiness complementation DNA fragmentation, be ligated and transformed into bacillus coli DH 5 alpha, apply Picking single colonie after plate is sequenced correct single colonie and is inoculated in the LB culture medium containing Amp through sequencing identification, 37 DEG C, 200rpm Bacterium is shaken overnight, is extracted plasmid and is named sgRNA-3, sgRNA-4, sgRNA-5, sgRNA-12, sgRNA-13, sgRNA-21 respectively, For later period cell experiment.

Table 2 is directed to the sgRNA sequence in the 3 ' area UTR of KAP6.1 gene

The Efficiency testing of 3 CRISPER-Cas9 system of embodiment

(1) by extracting the DNA of transfection Cas9 and different sgRNA carrier cells, and as template, PCR amplification sgRNA The destination region of cutting.Primer is as follows:

T7E1-F:ACTACTATTGAGGATGCCAC

T7E1-R:GTCTTCTGCATGGAAGTCAA

(2) 50 μ L, 5 × PrimeSTAR Buffer (Mg2+Plus) of PCR overall reaction system, 10 μ L, dNTP Mixture (2.5mM each) 4 μ L, each 1.5 μ L, PrimeSTAR HS DNA Polymerase of upstream and downstream primer (10 μM) (2.5U/ μ L) 0.5 μ L, genomic DNA 100ng, aqua sterilisa are supplemented to 50 μ L.PCR reaction condition: 95 DEG C of initial denaturation 3min；98 DEG C of denaturation 10s, 58 DEG C of annealing 15s, 72 DEG C of extension 30s, 32 recycle；72℃5min.Using 1% agarose gel electrophoresis to PCR product It is detected, and is recycled using product system QIAquick Gel Extraction Kit.

(3) denaturation annealing is carried out to PCR product.Reaction system are as follows: 18 μ L, the NEBuffer22 μ of PCR product of 11ng/ μ L L, totally 20 μ L.Annealing reaction condition: 95 DEG C of 5min, 95 DEG C of 5s 5 circulations, 2 DEG C of each cycle down, 85 DEG C of 5s, each cycle down 0.1℃。

(4) 0.3 μ L T7E1 (NEB), 37 DEG C of water-bath 25min are added in denaturation annealing reaction system.With 2.3% agar Digestion result is identified in sugared gel electrophoresis.

(5) it using the band gray value of Quantity one analysis gel electrophoresis result, is calculated in conjunction with stripe size different SgRNA:Cas9 cutting genome efficiency, 9A figure is the PCR result that different sgRNA correspond to cell DNA KAP6.13 ' UTR Scheme and after T7E1 digestion as a result, sgRNA-3, sgRNA-4, sgRNA-5, sgRNA-12 appearance separation band, show sgRNA pairs Genome is edited, and 9B figure is analyzed by the gray value to two bands, show sgRNA-3, sgRNA-4, sgRNA-5, The editorial efficiency of sgRNA-12 is respectively 36.31%, 29.68%, 33.84%, 9.14%.

Embodiment 4 utilizes CRISPR/Cas9 system production for the VEGF164 transgenic cell line of body-cell neucleus transplanting Method

(1) homologous targeting vector PB-G-H-VEGF164-DsRed, sgRNA for being prepared in above embodiments are transcribed Carrier and Cas9 expression vector are mixed by 1:1:1, are utilized3000 transfection down producing goat fetuses are at fiber finer Born of the same parents.

(2) the 10%FBS DMEM/F12 cell containing 26 μ g/mL piricularrins Yu 1ug/mL puromycin is used instead afterwards for 24 hours Culture solution carries out primary dcreening operation 48h, removes the cell of untransfected plasmid.It is passed in 6 orifice plates in the ratio of 1:10 by cell is transfected afterwards, Every kind of sgRNA passes 4 wares, and the rear 10%FBS DMEM/F12 cell culture fluid with 1ug/mL puromycin screens.It is used instead after 3d The 10%FBS DMEM/F12 cell culture fluid of 0.5 μ g/mL puromycin continues to screen 6-15d.

(3) it after occurring to cell clone, with the dipped 0.25% trypsase pancreatin of the 2x2mm filter paper of sterilizing, will filter The scraps of paper are attached on single cell colonies 10-15 seconds, and the filter paper that taking-up is stained with cell is put in 24 orifice plates with 10%FBS's DMEM/F12 cell culture fluid culture.Cell is transferred to 6 orifice plates after covering in 24 orifice plates continues to cultivate, and after covering with, that is, obtains Obtain the cell clone that foreign gene is knocked in.Cell a part is frozen, a part universal pillar DNA extraction kit (north Jing Kangwei century) therefrom extract cell DNA.

Identification of the embodiment 5 for the VEGF164 transgenic cell line of body-cell neucleus transplanting

(1) DNA extracted using cell clone is template, with VEGF164-BglII-F, VEGF-EcoRI-R amplification Whether VEGF164 detection VEGF164 knocks in success, and amplified fragments size is 570bp, PCR overall reaction system 50 μ L, 5 × PrimeSTAR Buffer(Mg²⁺Plus) 10 μ L, dNTP Mixture (2.5mM each) 4 μ L, upstream and downstream primer (10 μM) are each 1.5 μ L, PrimeSTAR HS DNA Polymerase (2.5U/ μ L) 0.5 μ L, genomic DNA 100ng, aqua sterilisa are supplemented to 50μL.PCR reaction condition: 95 DEG C of initial denaturation 3min；98 DEG C of denaturation 10s, 58 DEG C of annealing 15s, 72 DEG C of extension 30s, 32 recycle； 72℃5min.PCR product is detected using 1% agarose gel electrophoresis, and cell DNA amplifies 756bp and 570bp band, Show that foreign gene VEGF164 and GFP are successfully knocked in Northern Shaanxi White Cashmere Goat fetal fibroblast genome, such as Figure 10 institute Show.

(2) same template with GFP primer (F:CGTGATGGGCTAC GGCTTCTAC, R: TCGTACTTCTCGATGCGGGTGT) whether PCR amplification detection GFP knocks in.PCR reaction system and reaction condition is as described above. PCR product detect as shown in Figure 10 using 1% agarose gel electrophoresis.

(3) using all cell clones extract DNA as template, with 5 ' junction PCR primers (F: TATGCAAGGGAACTCAGTATGA, R:TAGGTGCCGAAGTGGTAGAA) and 3 ' junction PCR primers (F: CACGCCATCAACAACGGC, R:GGTTATGTGGGGAGCCATATC) junction PCR is carried out, be to detect exogenous sequences No correct integration.50 μ L, 5 × PrimeSTAR Buffer (Mg2+Plus) of PCR overall reaction system, 10 μ L, dNTP Mixture (2.5mM each) 4 μ L, each 1.5 μ L, PrimeSTAR HS DNA Polymerase of upstream and downstream primer (10 μM) (2.5U/ μ L) 0.5 μ L, genomic DNA 100ng, aqua sterilisa are supplemented to 50 μ L.PCR reaction condition: 98 DEG C of denaturation 10s, 60 DEG C of annealing 15s, 68 DEG C extend 30s, 30 circulation.PCR product is detected using 1% agarose gel electrophoresis, to determine whether foreign gene is pressed It is correctly integrated according to expected mode, discovery only has part cell junction PCR amplification shaping band, as shown in figure 11.

(4) choose correct 5 ' the junction PCR product of size, using 5 ' NEST of nest-type PRC primer (F: ACCCGAGAACAACCTCAACA, R:GCATACATTATACGAAGT TATGCTAGCGCGT GGGGATACCCCCTAGA) it carries out Nested PCR amplification, PCR reaction system and reaction condition are detected with (3), PCR product using 1% agarose gel electrophoresis, To which the integration more intuitively to 5 ' ends determines that PCR result has miscellaneous band to show there there is more gene integration type in cell Kind, as shown in figure 12.

(5) 5 ' NEST product utilization BglII, EcoRI carry out digestion identification.Digestion is digested overnight in 37 DEG C, digestion 20 μ L, 10 × H Buffer of overall reaction system, 2 μ L, 5 ' NEST recovery product, 111 μ L of μ L, EcoRI of μ g, BglII.Digestion is anti- Answer condition: 37 DEG C of water-baths are stayed overnight.Digestion products are detected using 1% agarose gel electrophoresis, occur 1078bp, 570bp, The cell of 340bp tri- swimming bands and expected consistent, shows that these cells 5 ' end exogenous origin gene integrator is correct, such as the institute of Figure 12 and 13 Show.

Above description has shown and described several preferred embodiments of invention, but as previously described, it should be understood that invention is not It is confined to form disclosed herein, should not be regarded as an exclusion of other examples, and can be used for various other combinations, modification And environment, and can be carried out within that scope of the inventive concept describe herein by the above teachings or related fields of technology or knowledge Change.And changes and modifications made by those skilled in the art do not depart from the spirit and scope of invention, then it all should be in the appended power of invention In the protection scope that benefit requires.

Sequence table

<110>Xibei Univ. of Agricultural & Forest Science & Technology

<120>method of CRISPR/Cas9 system production VEGF164 transgenic cell line is utilized

<130> 2018

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8725

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 1

catcgatagc agcagcagta gcagcatgtt gataagggac ttggtttggc acattaataa 60

acataaatat gttagtatat tggatatttt cttagaatgt aaatctaaca ctaatgagca 120

aactagtttg tataactgta tattcaattt agaaaaacaa gtggagaaat caggtttcaa 180

gaaataactc ctttttgcag tccttcaata gaaattgagc ataaatgtga attagtcatt 240

ggcatagaca gaaaaatata atacattttg ctcagacttg gtttactgga aactttaact 300

ggttgggtta tgatcaacat catgggaata aaagatacat tatagtttca atataggaaa 360

gaaactgact cactgaagaa gataatttgg atcaagaaga taagaatctt tgagtaaaaa 420

ggagttgtta gtcttaagaa aaaaatttta acgtttggtg aaacaaactg aggtcaagag 480

caaataagat taagaccaac aaatatattt ctcactatac tgaaggtgct aggtggttag 540

aataaaatgt gtgatctcgg acaggactgt gtaggtgtga gtctgcacct cctctcattc 600

agttccttaa ttggataaga ggaatctaaa ctgagatgtc aacacagcaa gcctgctgaa 660

tttctctgag gtttcatctt tggttgtgaa caacaagcta attagtccag tcatacagtt 720

agccaatggc atgaaggtgt ggtgggtcac acccacactg agggcatata aaaggccctc 780

tgcagggaga aatgtccaca ctcaagtgac acttctactc tcattctcta cccgagaaca 840

acctcaacaa ccaacaccat gtgtggctac tacggaaact actacggcgg cctccgctgt 900

ggggggcatg gctatggggg ggctggctgg ggggttgggc cccggggctg tggctatggc 960

tgtggctatg gctgtggcta tggctgtggc tcccgccctc tctatggctg tggctatggc 1020

tgtggctatg gctatggctc ccgctctctc tgtggaagtg gctatggatg tggctctggc 1080

tatggctctg gctttggcta ctactattgg taccgagggc agaggaagtc ttctaacatg 1140

cggtgacgtg gaggagaatc ccggccctag atctatgaac tttctgctct cttgggtgca 1200

ttggagcctt gccttgctgc tctaccttca ccatgccaag tggtcccagg ctgcacccat 1260

ggcagaagga gggcagaaac cccatgaagt gatgaagttc atggatgtct accagcgcag 1320

cttctgccgt cccattgaga ccctggtgga catcttccag gagtacccag atgagattga 1380

gttcattttc aagccgtcct gtgtgcccct gatgcggtgc gggggctgct gtaatgacga 1440

aagtctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta tgcggatcaa 1500

acctcaccaa agccagcaca taggagagat gagtttccta cagcataaca aatgtgaatg 1560

cagaccaaag aaagataaag caaggcaaga aaatccctgt gggccttgct cagagcggag 1620

aaagcatttg tttgtacaag atccgcagac gtgtaaatgt tcctgcaaaa acacagactc 1680

gcgttgcaag gcgaggcagc ttgagttaaa cgaacgtact tgcagatgtg acaagccgag 1740

gcgggaattc gagggcagag gaagtcttct aacatgcggt gacgtggagg agaatcccgg 1800

ccctcatatg gcctcctccg aggacgtcat caccgagttc atgcgcttca aggtgcgcat 1860

ggagggcacc gtgaacggcc acgagttcga gatcgagggc gagggcgagg gccgccccta 1920

cgagggccac aacaccgtga agctgaaggt gaccaagggc ggccccctgc ccttcgcctg 1980

ggacatcctg tccccccagt tccagtacgg ttccaaggtg tacgtgaagc accccgccga 2040

catccccgac tacaagaagc tgtccttccc cgagggcttc aagtgggagc gcgtgatgaa 2100

cttcgaggac ggcggcgtgg cgaccgtgac ccaggactcc tccctgcagg acggctgctt 2160

catctacaag gtgaagttca tcggcgtgaa cttcccctcc gacggccccg tgatgcagaa 2220

gaagaccatg ggctgggagg cctccaccga gcgcctgtac ccccgcgacg gcgtgctgaa 2280

gggcgagacc cacaaggccc tgaagctgaa ggacggcggc cactacctgg tggagttcaa 2340

gtccatctac atggccaaga agcccgtgca gctgcccggc tactactacg tggacgccaa 2400

gctggacatc acctcccaca acgaggacta caccatcgtg gagcagtacg agcgcaccga 2460

gggccgccac cacctgttcc tgtagtctag agggcccgtt taaacccgct gatcagcctc 2520

gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 2580

cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 2640

tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 2700

ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt ctgaggcgga 2760

aagaaccagc tggggctcta gggggtatcc ccacgcgcta gcataacttc gtataatgta 2820

tgctatacga agttatagga tctggatcgc tccggtgccc gtcagtgggc agagcgcaca 2880

tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaacggg tgcctagaga 2940

aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag 3000

ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaacggg 3060

tttgccgcca gaacacagct gaagcttcga ggggctcgca tctctccttc acgcgcccgc 3120

cgccctacct gaggccgcca tccacgccgg ttgagtcgcg ttctgccgcc tcccgcctgt 3180

ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa agctcaggtc gagaccgggc 3240

ctttgtccgg cgctcccttg gagcctacct agactcagcc ggctctccac gctttgcctg 3300

accctgcttg ctcaactcta cgtctttgtt tcgttttctg ttctgcgccg ttacagatcc 3360

aagctgtgac cggcgcctac gctagacgcc accatggaga gcgacgagag cggcctgccc 3420

gccatggaga tcgagtgccg catcaccggc accctgaacg gcgtggagtt cgagctggtg 3480

ggcggcggag agggcacccc caagcagggc cgcatgacca acaagatgaa gagcaccaaa 3540

ggcgccctga ccttcagccc ctacctgctg agccacgtga tgggctacgg cttctaccac 3600

ttcggcacct accccagcgg ctacgagaac cccttcctgc acgccatcaa caacggcggc 3660

tacaccaaca cccgcatcga gaagtacgag gacggcggcg tgctgcacgt gagcttcagc 3720

taccgctacg aggccggccg cgtgatcggc gacttcaagg tggtgggcac cggcttcccc 3780

gaggacagcg tgatcttcac cgacaagatc atccgcagca acgccaccgt ggagcacctg 3840

caccccatgg gcgataacgt gctggtgggc agcttcgccc gcaccttcag cctgcgcgac 3900

ggcggctact acagcttcgt ggtggacagc cacatgcact tcaagagcgc catccacccc 3960

agcatcctgc agaacggggg ccccatgttc gccttccgcc gcgtggagga gctgcacagc 4020

aacaccgagc tgggcatcgt ggagtaccag cacgccttca agacccccat cgccttcgcc 4080

agatcccgcg ctcagtcgtc caattctgcc gtggacggca ccgccggacc cggctccacc 4140

ggatctcgcg agggcagagg aagtcttcta acatgcggtg acgtggagga gaatcccggc 4200

cctatgaccg agtacaagcc cacggtgcgc ctcgccaccc gcgacgacgt ccccagggcc 4260

gtacgcaccc tcgccgccgc gttcgccgac taccccgcca cgcgccacac cgtcgatccg 4320

gaccgccaca tcgagcgggt caccgagctg caagaactct tcctcacgcg cgtcgggctc 4380

gacatcggca aggtgtgggt cgcggacgac ggcgccgcgg tggcggtctg gaccacgccg 4440

gagagcgtcg aagcgggggc ggtgttcgcc gagatcggcc cgcgcatggc cgagttgagc 4500

ggttcccggc tggccgcgca gcaacagatg gaaggcctcc tggcgccgca ccggcccaag 4560

gagcccgcgt ggttcctggc caccgtcggc gtctcgcccg accaccaggg caagggtctg 4620

ggcagcgccg tcgtgctccc cggagtggag gcggccgagc gcgccggggt gcccgccttc 4680

ctggagacct ccgcgccccg caacctcccc ttctacgagc ggctcggctt caccgtcacc 4740

gccgacgtcg aggtgcccga aggaccgcgc acctggtgca tgacccgcaa gcccggtgcc 4800

tgaaatcaac ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt 4860

gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgg gttaactaaa 4920

cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa 4980

taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta 5040

tcatgtctgg aattgactca ataacttcgt ataatgtatg ctatacgaag ttatggatcc 5100

cgaagaatgc ggccacattc ttcgtcctgc taaagacttg ccttccggtg ccctctacat 5160

ctgatacagc aacccttccc tttttgcatt tgatgtcaaa agagtggaag aatgtgaaat 5220

tcatttgaga actctagtca tgatctctca ttagaatgat gccatcacag aaactctctt 5280

ttgacttcca tgcagaagac ttttctctat tttcctaata aacttgttca atatggaatc 5340

ataaacctgt ttctttctct cttttttttt ctctcatttt aaatgcatta tttatcattt 5400

ggggcttccc tgggtggatc agtggttaag aactcacctg ccaatacaga agacataggt 5460

tcaatccttg gatcaggaag atcccctgga gaaagaaatg gcaacccact tcagtattct 5520

tgcctgggaa atcccatgga cagaggagct tggtgggcta cagctcaaag aatcataaaa 5580

ggagtcagac acaacttagc aactaagcaa cacaaaacaa tgtgtctttt tggttttctc 5640

ttttttcctt ttttgaatta aagaaaataa ttttcttctt tagagaatag cttcttttag 5700

tatttctact ttaattgctc taccaatttt tgacttgtaa tataagaaag tagtggtctt 5760

aaagccctca gtgttctgct ctggtaaagc agtgatctgt ttttgctggt ccatcatgag 5820

gattaaaaaa attgatgttt gccaatgtag gtaaacattg cctgcatata gtgtgtattc 5880

caagcgaatt attccaaaat ctacatctat gtggagtcct ttagaaaata caatgctgat 5940

aaatagttat caaactctaa tttcagtttt aggtctattt aaacaaaaag tgtttcctat 6000

gcttgtccag cacaagaagt aaagaaattt taacctaccc tgccttcacc aaacttttaa 6060

atgccttgaa ctatagttgt gttttttttt taagtgacac cttttctaac atccactgtg 6120

tatttcagtt tacaaccatt taatagaatc tgatattctt actatctgac acatattaat 6180

taatatattt tatttatccc cttttgttac ccagagtttg cacacatttt gcattctgtt 6240

atttaatttt tttttttttt ttttttacct tctatgttca ggttcacatt ttcaggcagg 6300

aaatttagac attgaaaaat aaatcactgc agattttggt actccaagag taatattttt 6360

tagatataaa ttcatttctc ttagaattta atttaaaaaa tttaaattcc tcagttaagc 6420

atagaaagta atattacgag tacctaaaac tgtccaccta gattgatttg gcagttttta 6480

atattttgct agttttgttt cctctttctc tttcttcctc tatctctctc tttctctgtg 6540

tctctcttcc tacacacaca tacacacaca ttcacgtgct caagcaccca aacgcggccg 6600

ccatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 6660

cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 6720

attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 6780

tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 6840

ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 6900

gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 6960

ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 7020

cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 7080

ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 7140

accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 7200

catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 7260

gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 7320

tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 7380

agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 7440

actagaagaa cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 7500

gttggtagct cttgatccgg caaacaaacc accgctggta gcggtttttt tgtttgcaag 7560

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 7620

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 7680

aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 7740

tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 7800

atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 7860

cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 7920

gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 7980

gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 8040

tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 8100

tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 8160

tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 8220

aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 8280

atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 8340

tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 8400

catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 8460

aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 8520

tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 8580

gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 8640

tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 8700

tagaaaaata aacaaatagg ggttc 8725

<210> 2

<211> 28

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 2

ccatcgatct tagcagcagc agtagcag 28

<210> 3

<211> 32

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 3

ggggtaccat agtagtagcc aaagccagag cc 32

<210> 4

<211> 33

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 4

cgggatccac attcttcgtc ctgctaaaga ctt 33

<210> 5

<211> 36

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 5

ataagaatgc ggccgcgttt gggtgcttga gcacgt 36

<210> 6

<211> 29

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 6

gggtttcata tggcctcctc cgaggacgt 29

<210> 7

<211> 28

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 7

gctctagact acaggaacag gtggtggc 28

<210> 8

<211> 30

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 8

gaagatctat gaactttctg ctctcttggg 30

<210> 9

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 9

ggaattcccg cctcggcttg tcac 24

<210> 10

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 10

accgactggt gaatcctggt gtcc 24

<210> 11

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 11

aaacggacac caggattcac cagt 24

<210> 12

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 12

accgcattca gaactggtga atcc 24

<210> 13

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 13

aaacggattc accagttctg aatg 24

<210> 14

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 14

accgtatggg gttcattcag aac 23

<210> 15

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 15

aaacgttctg aatgaacccc ata 23

<210> 16

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 16

accgttgctg tatcagatgt aga 23

<210> 17

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 17

aaactctaca tctgatacag caa 23

<210> 18

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 18

accggttgct gtatcagatg tag 23

<210> 19

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 19

aaacctacat ctgatacagc aacc 24

<210> 20

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 20

accgcctgct aaagacttgc cttc 24

<210> 21

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 21

aaacgaaggc aagtctttag cagg 24

<210> 22

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 22

actactattg aggatgccac 20

<210> 23

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 23

gtcttctgca tggaagtcaa 20

<210> 24

<211> 22

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 24

cgtgatgggc tacggcttct ac 22

<210> 25

<211> 22

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 25

tcgtacttct cgatgcgggt gt 22

<210> 26

<211> 22

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 26

tatgcaaggg aactcagtat ga 22

<210> 27

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 27

taggtgccga agtggtagaa 20

<210> 28

<211> 18

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 28

cacgccatca acaacggc 18

<210> 29

<211> 21

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 29

ggttatgtgg ggagccatat c 21

<210> 30

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 30

acccgagaac aacctcaaca 20

<210> 31

<211> 47

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 31

gcatacatta tacgaagtta tgctagcgcg tggggatacc ccctaga 47

<210> 32

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 32

actggtgaat cctggtgtcc agg 23

<210> 33

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 33

cattcagaac tggtgaatcc tgg 23

<210> 34

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 34

gtatggggtt cattcagaac tgg 23

<210> 35

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 35

gttgctgtat cagatgtaga ggg 23

<210> 36

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 36

ggttgctgta tcagatgtag agg 23

<210> 37

<211> 23

<212> DNA

<213>sheep (Sheep)

<400> 37

cctgctaaag acttgccttc cgg 23

Claims

1. a kind of method using CRISPR/Cas9 system production VEGF164 transgenic cell line, which is characterized in that including with Lower step:

S2. the sgRNA for designing and synthesizing the CRISPR/Cas9 system cleavage site in the 3 ' areas UTR for KAP6.1, by synthesis SgRNA is cloned into pGL3-U6-sgRNA-PGK-puromycin and constitutes sgRNA transcription vector；

2. the method according to claim 1 using CRISPR/Cas9 system production VEGF164 transgenic cell line, It is characterized in that, homologous targeting vector PB-G-H-VEGF164-DsRed is constructed in step S1 specifically: in selection goat genome For 3 ' UTR region sequence of KAP6.1 gene as homology arm, left homology arm is the KAP6.1 gene C DS comprising removing terminator codon Left side sequence, right homology arm are the right flanks comprising 3 ' UTR of KAP6.1 gene, realize that foreign gene targeting is knocked in this 3 ' the area UTR of KAP6.1 gene and and KAP6.1 gene co-expressing；Using VEGF164 as foreign gene, select DsRed and The series connection of BGHpolyA terminator is used as exogenous gene expression box, using the EF1 GFP started and Puro as riddled basins, structure At homologous targeting vector be named as PB-G-H-VEGF164-DsRed.

3. the method according to claim 2 using CRISPR/Cas9 system production VEGF164 transgenic cell line, It is characterized in that, KAP6.1 homology arm PCR amplification primer is KAP-H1-Enzyme and KAP-H2-Enzyme, the KAP-H1- Enzyme includes KAP-H1-Enzyme-F and KAP-H1-Enzyme-R, and nucleotide sequence is respectively SEQ ID NO.2 and SEQ Shown in ID NO.3；The KAP-H2-Enzyme includes KAP-H2-Enzyme-F and KAP-H2-Enzyme-R, nucleotides sequence Column are respectively shown in SEQ ID NO.4 and SEQ ID NO.5.

4. the method according to claim 1 using CRISPR/Cas9 system production VEGF164 transgenic cell line, It is characterized in that, the DNA sequence dna of sgRNA sequence action site is as follows in step S2: shown in SEQ ID NO.32-37.

5. the method according to claim 1 using CRISPR/Cas9 system production VEGF164 transgenic cell line, It is characterized in that, for producing the building of the VEGF164 transgenic cell line of body-cell neucleus transplanting in step S3 specifically: will be homologous The mass mixings such as targeting vector, sgRNA transcription vector and Cas9 expression vector utilize3000 transfection suedes Caprine fetal fibroblast cell is to obtain after 1 μ g/mL puromycin and 26 road μ g/mL pest rhzomorphs are screened using concentration Positive VEGF164 transgenosis down producing goat fetal fibroblast is the VEGF164 transgenosis for being used to produce body-cell neucleus transplanting Cell line.

6. the VEGF164 transgenic cell line that method described in claim 1-5 any claim is prepared.

7. method described in claim 1-5 any claim is on the gene editing mountain of the production gene site-directed insertion of VEGF164 Application in sheep.

8. application according to claim 7, which is characterized in that will be for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 It is transfected jointly with Cas9 expression vector to cell, uses positive cell as donor cell after screening, it is raw by the method for nuclear transfer Produce the gene editing goat that the 3 ' areas UTR of KAP6.1 knock out.

9. application according to claim 7, which is characterized in that will be for the sgRNA transcription vector in the 3 ' areas UTR of KAP6.1 It is injected into fertilized eggs simultaneously after being transcribed in vitro with Cas9 expression vector, then by embryo transfer for producing targeting knockout The gene editing goat in the 3 ' areas UTR of KAP6.1.

10. application according to claim 7, which is characterized in that by sgRNA transcription vector, Cas9 expression vector with it is homologous Targeting vector is transfected to cell simultaneously, is used positive cell as donor cell after screening, is produced by the method for nuclear transfer The gene editing goat of the gene site-directed insertion of VEGF164.