CN106636200B - A kind of the RNA interference plasmid and its application method of ZNF667 albumen - Google Patents
A kind of the RNA interference plasmid and its application method of ZNF667 albumen Download PDFInfo
- Publication number
- CN106636200B CN106636200B CN201611114524.9A CN201611114524A CN106636200B CN 106636200 B CN106636200 B CN 106636200B CN 201611114524 A CN201611114524 A CN 201611114524A CN 106636200 B CN106636200 B CN 106636200B
- Authority
- CN
- China
- Prior art keywords
- znf667
- cell
- shrna
- plasmid
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of short hairpin RNA interference plasmid of ZNF667 albumen and its application methods.Short hairpin RNA (ZNF667-shRNA) interference plasmid of ZNF667 albumen is successfully constructed for the first time, is transfected into hepatoma H22 cells, and the cell strain of stable transfection ZNF667-shRNA plasmid is constructed.It was found that the proliferation of HepG2 cell, infiltration, invasion migration can be inhibited by cutting down the ZNF667 albumen in HepG2 cell.Tumor formation in nude mice confirms that the expression for cutting down ZNF667 in HepG2 cell can inhibit tumor formation from body level.Cut down the expression of the ZNF667 albumen in HepG2 cell, it may be possible to by promoting P53, inhibit Bcl-2 albumen to reach the grade malignancy for inhibiting HepG2 cell.The present invention will provide new thread and approach for the treatment of liver cancer, be of great significance.
Description
Technical field
The invention belongs to the technical fields of oncomolecularbiology, and in particular to the short hairpin RNA of ZNF667 albumen interferes
Plasmid and its application method.
Background technique
ZNF667 be found in myocardial ischemia in rats pre-adaptation a kind of expression up-regulation gene, by with gene pool
It compares and finds no corresponding sequence, it is a completely new gene, is named as ZNF667, Genbank accession number
For AY221750.By bioinformatic analysis, it is found that corresponding albumen is a kind of KRAB type zinc finger protein, contain 14
A zinc fingers, have the function of transcriptional control.
The ORF of ZNF667 is 1827bp, encodes 608 amino acid.At present such as ZNF667 correlation function result of study
Under: (1) ZNF667 be a kind of newfound KRAB type zinc finger protein, can inhibit the transcriptional activity of SRE and AP-1, has transcription suppression
Production is used；(2) ZNF667 is located in nucleus, is mainly expressed in heart and brain tissue, in liver, kidney, skeletal muscle, testis
Expression is taken second place, then less in other tissue expressions；(3) ZNF667 gene is in ischemic, anoxic, inflammation, oxidative stress condition following table
Up to increasing, there is typical stress reaction；(4) ZNF667 promotes cell to grow under stress situation；(5) ZNF667 has anti-
Cardiac muscle cell apoptosis effect, H2O2Handle H9C2Cardiac muscle cell can significantly inhibit the albumen such as Fas after transiently transfecting ZNF667
Expression, and this Anti-G value inhibits its expression related in conjunction with direct and Fas promoter；ZNF667 can inhibit TNF- ɑ
Caused Apoptosis, and this Anti-G value also inhibits its expression related in conjunction with direct and Bid promoter.(6)
ZNF667 can be by the expression of inhibition Bax and P53 after being overexpressed.Function assessment in relation to ZNF667 research shows that: brain star is thin
The content of the raising of born of the same parents' tumor Pathological degree, ZNF667mRNA and albumen is in rising trend, especially grade malignancy it is high III, IV
In grade cerebral astrocytoma, content is significantly raised.But expression of the ZNF667 in other cancers, with ZNF667 short hairpin RNA
Interference plasmid treats cancer, still without any research.
By the present invention in that transfecting HepG2 liver cancer cell lines with ZNF667 hair clip RNA interfering (shRNA) plasmid, establish
ZNF667 stablizes the liver cancer cell lines cut down, by the study found that HepG2-ZNF667-shRNA cell line expresses are cell increasing
It grows and slows down, cloning efficiency lowers, and infiltration declines with invasive ability.Tumor formation in nude mice confirms, inhibits in HepG2 cell
The expression of ZNF667 can inhibit the tumor formation of HepG2 cell from body level.The present invention is from cell function level and in body animal
Experimental level confirms the expression for cutting down the ZNF667 albumen in HepG2 liver cancer cells, can inhibit the pernicious of HepG2 cell
Degree, plays therapeutic effect.
Summary of the invention
The purpose of the present invention is the hair clip short hairpin RNA interference plasmids by constructing a kind of ZNF667 albumen, inquire into and cut down
Influence of the ZNF667 albumen to the biological characteristics of HepG2 cell, and then this plasmid is used to inhibit the treatment of liver cancer.
A kind of short hairpin RNA interference plasmid of ZNF667 albumen, can generate interference according to the sequence design of ZNF667
The DNA fragmentation of the siRNA of ZNF667 protein expression is inserted into built-up in short hairpin RNA interference carrier.
Above-mentioned plasmid is template and Vector promoter starting expression siRNA to sequence using the mRNA sequence of people ZNF667
Requirement, design synthesis can generate interference ZNF667 protein expression siRNA DNA fragmentation.
The target gene ZNF667 sequence of siRNA interference is as follows:
SiRNA-1:CGAATATCTCTCACACGACAT；
SiRNA-2:CGCCAATCATTTCTTATTGAA；
SiRNA-3:CAACCCTTATTCTGCATCTAA.
Preferably siRNA-2:CGCCAATCATTTCTTATTGAA
The original plasmid expression vector that above-mentioned plasmid is selected is preferably pRNAT-U6.1/Neo.
Restriction enzyme site when DNA fragmentation is inserted into carrier is BamH I and Hind III.
The DNA fragmentation of the siRNA of interference ZNF667 protein expression, specific sequence can be generated according to the sequence design of ZNF667
It arranges as follows:
ZNF667-shRNA-1a chain-ordering:
5’-GATCCCCGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCGT TTTTGGAT-
3’
ZNF667-shRNA-1b chain-ordering:
5’-AGCTATCCAAAAACGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAG ATATTCG GG-
3’
ZNF667-shRNA-2a chain-ordering:
5’-GATCCCCGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCG TTTTTGGAT-
3’
ZNF667-shRNA-2b chain-ordering:
5’-AGCTATCCAAAAAGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGAT TGGCG GG-
3’
ZNF667-shRNA-3a chain-ordering:
5’-GATCCCCAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTG TTTTTGGAT-
3’
ZNF667-shRNA-3b chain-ordering:
5’-AGCTATCCAAAAACAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAA GGGTTGGG-
3’。
Compare shRNA a chain-ordering:
5’-GATCCCTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAA TTTTTGGAT-3’
Compare shRNA b chain-ordering:
5’-AGCTATCCAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGA GAAGG-3’。
The sequence of three ZNF667 short hair clip interference plasmid carriers of building is shown in SEQ NO:17-19.It is preferred that seeing SEQ NO:
18。
The application method of the short hairpin RNA interference plasmid of the ZNF667 albumen is used to prepare the preparation for inhibiting liver cancer.
Interference sequence of the present invention by online bioinformatics software selection design ZNF667, the original interfered according to RNA
Then construct the short hairpin RNA interference plasmid of ZNF667.The building of plasmid and the short hair clip for screening the siRNA sequence containing ZNF667
RNA interference plasmid is indicated using ampicillin (ampicilin, Amp) resistant gene as screening.Using neomycin (G418)
The HEPG2 cell strain of screening technique building stable transfection ZNF667-shRNA and its blank control plasmid.Mtt assay detection transfection is dry
Plasmid ZNF667-shRNA is disturbed, blank control plasmid, the proliferation of three groups of HepG2 cell strains of blanc cell, Clone formation are transfected
The clonality of three groups of cell strains of experimental monitoring.Scratch test detects the transfer ability of three groups of cells, Transwell experiment
Detect its wetting capacity.Tumor formation in nude mice from body level examine three groups of cells grade malignancy, immune-blotting method target spot
The expression of molecule P53, Bcl-2.
The result is that the present invention successfully constructs ZNF667 hair clip interference plasmid (ZNF667-shRNA), and transfected
HepG2 cell establishes the cell strain for surely turning interference plasmid ZNF667-shRNA.MTT experiment statistics indicate that, transfection
The cell strain growth of ZNF667-shRNA significantly slows down compared with HepG2, HepG2-ZNF667E (transfection blank control plasmid) cell；
Cell clonality weakens compared with blank control HepG2 group and blank control plasmid group HepG2-ZNF667E group；Scratch experiment
Show: and HepG2 blanc cell, HepG2-ZNF667E (turning blank control plasmid cell strain NC group) are compared, and are transfected
The migration distance of the cell strain of ZNF667-shRNA was substantially reduced for 48 hours at 24 hours；Transwell Matrigel result table
Bright: the cell strain cell invasion ability for having transfected ZNF667-shRNA weakens compared with HepG2 group and HepG2-ZNF667E group.It is immune
Blot results are shown: having transfected the expression of the P53 in the cell of ZNF667-shRNA compared with HepG2, HepG2-ZNF667E group is thin
Born of the same parents' strain is significantly raised, and compared with HepG2, HepG2-ZNF667E cell strain is substantially reduced for the expression of Bcl-2.This is mentioned for the treatment of liver cancer
New approach and thinking are supplied.
Detailed description of the invention
Fig. 1 is ZNF667-shRNA-1a chain sequencing result；
Fig. 2 is ZNF667-shRNA-2a chain sequencing result；
Fig. 3 is ZNF667-shRNA-3a chain sequencing result；
Fig. 4 is HepG2 cell transfecting blank control plasmid (NC), ZNF667-shRNA1 (Sh1), ZNF667-shRNA 2
(Sh2), after ZNF667-shRNA3 (Sh3) plasmid and blanc cell protein expression test strip；
Fig. 5 is HepG2 cell transfecting blank control plasmid (NC), ZNF667-shRNA1 (Sh1), ZNF667-shRNA 2
(Sh2), after ZNF667-shRNA3 (Sh3) plasmid and blanc cell protein expression detection cut down efficiency；
* it is compared with blanc cell, & is compared with blank control plasmid group；
Fig. 6 is stable transfection ZNF667-shRNA, the HepG2 cell of NC (blank control plasmid) and Con (blanc cell)
Middle ZNF667 albumen carries out Western blot testing result；
Fig. 7 is stable transfection ZNF667-shRNA, the HepG2 cell of NC (blank control plasmid) and Con (blanc cell)
The statistical analysis of middle ZNF667 protein expression；
* it is compared with blanc cell, & is compared with blank control plasmid group；
Fig. 8 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
Growth curve chart；
* it is compared with Con (blanc cell), # is compared with NC (blank control plasmid) group；
Fig. 9 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
Cell clonal formation figure；
Figure 10 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
The statistical analysis of cell clone；
Figure 11 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
TransWell experimental result；
Figure 12 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
The results of statistical analysis of TransWell experiment；
* it is compared with Con (blanc cell), & is compared with NC (blank control plasmid) group；
Figure 13 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
Cell scratch experiment result；
Figure 14 be HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC) afterwards with Con (blanc cell)
Cell scratch experiment results of statistical analysis；
* it is compared with Con (blanc cell), # is compared with NC (blank control plasmid) group；
Figure 15 is that Western blot detects HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC)
Afterwards with P53 and Bcl2, ZNF667 protein expression in Con (blanc cell)；
Figure 16 is that Western blot detects HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC)
Afterwards with Bcl2 protein expression analysis result in Con (blanc cell)；
* it is compared with Con (blanc cell), # is compared with NC (blank control plasmid) group；
Figure 17 is that Western blot detects HepG2 cell transfecting ZNF667-shRNA plasmid, blank control plasmid (NC)
Afterwards with P53 protein expression analysis result in Con (blanc cell)；
* it is compared with Con (blanc cell), # is compared with NC (blank control plasmid) group；
Figure 18 is HepG2 cell transfecting ZNF667-shRNA plasmid, (blank is thin with HepG2 afterwards for blank control plasmid (NC)
Born of the same parents) three groups of cell nude mice tumor formation material object volume and growth curve charts；
Figure 19 is HepG2 cell transfecting ZNF667-shRNA plasmid, (blank is thin with HepG2 afterwards for blank control plasmid (NC)
Born of the same parents) three groups of cell nude mice tumor formation tumor volume and weight statistical analysis；
Figure 20 is HepG2 cell transfecting ZNF667-shRNA plasmid, (blank is thin with HepG2 afterwards for blank control plasmid (NC)
Born of the same parents) three groups of cell nude mice tumor formations, the content detection and statistical analysis of ZNF667 albumen in knurl.
Specific embodiment
It is intended to further illustrate the present invention below in conjunction with specific embodiment, is not intended to limit the present invention.
Material and method:
Material: HepG2 cell lines are purchased from Central South University's cellular elements center, and it is 1640+ that normal growth, which trains base,
10%FBS, cell are in spindle shape, adherent growth.
Plasmid expression vector pRNAT-U6.1/Neo, overall length 6380bp (see SEQ NO.21 in sequence table), it is glimmering comprising green
Photoprotein (Geenfluorescentprotein, GFP) knows label, ampicillin (ampicilin, Amp) resistance as inspection
Gene is screened as protokaryon to be indicated, shRNA segment is cloned into pRNAT-U6.1/Neo plasmid for screening to have succeeded, new mould
Plain (neomycin, be otherwise known as G418) resistant gene is screened as eukaryon to be indicated, for screening stable transfection ZNF667-
The cell of shRNA plasmid.Clone restriction enzyme site BamH I and Hind III.Guarantee the in the right direction of Insert Fragment, prevents carrier
Self connection.This carrier is purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd.
Method:
1.ZNF667 interferes the selection in site and the design of oligodeoxynucleotide
The mRNA complete sequence that people ZNF667 is searched in ncbi database is designed as template with reference to siRNA
Principle.Start requirement of the expression siRNA to sequence according to interference carrier pRNAT-U6.1/Neo promoter, using online
SiRNATatgetfinder software (http://genomics.jp/sidirect/) design synthesis 3 are directed to people ZNF667 sequence
The DNA fragmentation of the siRNA of column.The sequence that online input ZNF667mRNA1 sequence (NM_022103.3) analysis obtains, selects GC
Target-gene sequence of the content between 40%~55% as it is potential preferably, and in GenBank EST (EsT) data
It is retrieved in library with BLAsT, selected sequence and corresponding genome database is compared, excluded and other coded sequences are same
The sequence in source, to determine that it is specific sequence.
It, will be comprising interference target gene can be generated in order to improve the efficiency that sequence is correctly annealed as double chain DNA molecule
The DNA of the siRNA sequence of expression is designed as a chain and b chain oligonucleotide sequence according to following principle, adds in a chain and b chain-ordering
Enter intervening sequence CTCGAG, to avoid termination signal is formed, hairpin structure can be formed, the end 5' of a chain template is added to
3 ' ends of GATCCC, b chain template are added to GG, and the cohesive end formed after cutting with BamH I is complementary, and the end of a chain 3 ' is added to
The end 5' of TTTTTGGAT, b chain template is added to AGCTATCCAAAAA, mutual with the cohesive end that is formed after Hind III digestion
It mends.A chain and b chain for 3 siRNA of ZNF667 are synthesized by Shanghai Ji Kai gene Co., Ltd.Bob as ZNF667
The a chain and b chain for pressing from both sides the shRNA sequence (shRNA-NC) of the blank control plasmid of RNA interference plasmid are by the lucky triumphant chemical gene in Shanghai
Technology Co., Ltd.'s synthesis.
The synthesis of 2.ZNF667siRNA interference fragment
Eight Oligo segments of synthesis are first diluted to 100 μM, 5 μ L of each suction is matched two-by-two and is mixed in a pipe, mix postposition
95 DEG C, 5min in PCR instrument, it is stored at room temperature 20min, forms double-strand Oligo segment.Then again by double-strand Oligo DNA piece
Section is diluted to 10 μM, for being inserted into the carrier endonuclease bamhi of pRNAT-U6.1/Neo double digestion generation.
The interference plasmid sequence that table 1 constructs
The building of 3.shRNA carrier
PRNAT-U6.1/Neo carrier is digested using BamH I and Hind III, postdigestive product is set
It in 37 DEG C, 4h, is separated through 0.8% agarose gel electrophoresis, plastic recovery kit recovery purifying large fragment is spare.By Takara
Company's specification matches carrier with intron according to a certain percentage, and setting connection reaction, 16 DEG C of reactions are overnight.It will connection
Product is converted into the bacillus coli DH 5 alpha strain of competence, and ampicillin screening, picking positive colony shakes bacterium, small upgrading
Grain, 3 ZNF667shRNA eukaryotic vectors of building are respectively designated as ZNF667-shRNA1, ZNF667-shRNA2, ZNF667-
ShRNA3, it is not intended to compare shRNA eukaryotic vector by name NC.The carrier of building also need it is subsequent be sequenced, verified.
The identification of 4.shRNA carrier
Extract the sequencing of plasmid Hou Song Shanghai Sangon Biotech Company.
5. the identification of the reduction efficiency of interference plasmid
By 1 × 105A HepG2 cell inoculation turns after bed board 48 hours into the 6 orifice plates being coated with 0.1% gelatin
Dye.Cell transfecting is divided into 5 groups: blanc cell group, transfects three shRNA groups and blank control shRNA group, cell transfecting according to
The operation of LipofectaminTM2000 specification, all cells are placed on 37 DEG C, 5%CO2It is cultivated in constant incubator, 48
Total protein is collected after hour.The reduction of 3 hair clip short hairpin RNA interference plasmids is determined by the expression of detection ZNF667 albumen
Efficiency.Finally fixing No. 2 plasmid ZNF667-shRNA2 is best alternative plasmid.
6. the foundation of the HepG2 cell strain of stable transfection ZNF667-shRNA2 carrier
1. cell prepares culture HepG2 cell to 80~90% full bottles, cell is collected in digestion, with 1 × 105A/mL's is thin
Born of the same parents' density is inoculated with 26 porocyte culture plates, and every hole is inoculated with 2mL cell suspension, every plant of 1 hole of cell inoculation, 37 DEG C, 5%CO2Carefully
Start to transfect when expiring hole to cell 80% within the culture of born of the same parents' incubator 24 hours.
2. next day after plasmid transfection kind plate respectively takes 4 μ g plasmids (to number empty vectors for ZNF667-E, No. 2 above-mentioned matter
Grain number is ZNF667-AS2) it is diluted respectively with 0.25mL serum free medium, mix well 5min.Take 20 μ L (10 L × 2 μ)
Lipo2000 transfection reagent is diluted with 0.5mL (0.25mL × 2) serum free medium, mixes well 5min.6 orifice plates cell is abandoned
Complete medium is washed 2 times with serum free medium, while adding 0.5mL serum free medium.Two germplasm of 0.25mL is taken respectively
Grain suspension is added in 2 centrifuge tubes of transfection reagent, mixes.It is stored at room temperature 20min, and is added in six orifice plates in 30min.
3. cell screening HepG2 cell G418 prescreening: culture HepG2 cell to 80~90% full bottles, collect thin by digestion
Born of the same parents, with 1 × 104The cell density of a/ml is inoculated in 24 orifice plates, adjustment G418 concentration is 0,100,200,300,400,500,
600,700,800,900,1000g/ml is added in 24 holes, observes cell.600 μ g/mL finally are selected, are G418 screening concentration.
Steady strain screening: by the above-mentioned HepG2 cell marking for having transfected ZNF667-E, ZNF667-AS2 be HepG2- ZNF667-E,
HepG2-ZNF667-AS2.It after transfecting 48h, is added in the orifice plate of G418 to six of 600 μ g/mL, observes cell, change within every two days liquid, 7
HepG2 group cell is substantially dead after it, and adjustment G418 concentration is that 200 μ g/mL are to maintain concentration, continues to cultivate, amplifying cells: 10
HepG2 group complete cell death after its culture, other groups (have transfected the HepG2 cell of ZNF667-E and ZNF667-AS2
Group) G418 concentration is reduced to 200 μ g/mL, maintain the G418 concentration amplifying cells of 200 μ g/mL to full bottle.
7. ability of cell proliferation detects
1. mtt assay
Each group logarithmic phase HepG2 is collected respectively and stablizes strain cell, adjusts concentration of cell suspension；3 piece of 96 orifice plate is taken, every hole adds
Enter 100 μ L cell suspensions, bed board makes cell 2 × 10 to be measured3(edge hole is filled with sterile PBS to eliminate edge in the hole cell/
Effect), 5 multiple holes of every group of setting；5%CO2, 37 DEG C of incubator cultures, respectively at for 24 hours, one piece of 96 orifice plate of taking-up after 48h, 72h
Detection: 10 μ L MTT solution (5mg/ml, i.e. 0.5%MTT) solution are added in every hole when detection, and cell incubator continues to cultivate 4h,
Terminate culture；150ul dimethyl sulfoxide is added in every hole, sets low-speed oscillation 10min on shaking table, dissolves crystal sufficiently.Use enzyme
Mark instrument detects the light absorption value of each hole wavelength 490nm.
2. colony formation
The each group HepG2 cell (totally 3 groups) of logarithmic growth phase, is digested with pancreatin digestive juice and uses 1640 complete mediums
Single cell suspension is made, makes individual cells percentage 95% or more.Cell count, and with 1640 culture mediums containing 10%FBS
Cell concentration is adjusted to 1 × 104A/ml is spare；It is inoculated with 35mm Tissue Culture Dish, the hole 200cells/, every group of cell repeats kind 3
A hole, to ensure the reliability of experimental data.3ml complete medium is supplied, mixes well and is placed on 5%CO2, 37 DEG C of incubators
Culture.Often observation terminates culture when occurring macroscopic clone in culture dish.Fixed and dyeing: discarding supernatant liquid,
It is carefully embathed with PBS 2 times.Every hole adds the fixed cell 15min of 4% paraformaldehyde of 2mL.Fixer is removed, 1ml GIMSA is added to dye
Liquid dyes 20min, and flowing water slowly washes off excess stain liquid, is air-dried.It counts clone: plate being inverted and is superimposed one
Transparent film with grid with the naked eye directly counts clone's quantity.As a result it calculates and uses following formula: cloning efficiency=(gram
Grand number/inoculating cell number) × 100%.
8. infiltrating Function detection (Transwell Matrigel)
Respectively digestion collect each group HepG2 cell, with serum free medium be resuspended cell, adjustment cell density be 1 ×
106cells/ml.It sops up and sufficiently infiltrates the small indoor culture medium of invasion after substrate tunic；Add 500 μ L's to contain 10%FBS
Culture medium to lower room (invade small outdoor, 24 orifice bores in)；Add the cell suspension of the adjusted good cell density of 200 μ L to invasion
Small interior；37 DEG C, 5%CO2Cell incubator is incubated for for 24 hours；It is softly wiped with cotton swab to remove the small interior of invasion and not invade substrate
The cell and basal layer (ECMatrix gel) of tunic, careful operation in case pierce through bottom polycarbonate membrane；In 24 new holes
Add 500 μ L dyeing liquors in plate hole, invasion cell is immersed into dyeing 20min respectively；Invasion cell is submerged in the beaker for having water
Extra dyestuff is rinsed out several times, is then dried in air；The different visuals field are taken to take pictures acquisition at random by microscope；Then it uses
Dyestuff on 10% acetic acid film, 500 holes μ L/, then (150 hole μ L/) is gone in 96 orifice plates, it detects each under 570nm wavelength
Hole OD value.
9. transfer ability detects (scratch experiment)
Each group HepG2 cell is collected in digestion respectively, and group of cells is made into individual cells with the culture medium containing 10%FBS and is hanged
Liquid, with every hole 3 × 105A cell inoculation is to 6 orifice plates；It is paved with bottom hole to cell, with the vertical plate face scratch of the tip head of 20 μ L, is used
Serum free medium washs 2 times, and the cell split away off is washed away；With serum free medium culture cell, it is replaced with contains afterwards for 24 hours
3%FBS culture medium continues to cultivate；Using the scratch time as starting point, every shooting group of cells picture for 24 hours.
10. prepared by transplanted tumor in nude mice animal model
1. 9 nude mice random digits tables are divided into 3 groups: HepG2 cell, ZNF667-NC group, ZNF667-shRNA group；
2. will be abandoned in logarithmic growth phase cancer cell culture solution, washed cell 2 times with sterile neutrality PBS, with 0.25%
Trypsin digestion, under culture bottle elution, at single cell suspension, 1000 turns/min is centrifuged smin for piping and druming, collect cell,
With 0.9% physiological saline suspension cell, constant volume, and be 2 × 10 by the cell concentration that cell density is adjusted to injection6A cell/ml.
3. to the ultraviolet light irradiation of super-clean bench 30 minutes, 75% alcohol wipe table top；With 75% wipes of alcohol culture cage,
Other equal high pressure sterilization processing of apparatus.It is sterilized at nude inoculation before injecting cell suspension with 75% alcohol local skin
Skin, every nude inoculation 0.2ml cell suspension are inoculated in nude mice the nape of the neck or oxter skin with sterile disposable syringe respectively
Under.
4. the growing state of every 3 days close observation tumor formation situations and tumour after inoculation.It measures within every 5 days after the success of nude mice tumorigenesis
Gross tumor volume simultaneously records, and draws each group and plants tumor growth curve.Experiment on the 42nd terminates, and puts to death all nude mices, solution with de- cervical approach
Tumor tissues are taken out, tumour longest diameter and transverse diameter is measured, weighs tumor quality.Gross tumor volume is calculated separately with formula.
Calculation formula is as follows: gross tumor volume=tumour major diameter × tumour minor axis2×0.5。
As a result:
The identification of 1.ZNF667-shRNA plasmid
Positive bacterium colony is selected, plasmid is extracted, using T7 as sequencing primer, the logical survey of sequence is carried out to carrier construction, passes through sequencing
Peak figure carries out verification analysis, it was demonstrated that Insert Fragment is ZNF667shRNA DNA fragmentation, and without base mutation (Fig. 1-Fig. 3), explanation
The success of shRNA vector construction, meets desired design, can express siRNA, it is contemplated that can be disappeared to the expression of ZNF667 albumen
Subtract.
Inhibiting effect of the 2.ZNF667-shRNA to ZNF667 protein expression in HepG2 cell
HepG2 cell ZNF667 protein expression after Western blotting detection transfection sh short hairpin RNA interference plasmid
The variation of amount, as a result, it has been found that: in HepG2 cell, collect empty plasmid control group, ZNF667-con group (blanc cell group)
With ZNF667-shRNA 1 (transfection No. 1 plasmid), ZNF667-shRNA 2 (No. 2 plasmids of transfection), ZNF667-shRNA 3 (turn
Contaminate No. 3 plasmids) in total 5 groups of mark total protein of cell detected, ZNF667-shRNA1, ZNF667-shRNA as the result is shown
2, ZNF667-shRNA3 histone band of expression obviously weakens (figure than blanc cell group (Con) and empty plasmid (NC) group band
4), statistical analysis confirms that this three groups of plasmids all have significant difference (Fig. 5) in the interference effect of HepG2 cell,
The jamming effectiveness of ZNF667-shRNA2 be it is optimal, be confirmed as can be used for the interference plasmid of subsequent experiment.
3. the foundation and identification of the HepG2 cell strain of stable transfection ZNF667-shRNA2 plasmid and control plasmid
According to the method that aforementioned stable cell strain is established, the best G418 concentration of screening HepG2 stable cell strain is
600ug/ml, after obtaining stable cell strain, maintaining culture concentration is 200ug/ml.The stable cell strain finally established is named as
ZNF667-shRNA (HepG2 cell transfecting ZNF667-shRNA2 plasmid group), NC (blank control plasmid group).Collection transfects
ZNF667-shRNA, NC and blanc cell albumen carry out Western blot detection, film are scanned, image analysis is used
Software I PP6.0 carries out gray analysis (Fig. 6) to image.Results of statistical analysis shows (Fig. 7), ZNF667-shRNA2 plasmid
After stable be transferred in HepG2 cell, 90% protein expression can be cut down.ZNF667-shRNA is transfected, NC and blank are thin
The differential expression of ZNF667 has statistical significance in born of the same parents.
4.ZNF667-shRNA ability of cell proliferation weakens
Using based on 3- (4,5)-dimethylthiahiazo (- z-y1) -3,5-di-
Phenytetrazoliumromide's (chemical name: 3- (4,5- dimethylthiazole -2) -2,5- diphenyltetrazolium bromide bromide) is thin
Born of the same parents' counting reagent kit detects the proliferative capacity of three plants of cells.OD value, living cells line grain are measured at 490mM wavelength using microplate reader
Succinate dehydrogenase in body can make exogenous MTT be reduced to the bluish violet Jie Jing formazan of water-insoluble and be deposited in cell,
And dead cell is without this function.Its absorbance value is measured at 490nm wavelength with microplate reader, within the scope of certain cell number, MTT knot
The amount that crystalline substance is formed is directly proportional to cell number.To the proliferation of reacting cells indirectly.It is 0 hour, 24 hours, 48 hours small with 72
When 490mM wavelength at OD value be shown in Table 1, tracing analysis shows: after HepG2 cell transfecting blank control plasmid ZNF667-NC,
Stablize the growth of strain cell slightly to slow down compared with HepG2 cell；After HepG2 cell transfecting ZNF667-shRNA2 plasmid, cell strain is raw
Length significantly slows down (Fig. 8) compared with HepG2-NC and blanc cell, and difference has statistical significance.
1 HepG2 each group of table stablizes strain cell MTT different time point data
5. the HepG2 cell strain clonality for surely turning ZNF667-shRNA (No. 2 plasmids) reduces
Clone forming Test be measure ability of cell proliferation one of effective ways, cloning efficiency reflect cell colony according to
Rely two important characters of property and proliferative capacity.After HepG2 cell transfecting plasmid ZNF667-shRNA, ZNF667-shRNA group cell
Clonality weakens compared with HepG2 group, weakens (Fig. 9, table 2) compared with blank control plasmid group NC.The difference of Clone formation has
Statistical significance (Figure 10).
Table 2.HepG2 each group cloning efficiency data
6. the HepG2 cell strain infiltration for surely turning ZNF667-shRNA (No. 2 plasmids) is reduced with transfer ability
Whether HepG2 can be influenced using the expression change of scratch test and transwell invasion testing inspection ZNF667
The invasive ability of cell.Transwell invasion test experimental result using the OD value of acetic acid eluent 570nm in microplate reader come
The cell number across the cell Transwell is represented indirectly, the results showed that has transfected the cell strain invasive ability of ZNF667-shRNA
Decline, light absorption value has dropped 25% (Figure 11, table 3) when being embodied in 570nm wavelength.The results showed that ZNF667-
ShRNA group cell invasion ability weakens compared with HepG2 group, weakens compared with blank control plasmid group NC group, and difference is anticipated with statistics
Adopted (Figure 12).
3 HepG2 of table, tri- groups of cell Transwell Matrigel results
| Con | NC | ZNF667-shRNA | |
| OD | 1.233±0.026 | 1.228±0.028 | 0.814±0.029 |
Scratch experiment (Scratching test) is a kind of for detecting the experimental method of cell movement, and the experiment is available
In the invasion transfer ability of detection adherent growth tumour cell.After all three groups of cells are paved with bottom hole, 10ul rifle is used
The vertical plate face scratch of head, using the scratch time as starting point, every shooting group of cells picture and HepG2 cell for 24 hours, NC group surely turns
Cell strain is compared, and the migration distance of HepG2-ZNF667-shRNA cell strain was substantially reduced (table 4, figure for 48 hours at 24 hours
13), and difference has statistical significance (Figure 14).
4. HepG2 of table, tri- groups of cell scratch experiment migration distances (mm)
P53 in 7 tri- plants of HepG2 cells, the expression of Bcl-2 albumen
Cut down ZNF667 protein expression is that HepG2 cell how to be caused to grow to further inquire into, proliferation is infiltrated and invaded
The change of ability is attacked, Bcl2 has been selected, two albumen of P53 are that target molecule is detected, the results showed that and HepG2 cell
And NC cell strain is compared, two protein expressions of P53 and Bcl2 in HepG2-ZNF667-shRNA cell strain are substantially change.
The expression of Bcl2 albumen is substantially reduced, and the expression of p53 albumen is significantly raised (Figure 15), and Figure 16 and 17 is Bcl2 albumen and P53 egg
White expression analysis result；The result shows that the ZNF667 albumen in reduction tri- cell strains of HepG2 is particularly likely that and passes through reduction
Bcl2 increases the expression of p53 to reach the biological characteristics for changing HepG2 cell, to show to cut from cell in vitro level
Subtract its grade malignancy.
8. tumor formation in nude mice
By HepG2 cell and HepG2-NC cell strain, HepG2-ZNF667-shRNA cell strain carries out tumor formation in nude mice.
42nd day execution nude mice, the tumor formation volume and growth curve of mouse are shown in that Figure 18 tumor volume and weight statistical analysis are shown in figure
19, three groups of cell nude mice tumor formations, the content detection and results of statistical analysis of ZNF667 albumen are shown in Figure 20 in knurl.
SEQUENCE LISTING
<110>Xiangye No. 2 Hospital of Central South University
<120>the RNA interference plasmid and its application method of a kind of ZNF667 albumen
<130>nothing
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> siRNA-1
<400> 1
cgaatatctc tcacacgaca t 21
<210> 2
<211> 22
<212> DNA
<213> siRNA-2
<400> 2
cgccaatcat ttcttattga ac 22
<210> 3
<211> 21
<212> DNA
<213> siRNA-3
<400> 3
caacccttat tctgcatcta a 21
<210> 4
<211> 63
<212> DNA
<213>ZNF667-shRNA-1a chain-ordering
<400> 4
gatccccgaa tatctctcac acgacatctc gagatgtcgt gtgagagata ttcgtttttg 60
gat 63
<210> 5
<211> 63
<212> DNA
<213>ZNF667-shRNA-1b chain-ordering
<400> 5
agctatccaa aaacgaatat ctctcacacg acatctcgag atgtcgtgtg agagatattc 60
ggg 63
<210> 6
<211> 64
<212> DNA
<213>ZNF667-shRNA-2a chain-ordering
<400> 6
gatccccgcc aatcatttct tattgaactc gagttcaata agaaatgatt ggcgtttttg 60
gat 63
<210> 7
<211> 62
<212> DNA
<213>ZNF667-shRNA-2b chain-ordering
<400> 7
agctatccaa aaagccaatc atttcttatt gaactcgagt tcaataagaa atgattggcg 60
gg 62
<210> 8
<211> 63
<212> DNA
<213>ZNF667-shRNA -3a chain-ordering
<400> 8
gatccccaac ccttattctg catctaactc gagttagatg cagaataagg gttgtttttg 60
gat 63
<210> 9
<211> 63
<212> DNA
<213>ZNF667-shRNA -3b chain-ordering
<400> 9
agctatccaa aaacaaccct tattctgcat ctaactcgag ttagatgcag aataagggtt 60
ggg 63
<210> 10
<211> 59
<212> DNA
<213>shRNA a chain-ordering is compareed
<400> 10
gatcccttct ccgaacgtgt cacgtctcga gacgtgacac gttcggagaa tttttggat 59
<210> 11
<211> 59
<212> DNA
<213>shRNA b chain-ordering is compareed
<400> 11
agctatccaa aaattctccg aacgtgtcac gtctcgagac gtgacacgtt cggagaagg 59
<210> 12
<211> 6
<212> DNA
<213>intervening sequence is added in a chain and b chain-ordering
<400> 12
ctcgag 6
<210> 13
<211> 6
<212> DNA
<213>sequence of the end the 5' addition of a chain template
<400> 13
gatccc 6
<210> 14
<211> 2
<212> DNA
<213>sequence of the end the 3' addition of b chain template
<400> 14
gg 2
<210> 15
<211> 9
<212> DNA
<213>sequence of the end a chain 3' addition
<400> 15
tttttggat 9
<210> 16
<211> 13
<212> DNA
<213>sequence of the end the 5' addition of b chain template
<400> 16
agctatccaa aaa 13
<210> 17
<211> 938
<212> DNA
<213>plasmid shRNA1
<400> 17
tccggatctc ctaagggagg agagcatgaa ttctcgagcg gccgccccct tcaccgaggg 60
cctatttccc atgattcctt catatttgca tatacgatac aaggctgtta gagagataat 120
tggaattaat ttgactgtaa acacaaagat attagtacaa aatacgtgac gtagaaagta 180
ataatttctt gggtagtttg cagttttaaa attatgtttt aaaatggact atcatatgct 240
taccgtaact tgaaagtatt tcgatttctt ggctttatat atcttgtgga aaggacgaaa 300
caccggcgaa tatctctcac acgacatctc gagatgtcgt gtgagagata ttcgttttta 360
attctcgacc tcgagacaaa tgcagtattc atccacaagc ttaagtttaa accgctgatc 420
agcctcgact gtgccttcta aatagtaatc aattacgggg tcattagttc atagcccata 480
tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga 540
cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt 600
ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt 660
gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca 720
ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt 780
catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt 840
tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 900
ccaaaatcaa cgggactttc caaaatgtcg taacaact 938
<210> 18
<211> 1008
<212> DNA
<213>plasmid shRNA2
<400> 18
tttccctcac ttaaggggag gagaagcatg aattctcgag cggccgcccc cttcaccgag 60
ggcctatttc ccatgattcc ttcatatttg catatacgat acaaggctgt tagagagata 120
attggaatta atttgactgt aaacacaaag atattagtac aaaatacgtg acgtagaaag 180
taataatttc ttgggtagtt tgcagtttta aaattatgtt ttaaaatgga ctatcatatg 240
cttaccgtaa cttgaaagta tttcgatttc ttggctttat atatcttgtg gaaaggacga 300
aacaccggcg ccaatcattt cttattgaac tcgagttcaa taagaaatga ttggcgtttt 360
taattctcga cctcgagaca aatggcagta ttcatccaca agcttaagtt taaaccgctg 420
atcagcctcg actgtgcctt ctaaatagta atcaattacg gggtcattag ttcatagccc 480
atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 540
cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 600
tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 660
agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 720
gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 780
agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcatgggcg tggatagcgg 840
tttgactcac ggggatttcc aagtctccac cccattgacg tcaatggagt ttgttttggc 900
accaaatcac cggactttcc aaaatgtcgt acactccgcc ccattgacgc aaatgggcgg 960
tagccgtgta cggtgggagt tctatataag tccgagctgg ttagtgac 1008
<210> 19
<211> 1017
<212> DNA
<213>plasmid shRNA3
<400> 19
tcccgtcact aagggaggag agcatgaatt ctcgagcggc cgcccccttc accgagggcc 60
tatttcccat gattccttca tatttgcata tacgatacaa ggctgttaga gagataattg 120
gaattaattt gactgtaaac acaaagatat tagtacaaaa tacgtgacgt agaaagtaat 180
aatttcttgg gtagtttgca gttttaaaat tatgttttaa aatggactat catatgctta 240
ccgtaacttg aaagtatttc gatttcttgg ctttatatat cttgtggaaa ggacgaaaca 300
ccggcaaccc ttattctgca tctaactcga gttagatgca gaataagggt tgtttttaat 360
tctcgacctc gagacaaatg gcagtattca tccacaagct taagtttaaa ccgctgatca 420
gcctcgactg tgccttctaa atagtaatca attacggggt cattagttca tagcccatat 480
atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac 540
ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc 600
cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg 660
tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat 720
tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc 780
atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt 840
gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac 900
caaaatcaac gggactttcc aaaatgtcgt acaactccgc cccattgacg caatggggcg 960
gtaggcgggg tacggtggga ggtctaatat aaggcagaag ctggtttagt gaaccgt 1017
<210> 20
<211> 1010
<212> DNA
<213> con-shRNA
<400> 20
tacctcacta agggaggaga agcatgaatt ccccagtgga aagacgcgca ggcaaaacgc 60
accacgtgac ggagcgtgac cgcgcgccga gcgcgcgcca aggtcgggca ggaagagggc 120
ctatttccca tgattccttc atatttgcat atacgataca aggctgttag agagataatt 180
agaattaatt tgactgtaaa cacaaagata ttagtacaaa atacgtgacg tagaaagtaa 240
taatttcttg ggtagtttgc agttttaaaa ttatgtttta aaatggacta tcatatgctt 300
accgtaactt gaaagtattt cgatttcttg ggtttatata tcttgtggaa aggacgcggg 360
atcccttctc cgaacgtgtc acgtctcgag acgtgacacg ttcggagaat ttttggatag 420
cttaagttta aaccgctgat cagcctcgac tgtgccttct aaatagtaat caattacggg 480
gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 540
gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 600
agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 660
ccacttggca gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga 720
cggtaaatgg cccgcctggc attatgccca gtacatgacc ttatgggact ttcctacttg 780
gcagtacatc tacgtattag tcatcgctat taccatggtg atgcgggttt tggcagtaca 840
tcaatgggcg tggatagcgg tttgactcac ggggatttcc aagtctccac cccattgacg 900
tcaatgggag tttgttttgg caccaaaatc aacgggactt tccaaaatgt cgtacaactc 960
cgccccattg acgcaaatgg ggcggtaggc gtgtacggtg ggaggtctat 1010
<210> 21
<211> 6380
<212> DNA
<213>pRNAT-U6.1/neo carrier
<400> 21
aatggactat catatgctta ccgtaacttg aaagtatttc gatttcttgg gtttatatat 60
cttgtggaaa ggacgcggga tccgagctcg gtaccaagct taagtttaaa ccgctgatca 120
gcctcgactg tgccttctaa atagtaatca attacggggt cattagttca tagcccatat 180
atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac 240
ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc 300
cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg 360
tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat 420
tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc 480
atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt 540
gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac 600
caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac gcaaatgggc 660
ggtaggcgtg tacggtggga ggtctatata agcagagctg gtttagtgaa ccgtcagatc 720
cgctagcgct accggtcgcc accatggcca gcaagggcga ggagctgttc accggcgtgg 780
tgcccatcct ggtggagctg gacggcgatg tgaatggcca caagttcagc gtgagcggcg 840
agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca 900
agctgcctgt gccctggccc accctggtga ccaccctgag ctacggcgtg cagtgcttct 960
cacgctaccc cgatcacatg aagcagcacg acttcttcaa gagcgccatg cctgagggct 1020
acatccagga gcgcaccatc ttcttcgagg atgacggcaa ctacaagtcg cgcgccgagg 1080
tgaagttcga gggcgatacc ctggtgaatc gcatcgagct gaccggcacc gatttcaagg 1140
aggatggcaa catcctgggc aataagatgg agtacaacta caacgcccac aatgtgtaca 1200
tcatgaccga caaggccaag aatggcatca aggtgaactt caagatccgc cacaacatcg 1260
aggatggcag cgtgcagctg gccgaccact accagcagaa tacccccatc ggcgatggcc 1320
ctgtgctgct gcccgataac cactacctgt ccacccagag cgccctgtcc aaggacccca 1380
acgagaagcg cgatcacatg atcctgctgg agttcgtgac cgccgccggc atcacccacg 1440
gcatggacga gctgtacaag tgaggactag ataactgaac ttgtttattg cagcttataa 1500
tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 1560
ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctgtg ggaagacaat 1620
agcaggcatg ctggggatgc ggtgggctct atggcttctg aggcggaaag aaccagctgg 1680
ggctctaggg ggtatcccca cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg 1740
gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc 1800
ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc 1860
cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt 1920
gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag 1980
tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg 2040
gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag 2100
ctgatttaac aaaaatttaa cgcgaattaa ttctgtggaa tgtgtgtcag ttagggtgtg 2160
gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 2220
caaccaggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc 2280
tcaattagtc agcaaccata gtcccgcccc taactccgcc catcccgccc ctaactccgc 2340
ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 2400
aggccgcctc tgcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag 2460
gcttttgcaa aaagctcccg ggagcttgta tatccatttt cggatctgat caagagacag 2520
gatgaggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt 2580
gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg 2640
ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg 2700
gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg 2760
ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg 2820
gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca 2880
tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc 2940
accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc 3000
aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca 3060
aggcgcgcat gcccgacggc gaggatctcg tcgtgaccca tggcgatgcc tgcttgccga 3120
atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg 3180
cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg 3240
aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg 3300
ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga 3360
ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag 3420
gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct 3480
catgctggag ttcttcgccc accccaactt gtttattgca gcttataatg gttacaaata 3540
aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg 3600
tttgtccaaa ctcatcaatg tatcttatca tgtctgtata ccgtcgacct ctagctagag 3660
cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 3720
acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 3780
actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 3840
gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 3900
cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 3960
tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 4020
gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 4080
ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 4140
aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 4200
tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 4260
ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 4320
gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 4380
tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 4440
caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 4500
ctacggctac actagaagaa cagtatttgg tatctgcgct ctgctgaagc cagttacctt 4560
cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtttttt 4620
tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 4680
ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 4740
attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 4800
ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 4860
tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 4920
aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 4980
acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 5040
aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 5100
agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt 5160
ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg 5220
agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt 5280
tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc 5340
tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc 5400
attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa 5460
taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg 5520
aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc 5580
caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag 5640
gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt 5700
cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 5760
tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc 5820
acctgacgtc gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc 5880
tgctctgatg ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct 5940
gagtagtgcg cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg 6000
aagaatctgc ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg 6060
cgtttaatac gactcactat agggagagag agagaattac cctcactaaa gggaggagaa 6120
gcatgaattc cccagtggaa agacgcgcag gcaaaacgca ccacgtgacg gagcgtgacc 6180
gcgcgccgag cgcgcgccaa ggtcgggcag gaagagggcc tatttcccat gattccttca 6240
tatttgcata tacgatacaa ggctgttaga gagataatta gaattaattt gactgtaaac 6300
acaaagatat tagtacaaaa tacgtgacgt agaaagtaat aatttcttgg gtagtttgca 6360
gttttaaaat tatgttttaa 6380
Claims (7)
1. a kind of application method of the short hairpin RNA interference plasmid of ZNF667 albumen, which is characterized in that be used to prepare and inhibit liver
The preparation of cancer, the short hairpin RNA interference plasmid of the ZNF667 albumen be can be generated according to the sequence design of ZNF667 it is dry
The DNA fragmentation for disturbing the siRNA of ZNF667 protein expression is inserted into built-up in short hairpin RNA interference carrier.
2. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 1, which is characterized in that
Requirement using the mRNA sequence of people ZNF667 as template and Vector promoter starting expression siRNA to sequence, design
Synthesis can generate the DNA fragmentation of the siRNA of interference ZNF667 protein expression.
3. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 2, which is characterized in that
The target gene ZNF667 sequence of siRNA interference is as follows:
SiRNA-1:CGAATATCTCTCACACGACAT；
SiRNA-2:CGCCAATCATTTCTTATTGAA；
SiRNA-3:CAACCCTTATTCTGCATCTAA.
4. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 3, which is characterized in that
The target gene ZNF667 sequence of siRNA interference is siRNA-2:CGCCAATCATTTCTTATTGAA.
5. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 3, which is characterized in that
The original plasmid expression vector of selection is preferably pRNAT-U6.1/Neo.
6. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 5, which is characterized in that
Restriction enzyme site when DNA fragmentation is inserted into carrier isBAmH I andHind III。
7. the application method of the short hairpin RNA interference plasmid of ZNF667 albumen according to claim 6, which is characterized in that
The DNA fragmentation of the siRNA of interference ZNF667 protein expression can be generated according to the sequence design of ZNF667, particular sequence is as follows:
ZNF667-shRNA-1 a chain-ordering:
5’-
GATCCCCGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCGTTTTTGGAT -3’
ZNF667-shRNA-1 b chain-ordering:
5’-
AGCTATCCAAAAACGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCG GG -3’
ZNF667-shRNA-2 a chain-ordering:
5’-
GATCCCCGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCG TTTTTGGAT -3’
ZNF667-shRNA-2 b chain-ordering:
5’-
AGCTATCCAAAAAGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCG GG -3’
ZNF667-shRNA -3a chain-ordering:
5’-
GATCCCCAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTG TTTTTGGAT -3’
ZNF667-shRNA -3b chain-ordering:
5’-
AGCTATCCAAAAACAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTGGG-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611114524.9A CN106636200B (en) | 2016-12-07 | 2016-12-07 | A kind of the RNA interference plasmid and its application method of ZNF667 albumen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611114524.9A CN106636200B (en) | 2016-12-07 | 2016-12-07 | A kind of the RNA interference plasmid and its application method of ZNF667 albumen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636200A CN106636200A (en) | 2017-05-10 |
| CN106636200B true CN106636200B (en) | 2019-08-13 |
Family
ID=58820179
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611114524.9A Active CN106636200B (en) | 2016-12-07 | 2016-12-07 | A kind of the RNA interference plasmid and its application method of ZNF667 albumen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636200B (en) |
-
2016
- 2016-12-07 CN CN201611114524.9A patent/CN106636200B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Guiliang Wang等.Mipu1, a novel rat zinc-finger protein, inhibits transcriptional activities of AP-1 and SRE in mitogen -activated protein kinase signaling pathway.《Mol Cell Biochem》.2008,(第322期),第第93-102页，尤其是第95页左栏质粒构建. * |
| Mipu1, a novel rat zinc-finger protein, inhibits transcriptional activities of AP-1 and SRE in mitogen -activated protein kinase signaling pathway;Guiliang Wang等;《Mol Cell Biochem》;20081118(第322期);第95页左栏质粒构建 * |
| Mipu1在人脑星形细胞瘤中的表达及临床意义初步探讨;王智等;《中华神经外科疾病研究杂志》;20131231;第12卷(第1期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636200A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117577B (en) | Low-toxicity herpes simplex virus system and construction method and application thereof | |
| CN107119021A (en) | PD 1 knocks out the preparation of CD19CAR T cells | |
| CN114908087B (en) | Construction and application of long-circulating kidney-targeted extracellular vesicles | |
| AU757549B2 (en) | Inducible alphaviral gene expression system | |
| CN104593413A (en) | Method for synthesizing secreted human serum albumin employing bombyx mori posterior silk gland | |
| IL261740B2 (en) | Compositions and methods for treatment of type vii collagen deficiencies | |
| CN110628821B (en) | Cell model and preparation method and application thereof | |
| CN106636200B (en) | A kind of the RNA interference plasmid and its application method of ZNF667 albumen | |
| CN107384920B (en) | Base editing system based on streptococcus pyogenes and application of base editing system in gene editing | |
| US20040197855A1 (en) | Test system for determining gene toxicities | |
| WO1996009399A2 (en) | Chimeric adenovirus for gene delivery | |
| CN110218739B (en) | Reporter gene image probe for monitoring pre-mRNA splicing process and construction method thereof | |
| CN107384960A (en) | The binding molecule transgene carriers of IL 17 and its construction method and application are carried based on replication defective recombined adhenovirus | |
| CN114875098B (en) | Kit for carrying out seamless assembly on multiple DNA fragments and assembly vector and application method thereof | |
| CN115364096B (en) | Medicine for improving islet beta cell apoptosis in Wolfram syndrome | |
| KR102624832B1 (en) | Production of transgenic dogs overexpressing muscle-specific peroxisome proliferator-activated receptor delta (PPARδ). | |
| KR20130123244A (en) | The shrna downregulating hsp27 for treatment of tumor | |
| CN102649961B (en) | Aptamer sequence of hepatitis B virus (HBV) core antigen and application of nucleic aptamer sequence | |
| CN110055280A (en) | A kind of cell line and its construction method and application of stable expression mCherry-tau | |
| CN106591369A (en) | Method for targeted editing of buffalo 18S rDNA gene by virtue of adenovirus system | |
| KR20230070177A (en) | Method for culturing a cell expressing a protein | |
| KR20220031000A (en) | Method for preparing nucleic acid-encapsulated AAV hollow particles | |
| CN109679923A (en) | Utilize the method for CRISPR/Cas9 system production VEGF164 transgenic cell line | |
| KR20220044493A (en) | Compositions and Methods for the Treatment of San Philippine Disease and Other Disorders | |
| TW202237830A (en) | Virus-like particle with targeted peptide linked to surface thereof and use of the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |