CN109661474A - Unicellular transcript sequencing - Google Patents

Unicellular transcript sequencing Download PDF

Info

Publication number
CN109661474A
CN109661474A CN201780044623.0A CN201780044623A CN109661474A CN 109661474 A CN109661474 A CN 109661474A CN 201780044623 A CN201780044623 A CN 201780044623A CN 109661474 A CN109661474 A CN 109661474A
Authority
CN
China
Prior art keywords
primer
cell
rna
bar code
sequencing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201780044623.0A
Other languages
Chinese (zh)
Inventor
肯尼斯·J·里瓦克
理查德·A·费克特
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Standard Biotools Corp
Original Assignee
Fluidigm Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fluidigm Corp filed Critical Fluidigm Corp
Publication of CN109661474A publication Critical patent/CN109661474A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1065—Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

This document describes the methods for the DNA profiling for being used to prepare the unicellular transcript sequencing for the RNA from cell colony.Cell from group is assigned in individual reaction volume by this method needs, so that multiple individual reaction volumes respectively contain the cell individually separated, wherein cell has been handled with fixative before a distribution.Then make isolated cell permeabilization or broken, and cDNA is prepared by reverse transcription object, then expand.Additionally provide for from unicellular T cell receptor or immunoglobulin effectively generate the new chemical process (chemistry) of DNA profiling.

Description

Unicellular transcript sequencing
Cross reference to related applications
This application claims on July 14th, 2016 U.S. Provisional Patent Application submitted No. 62/362,425 and 2017 2 U.S. Provisional Patent Application the 62/463rd, 487 equity and priority that the moon is submitted on the 24th, for all purposes, the two Application is hereby incorporated by reference in its entirety by reference.
Statement about the invention right completed under the research and development that federal government subsidizes
It is not applicable.
Field
Subject matter disclosed herein relates generally to single celled analysis field.Particularly, this theme is related to slender for carrying out The method and composition of born of the same parents' transcript sequencing.
Background
MRNA from the single eukaryocyte ability being sequenced is provided about cell heterogeneity range and cell The new information of identity property.Micromanipulation, laser microprobe dating, fluorescence-activated cell sorting and in microfluid can for example be passed through It is separated in device unicellular.The method for preparing sequencing library from unicellular mRNA is developed.Two class main methods are Full transcript and end tag.In full transcript method, each library includes the segment obtained from the overall length of transcript；? In the labeling method of end, each library includes the segment from transcript only one end.Full transcript library provides more letters Breath, but end tags and provides advantage in workflow and quantitative aspect.The preparatory processing of sequencing data is generally similar to greatly It measures and is processed used in mRNA sequencing.
Determining the background for encoding the RNA sequence of the T cell receptor (TCR) or immunoglobulin that are generated by specific cells Under, the unicellular transcript of sequencing is particularly interesting.For example, each T lymphocyte expression combines the TCR of antigen.Antigen In conjunction be immune response cascade in critical event.Each TCR is the α-chain and beta chain by being encoded respectively by TRA and TRB gene The heterodimer of composition.The multiplicity of antigen recognizing is generated by body cell V (D) the J recombination occurred at TRA and TRB locus Property.Under unicellular resolution ratio, determine that the sequence of the appropriate part of TRA and TRB serves as the unique identifiers of T cell ancestors, because It may be from common T cell clone to express any two T cell of identical TCR α β couple.Because immunoglobulin gene with Tcr gene is similarly organized and recombinates also by body cell V (D) J to generate diversity, so the RNA sequence of immunoglobulin It can be equally used for the ancestors of identification B cell.
It summarizes
The multiple embodiments considered herein may include, but be not necessarily limited to one or more in following embodiments It is a:
A kind of embodiment 1: DNA profiling preparing the unicellular transcript sequencing for the RNA from cell colony Method, this method comprises: the cell from the group is assigned in individual reaction volume, so that multiple individual reactants Product respectively contain it is unicellular, wherein the cell has been handled with fixative before a distribution, wherein the fixative includes thin Born of the same parents' permeabilization fixative, the cell permeabilization fixative make it possible to than there is no effects higher when the cell permeabilization fixative Rate generates DNA profiling from from single celled transcript；Each cell in permeabilization or each individually reaction volume of destruction； From the RNA reverse transcription cDNA in each individual reaction volume；And cDNA is expanded to generate DNA profiling, wherein amplification incorporation promotees Into one or more of nucleotide sequences of the DNA sequencing of DNA profiling.
Embodiment 2: the method for embodiment 1, wherein the fixative stablizes nucleus and/or stablizes RNA.
Embodiment 3: the method for embodiment 1, wherein this method includes pre-processing cell with fixative.
Embodiment 4: the method for embodiment 1 or 3, wherein the fixative includes biomarker and histology anti-corrosion Agent (BHP).
Embodiment 5: the method for embodiment 1 or 3, wherein the fixative includes two thiobis (succinimidos Propionic ester) (DSP).
Embodiment 6: the method for any one of embodiment 1-5, wherein with one or more Chi Congdan of DNA profiling DNA profiling is recycled in only reaction volume.
Embodiment 7: the method for any one of embodiment 1-6, wherein the further DNA amplification template after recycling.
Embodiment 8: the method for any one of embodiment 1-7, wherein this method, which also comprises, is subjected to DNA profiling DNA sequencing.
Embodiment 9: the method for any one of embodiment 1-8, wherein this method includes preparing for the T from group The RNA of cell receptor or immunoglobulin unicellular transcript sequencing DNA profiling, in which: the cell include T cell or B cell；And DNA profiling is generated by the RNA of T cell receptor or immunoglobulin respectively.
Embodiment 10: the method for embodiment 9, wherein the cell is T cell.
Embodiment 11: the method for embodiment 9, wherein the cell is B cell.
Embodiment 12: the method for embodiment 10 or 11, wherein the cell is activation.
Embodiment 13: the method for any one of embodiment 1-9, wherein the individual reaction volume includes microfluid Individual capture site in device.
Embodiment 14: the method for embodiment 13, including reverse transcription reagents are provided to each capture site, wherein reversing Record reagent includes: the first reverse transcription (RT) primer, and the first reverse transcription (RT) primer has to encoding T cell receptor or is immunized The part of constant section (CS) specificity of the RNA of the first chain of globulin, the T cell receptor or immunoglobulin further include Two chains；Second reverse transcription (RT) primer, the second reverse transcription (RT) primer have respectively to encoding T cell receptor or immune ball The part of constant section (CS) specificity of the RNA of the second chain of albumen；Wherein the first and second RT primers respectively additionally comprise First nucleotide label, the first nucleotide label include the first primer binding site for the first DNA sequencing primer, the 5' of the one nucleotide label in CS specificity portion；With the first bar code primer, the first bar code primer is wrapped from 3' to 5' Include the part to the first primer binding site specificity, the first bar code nucleotide sequence and the first sequencing adapter.
Embodiment 15: the method for embodiment 14, wherein the first bar code primer additionally comprises to form stem-duplex Nucleotide sequence, thus the first bar code primer has hairpin structure during reverse transcription, and has linear structure during amplification Type.
Embodiment 16: the method for embodiment 15, wherein in permeabilization or destroying every in each individually reaction volume Before a cell, the first bar code primer is supplied to each capture site.
Embodiment 17: the method for embodiment 15 or 16, wherein the reverse transcription reagents additionally comprise the second bar code Primer, the second bar code primer include the second primer binding site specificity to the second DNA sequencing primer from 3' to 5' Part, the second bar code nucleotide sequence and second sequencing adapter.
Embodiment 18: the method for embodiment 17, wherein to each capture site provide the second bar code primer and Permeabilization or the one or more of reagents for destroying each cell in each individually reaction volume.
Embodiment 19: the method for embodiment 17 or 18, wherein the second bar code primer additionally comprises to form stem-double-strand The nucleotide sequence of body, thus the second bar code primer has line with hairpin structure during reverse transcription and during amplification Property configuration.
Embodiment 20: the method for any one of embodiment 15-19, including amplifing reagent is provided to each capture site, Wherein amplifing reagent is provided separately with reverse transcription reagents, and amplifing reagent includes: multiple first amplimers, and each first expands Increasing primer has to difference variable section (VS) specificity of the RNA of the first chain of encoding T cell receptor or immunoglobulin Part；Multiple second amplimers, each second amplimer have the second chain to encoding T cell receptor or immunoglobulin RNA difference can be changed section (VS) specificity part；Wherein the first and second amplimers respectively additionally comprise the second core Thuja acid label, the second nucleotide label include the second primer binding site, and the second nucleotide label is in VS specificity portion The 5' divided；Wherein the first and second amplimers respectively contain to form stem-duplex nucleotide sequence, and wherein the first He There is linear configuration during each comfortable amplification of second amplimer.
Embodiment 21: the method for any one of embodiment 1-20, wherein the amplification cDNA is to generate DNA profiling packet It including polymerase chain reaction (PCR), the polymerase chain reaction (PCR) includes multiple circulations of denaturation, annealing and extension, Middle PCR includes reducing reaction temperature to make reaction volume rehydration after two or more PCR cycles.
Embodiment 22: the method for embodiment 21, wherein each of first and second amplimers are in rehydration Period has hairpin structure, and has linear configuration during denaturation, annealing and extension.
Embodiment 23: the method for any one of embodiment 14-22, wherein the reverse transcription reagents additionally comprise third Reverse transcription (RT) primer, third reverse transcription (RT) primer have widow-dT sequence and include the first primer binding site Third nucleotide label, 5' of the third nucleotide label in widow's-dT sequence.
Embodiment 24: the method for embodiment 23, wherein the 3rd RT primer additionally comprises widow-dT sequence and the first primer Unique molecular identifier (UMI) between binding site.
Embodiment 25: the method for any one of embodiment 20-24, wherein amplifing reagent includes third amplimer, The third amplimer includes the part to specific target RNA-specific and the second nucleotide comprising the second primer binding site Label, the second nucleotide label is in the 5' of target specific moiety, and wherein third amplimer includes forming stem-duplex nucleosides Acid sequence, wherein third amplimer has linear configuration during amplification.
Embodiment 26: the method for embodiment 14, including amplifing reagent is provided to each capture site, wherein amplification examination Agent is provided separately with reverse transcription reagents, and amplifing reagent includes: multiple first amplimers, and each first amplimer has It can be changed the part of section (VS) specificity to the difference of the RNA of the first chain of encoding T cell receptor or immunoglobulin；Multiple Two amplimers, RNA of each second amplimer with the second chain respectively to encoding T cell receptor or immunoglobulin The part of variable section (VS) specificity of difference；Wherein the first and second amplimers respectively additionally comprise the second nucleosides acidity scale Label, the second nucleotide label includes the second primer binding site for the second DNA sequencing primer, the second nucleotide label In the 5' of VS specificity portion；With the second bar code primer, the second bar code primer from 3 ' to 5 ' includes to the second primer The part of binding site specificity, the second bar code nucleotide sequence and the second sequencing adapter.
Embodiment 27: the method for embodiment 26, wherein reverse transcription reagents additionally comprise third reverse transcription (RT) primer, Third reverse transcription (RT) primer has widow-dT sequence and the third nucleotide label comprising the first primer binding site, the 5' of the trinucleotide label in widow's-dT sequence.
Embodiment 28: the method for embodiment 27, wherein the 3rd RT primer additionally comprises widow-dT sequence and the first primer Unique molecular identifier (UMI) between binding site.
Embodiment 29: the method for any one of embodiment 26-28, wherein amplifing reagent includes third amplimer, The third amplimer includes the part to specific target RNA-specific and the second nucleotide including the second primer binding site Label, 5' of the second nucleotide label in target specific moiety.
Embodiment 30: the method for embodiment 29, wherein the target specific moiety of third amplimer include not with target The insert of RNA annealing, wherein insert flank is 5' anchor sequence and 3' bait sequences, is both annealed with target RNA.
Embodiment 31: the method for embodiment 14, wherein reverse transcription reagents additionally comprise 5' oligonucleotides, and the 5' is few Nucleotide from 5 ' to 3 ' includes the second primer binding site and widow's-riboG sequence.
Embodiment 32: the method for embodiment 31, wherein 5' oligonucleotides additionally comprise the second primer binding site and Unique molecular identifier (UMI) between widow's-riboG sequence.
Embodiment 33: the method for embodiment 32, including amplifing reagent is provided to each capture site, wherein amplification examination Agent is provided separately with reverse transcription reagents, and amplifing reagent includes the second bar code primer, and the second bar code primer is from 3 ' It include the part to the second primer binding site specificity, the second bar code nucleotide sequence and the second sequencing adapter to 5 '.
Embodiment 34: the method for any one of embodiment 14-33, wherein this method, which generates, is used for T cell receptor chain DNA profiling.
Embodiment 35: the method for any one of embodiment 14-33, wherein this method, which generates, is used for immunoglobulin chain DNA profiling.
Embodiment 36: the method for embodiment 13-26, wherein the microfluidic device is to include matrix type miniflow below Body device: with the capture site of R row and the C matrix arrangement arranged, wherein R and C is greater than 1 integer, and wherein by cell After being assigned to capture site, capture site can be fluidly isolated from one another；One group of R first input line, one group of R first Input line is configured to the capture site being delivered to the first reagent in particular row；One group of C second input line, one group of C A second input line is configured to the capture site being delivered to the second reagent in particular column, wherein the delivering and delivering first Reagent separates, wherein after the reaction, can recycling is anti-in the pond of the reaction product from each row or respectively arranged from microfluidic device Answer product.
Embodiment 37: the method for embodiment 36, in which: provide reverse transcription to each capture site by the first input line Reagent, and amplifing reagent is provided to by each capture site by the second input line；Alternatively, being caught by the second input line to each It obtains site and reverse transcription reagents is provided, and provide amplifing reagent to each capture site by the first input line.
Embodiment 38: the method for embodiment 37, in which: each bar code primer for being supplied to the first input line includes Bar code nucleotide sequence, the bar code nucleotide sequence are different from being supplied to other bar codes of every other first input line Bar code nucleotide sequence in primer；The each bar code primer for being supplied to the second input line includes bar code nucleotides sequence Column, the bar code nucleotide sequence are different from the bar code being supplied in other bar code primers of every other second input line Nucleotide sequence；And each DNA profiling generated at each capture site includes with flowering structure: 5'- (the second sequencing linking Son)-(the second bar code nucleotide sequence)-(the second primer binding site)-(VS)-(complementary determining region)-(CS)-(reverse mutual Mend the first primer binding site)-(the first bar code of reverse complemental nucleotide sequence)-(adapter is sequenced in reverse complemental first)- 3', wherein the first and second bar code nucleotide sequences are together, uniquely mark generates the capture site at DNA profiling.
Embodiment 39: the method for any one of embodiment 14-38, in which: the CS specificity portion of the first RT primer Including the insert not with the CS of encoding T cell receptor or the RNA of the first chain of immunoglobulin annealing；And/or the 2nd RT draw The CS specificity portion of object includes the not insertion with the CS of encoding T cell receptor or the RNA of the second chain of immunoglobulin annealing Object；Wherein the flank of insert is 5' anchor sequence and 3' bait sequences, is both annealed with CS.
Embodiment 40: the method for any one of embodiment 26-39, in which: the VS of multiple first amplimers is special Specific portions include the insert that do not anneal with the VS of encoding T cell receptor or the RNA of the first chain of immunoglobulin；And/or The VS specificity portion of multiple second amplimers includes the not RNA with encoding T cell receptor or the second chain of immunoglobulin VS annealing insert；Wherein the flank of insert is 5' anchor sequence and 3' bait sequences, is both annealed with VS.
Embodiment 41: the method for embodiment 40 is not annealed with the CS of RNA wherein the first and second RT primers do not include Insert.
Embodiment 42: the method for any one of embodiment 1-40, wherein this method includes that preparation is used for slender dysuria with lower abdominal colic Record the DNA profiling of object group sequencing.
Embodiment 43: the method for any one of embodiment 1-42, wherein this method includes preparation for more than one The DNA profiling of the unicellular transcript sequencing of particular target RNA.
Embodiment 44: the method for embodiment 43, wherein reverse transcription reagents additionally comprise third reverse transcription (RT) primer, Third reverse transcription (RT) primer has to the part of specific target RNA-specific and comprising for the first DNA sequencing primer The third nucleotide label of the first primer binding site, 5' of the third nucleotide label in target specific moiety.
Embodiment 45: the method for embodiment 44, wherein the target specific moiety of the 3rd RT primer include not with it is specific The insert of target RNA annealing, wherein insert flank is 5' anchor sequence and 3' bait sequences, is both annealed with target RNA.
Embodiment 46: the method for any one of embodiment 1-26 and 36-45, wherein in addition the reverse transcription reagents wrap Oligonucleotides containing 5', the 5' oligonucleotides from 5 ' to 3 ' include the second primer combination for the second DNA sequencing primer Site and widow's-riboG sequence.
Embodiment 47: the method for embodiment 46, wherein 5' oligonucleotides additionally comprise the second primer binding site and Unique molecular identifier (UMI) between widow's-riboG sequence.
Embodiment 48: the method for any one of embodiment 9-47, wherein this method include determine, T cell receptor or Immunoglobulin sequences are present in the cell with particular phenotype.
Embodiment 49: for generating the primer sets of DNA profiling from the RNA of encoding T cell receptor or immunoglobulin chain Close, primer combination includes: the first reverse transcription (RT) primer, the first reverse transcription (RT) primer have to coding T cell by The part of constant section (CS) specificity of the RNA of the first chain of body or immunoglobulin, the T cell receptor or immunoglobulin It further include the second chain；Second reverse transcription (RT) primer, the second reverse transcription (RT) primer have respectively to encoding T cell receptor Or the part of constant section (CS) specificity of the RNA of the second chain of immunoglobulin；Wherein the first and second RT primers are respectively The first nucleotide label is additionally comprised, the first nucleotide label includes the first primer knot for the first DNA sequencing primer Coincidence point, 5' of the first nucleotide label in CS specificity portion；With the first bar code primer, the first bar code primer is certainly 3 ' to 5 ' include the part to the first primer binding site specificity, the first bar code nucleotide sequence and the first sequencing linking Son；Multiple first amplimers, each first amplimer have to the first chain of encoding T cell receptor or immunoglobulin The difference of RNA can be changed the part of section (VS) specificity；Multiple second amplimers, it is right respectively that each second amplimer has The difference of the RNA of second chain of encoding T cell receptor or immunoglobulin can be changed the part of section (VS) specificity；Wherein first The second nucleotide label is respectively additionally comprised with the second amplimer, the second nucleotide label includes surveying for the 2nd DNA Second primer binding site of sequence primer, 5' of the second nucleotide label in VS specificity portion；With the second bar code primer, institute Stating the second bar code primer from 3 ' to 5 ' includes part to the second primer binding site specificity, the second bar code nucleotides sequence Column and the second sequencing adapter.
Embodiment 50: the primer combination of embodiment 49, wherein the first bar code primer includes forming stem-duplex Nucleotide sequence, thus the first bar code primer has hairpin structure when being used for reverse transcription, and when for having when expanding Linear configuration.
Embodiment 51: the primer combination of embodiment 49 or 50, wherein the second bar code primer includes forming stem-double-strand The nucleotide sequence of body, thus the second bar code primer has hairpin structure when being used for reverse transcription, and when for when expanding With linear configuration.
Embodiment 52: the primer combination of any one of embodiment 49-51, wherein the first and second amplimers are respectively Comprising forming stem-duplex nucleotide sequence, thus the first and second amplimers are linear for respectively having when expanding Configuration.
Embodiment 53: the primer combination of any one of embodiment 49-52 additionally comprises third reverse transcription (RT) and draws Object, third reverse transcription (RT) primer have widow-dT sequence and the third nucleotide label comprising the first primer binding site, 5' of the third nucleotide label in widow's-dT sequence.
Embodiment 54: the primer combination of embodiment 53, wherein the 3rd RT primer additionally comprises widow-dT sequence and first Unique molecular identifier (UMI) between binding site.
Embodiment 55: the primer combination of any one of embodiment 49-54 additionally comprises third amplimer, described Third amplimer includes the part to specific target RNA-specific and the second nucleosides acidity scale comprising the second primer binding site Label, the second nucleotide label is in the 5' of target specific moiety, and wherein third amplimer includes forming stem-duplex nucleotide Sequence, thus third amplimer has linear configuration during amplification.
Embodiment 56: embodiment 49 primer combination, in which: the CS specificity portion of the first RT primer include not with The insert of the CS annealing of the RNA of first chain of encoding T cell receptor or immunoglobulin；And/or the 2nd RT primer CS it is special Specific portions include the insert that do not anneal with the CS of encoding T cell receptor or the RNA of the second chain of immunoglobulin；Wherein insert The flank for entering object is 5' anchor sequence and 3' bait sequences, is both annealed with CS.
Embodiment 57: the primer combination of embodiment 49 or 56, in which: the VS specificity portion of multiple first amplimers Dividing includes the insert that do not anneal with the VS of encoding T cell receptor or the RNA of the first chain of immunoglobulin；And/or multiple The VS specificity portion of two amplimers includes that the VS not with encoding T cell receptor or the RNA of the second chain of immunoglobulin is moved back The insert of fire；Wherein the flank of insert is 5' anchor sequence and 3' bait sequences, is both annealed with VS.
Embodiment 58: embodiment 57 primer combination, wherein the first and second RT primers do not include not with the CS of RNA The insert of annealing.
Embodiment 59: the primer combination of any one of embodiment 56-58 additionally comprises third reverse transcription (RT) and draws Object, third reverse transcription (RT) primer have widow-dT sequence and the third nucleotide label comprising the first primer binding site, 5' of the third nucleotide label in widow's-dT sequence.
Embodiment 60: the primer combination of embodiment 59, wherein the 3rd RT primer additionally comprises widow-dT sequence and first Unique molecular identifier (UMI) between the binding site of DNA sequencing primer.
Embodiment 61: the primer combination of embodiment 59 or 60 additionally comprises third amplimer, the third amplification Primer includes the part to specific target RNA-specific, the second nucleotide label including the second primer binding site, the second nucleosides 5' of the acidity scale label in target specific moiety.
Embodiment 62: the primer combination of embodiment 61, wherein the target specific moiety of third amplimer includes not With the insert of target RNA annealing, wherein insert flank is 5' anchor sequence and 3' bait sequences, is both annealed with target RNA.
Embodiment 63: the primer combination of any one of embodiment 49-58, wherein it is inverse to additionally comprise third for primer combination (RT) primer is transcribed, third reverse transcription (RT) primer has the part to specific target RNA-specific and includes the first primer The third nucleotide label of binding site, 5' of the third nucleotide label in target specific moiety.
Embodiment 64: embodiment 63 primer combination, wherein the target specific moiety of the 3rd RT primer include not with The insert of particular target RNA annealing, wherein insert flank is 5' anchor sequence and 3' bait sequences, is both annealed with target RNA.
Embodiment 65: the primer combination of embodiment 63 or 64, wherein primer combination additionally comprise 5' oligonucleotides, institute Stating 5' oligonucleotides from 5 ' to 3 ' includes the second primer binding site and widow's-riboG sequence.
Embodiment 66: the primer combination of embodiment 65, wherein 5' oligonucleotides additionally comprises the second DNA sequencing primer Binding site and widow's-riboG sequence between unique molecular identifier (UMI).
Embodiment 67: for generating the primer sets of DNA profiling from the RNA of encoding T cell receptor or immunoglobulin chain Close, primer combination includes: the first reverse transcription (RT) primer, the first reverse transcription (RT) primer have to coding T cell by The part of constant section (CS) specificity of the RNA of the first chain of body or immunoglobulin, the T cell receptor or immunoglobulin It further include the second chain；Second reverse transcription (RT) primer, the second reverse transcription (RT) primer have respectively to encoding T cell receptor Or the part of constant section (CS) specificity of the RNA of the second chain of immunoglobulin；Wherein the first and second RT primers are respectively The first nucleotide label is additionally comprised, the first nucleotide label includes the first primer bound site for the first DNA sequencing primer Point, 5' of the first nucleotide label in CS specificity portion；With the first bar code primer, the first bar code primer from 3 ' extremely 5 ' include the part to the first primer binding site specificity, the first bar code nucleotide sequence and the first sequencing adapter；5' Oligonucleotides, from 5 ' to 3 ' include the second primer binding site, the unique molecular identifier for the second DNA sequencing primer (UMI) and widow's-riboG sequence；With the second bar code primer, the second bar code primer from 3 ' to 5 ' includes to the second primer The part of binding site specificity, the second bar code nucleotide sequence and the second sequencing adapter.
Embodiment 68: embodiment 67 primer combination, in which: the CS specificity portion of the first RT primer include not with The insert of the CS annealing of the RNA of first chain of encoding T cell receptor or immunoglobulin；And/or the 2nd RT primer CS it is special Specific portions include the insert that do not anneal with the CS of encoding T cell receptor or the RNA of the second chain of immunoglobulin；Wherein insert The flank for entering object is 5' anchor sequence and 3' bait sequences, is both annealed with CS.
Embodiment 69: the primer combination of embodiment 67 or 68, wherein the combination additionally comprises third reverse transcription (RT) primer, third reverse transcription (RT) primer have to the part of specific target RNA-specific and combine comprising the first primer The third nucleotide label in site, 5' of the third nucleotide label in target specific moiety.
Embodiment 70: embodiment 69 primer combination, wherein the target specific moiety of the 3rd RT primer include not with The insert of particular target RNA annealing, wherein insert flank is 5' anchor sequence and 3' bait sequences, is both annealed with target RNA.
Embodiment 71: the primer combination of any one of embodiment 49-70, wherein the primer sets are appropriate to generation use In the DNA profiling of T cell receptor chain.
Embodiment 72: the primer combination of any one of embodiment 49-70, wherein the primer sets are appropriate to generation use In the DNA profiling of immunoglobulin chain.
Embodiment 73: a kind of kit, the kit include any one of embodiment 49-72 primer combination and Matrix type microfluidic device, the matrix type microfluidic device include: the capture site of the matrix arrangement with R row and C column, wherein R and C is greater than 1 integer, and wherein cell is assigned to capture site after, capture site can by fluid each other every From；One group of R first input line, one group of R the first input lines are configured to deliver the first reagent catching into particular row Obtain site；One group of C second input line, one group of C the second input lines are configured to the second reagent being delivered to particular column In capture site, wherein it is described delivering with deliver the first reagent separate, wherein after the reaction, can exist from microfluidic device Reaction product is recycled in the pond of the reaction product from each row or respectively arranged.
Brief description
This patent or application documents include the figure of an at least width Rendering.This patent or patent Shen with color drawings The copy that please be announced will be provided according to after request and payment necessary expenses by supervisor office (Office).
Figure 1A-D: example matrix type microfluidic device is schematically shown in (1A).(1B) is shown by R The first different input lines delivers R different bar codes to capture site.(1C) is shown through C different input lines to catching It obtains site and delivers C different bar code.(1D) illustrates, after being reacted, can for example be applied by the fluid in collecting Reaction product is released from the outlet of an end of input line to C the second input lines, and the reaction product of each column is received Integrate a pond.
Fig. 2: the photo of the example matrix type microfluidic device schematically shown in Fig. 1.
Fig. 3 A-3D: the schematic diagram of gene (respectively TRA and TRB) structure of the α and β chain of encoding T cell receptor.(3A) Generate the body cell recombination of the gene of coding TCR α chain.(3B) generates the body cell recombination of the gene of coding TCR β chain.(3C) body The details of complementary determining region (CDR) after cell recombination in TCR α chain gene；N indicates the non-template nucleosides in insertion CDR3 Acid.The details of CDR after the recombination of (3D) body cell in TCR β chain gene.
Fig. 4 A-4B:(4A) in an embodiment of unicellular TCR transcript sequencing approach to be added to matrix type micro- The schematic diagram of primer in the column (or row) of fluid means.TRAC and TRBC sequence is complementary with the mRNA of TCR α and TCR β, and It is used as specific primer during reverse transcriptase reaction.In first bar code primer shown in Figure 4 A, Rd2 is Illumina 2 sequence of TruSeq Read, BC1-20 refers to 20 kinds of different bar codes, and P7 is one of Illumina sequencing adapter. P7.BC.Rd2 primer is not involved in RT reaction, but makes that bar code is added to amplification section during amplification step there The end.(4B) is added to matrix type microfluidic device in the embodiment of unicellular TCR transcript sequencing approach Row (or column) in primer schematic diagram.
The graphic representation of Fig. 5: Super Selective primer.Anchoring area section is with making primer stability in conjunction with template.Due to not Insert/ring region of pairing, bait section (usual 5-10 nucleotide) only shortly hybridize with template.
Fig. 6 A-6B: the schematic diagram of Super Selective primer is used in method shown in figure 4 above A-4B.(6A) is reversed Record.(6B) amplification.
Fig. 7: the schematic diagram of the DNA profiling (sequencing of targeting transcript) of specific coded sequence of target transcript is generated using template switch. In template switch oligonucleotide, Rd1 is 1 sequence of Illumina TruSeq Read, and UMI is unique molecular identifier, and GGG is widow's-riboG sequence.In RT primer, Rd2 is 2 sequence of Illumina TruSeq Read.It is discussed about Fig. 4 and 6 P7.BC.Rd2 primer can trigger the following amplification of the cDNA generated by template switch.
Fig. 8 A-B: coding constitutes the schematic diagram of the structure of the specific heavy chain of immunoglobulin and the gene of light chain.(8A) is produced The body cell recombination of the gene of raw coding μ or δ heavy chain.(8B) generates the body cell recombination of the gene of coding κ light chain.
Fig. 9: the gel of the result of display embodiment 1.Magnitude range from the expectation DNA fragmentation of TCR transcript is 250 to 350 nucleotide.The magnitude range of undesirable non-specificity segment is 100 to 220 nucleotide.It is anti-in swimming lane 1 The acyclic RT primer of product and acyclic V primer is answered to generate；Swimming lane 2, ring RT primer and acyclic V primer；Swimming lane 3, acyclic RT primer With ring V primer；Swimming lane 4, ring RT primer and ring V primer.For combination 3, desired segment and undesirable segment are observed most Good ratio, combination 3 are acyclic RT primer and ring V primer.
Figure 10: the gel of the result of display embodiment 2.Due to being added to P5, P7 and other sequences, transcribed from TCR The magnitude range of the expectation DNA fragmentation of object is 320 to 400 nucleotide.The result shows that fixed cell is generated than fresh cells Much better expectation segment yield.
Figure 11 A-11B: the schematic diagram for the illustrative method that the unicellular T cell receptor template designed for pipe generates, It is described in detail in embodiment 5.
Figure 12 A-12B: generating the schematic diagram of the method for unicellular T cell receptor template, and this method is similar to Figure 11 A-11B Shown in method, but be modified to the C with Fluidigm1 TMHigh-throughput IFC is used together and (is described in detail in embodiment 5).
Figure 13: the gel of the result of display embodiment 5.This method generates the overwhelming majority in expected 350-450bp size The library TCR in range.
Detailed description
This document describes the method for being used to prepare DNA profiling, the DNA profiling is used for the list of the RNA from cell colony The sequencing of cell transcription object.Cell from the group is assigned in individual reaction volume by this method needs, so that multiple lists Only reaction volume respectively contains the cell individually separated, and wherein cell has been handled with fixative before a distribution.Certain In embodiment, fixative can be cell permeabilization fixative.In certain embodiments, this method includes pre- with fixative The step of handling cell.This method is by the permeabilization in the individual reaction volume of each cell or destroys (for example, cracking) often A cell is simultaneously carried out from RNA reverse transcription cDNA in each individual reaction volume (that is, wherein from isolated cell Each reverse transcription of RNA is separately carried out with the reverse transcription of the RNA from other each cells separated).Then amplification cDNA with DNA is generated, which also carries out in individual reaction volume to generate DNA profiling from each isolated cell.Amplification incorporation Promote the one or more of nucleotide sequences of the DNA sequencing of DNA profiling.After amplification, DNA profiling can be recycled, such as with In further amplification and/or DNA sequencing.In some embodiments, with one or more ponds of DNA profiling from individually anti- Answer volume to recycle DNA profiling, optionally further merge with generate the single pond of DNA profiling for further expand and/ Or DNA sequencing.
Methods described herein makes it possible to generate DNA profiling from from single celled transcript, high-efficient In the efficiency (for example, without fixative) being previously possible.In certain embodiments, for T cell receptor or immunoglobulin Unicellular sequencing allows to produce using than any previously available simpler scheme this document describes specified chemical method Raw DNA profiling, especially when implementing on matrix type microfluidic device.
Definition
Unless otherwise indicated, claims and terminology used herein it is as follows list define.These Term defines for the sake of clarity, but is defined how will understand that these terms are consistent with those skilled in the art.
As used herein, term " microfluidic device " refers to any device including room and/or fluid channel, wherein at least One size is less than 1 millimeter.In certain embodiments, microfluidic device includes fluid flow passages (or line) and individually control Channel (or line), is used to control or regulate the stream by fluid channel.
Term nucleic acid includes any form of DNA or RNA, including for example, genomic DNA；Complementary DNA (cDNA) is The DNA of mRNA is indicated, is usually obtained by the reverse transcription of mRNA (mRNA) or by amplification；Synthesis is generated by amplification DNA molecular；And mRNA.
Term nucleic acid includes double-strand or three chain nucleic acid and single chain molecule.In double-strand or three chain nucleic acid, nucleic acid chains need not For (coextensive) (that is, double-strandednucleic acid need not be double-strand along the whole length of two chains) of coextensive.
Term nucleic acid further includes its any chemical modification, such as by methylating and/or by capped (capping).Core Acid modification may include the addition of chemical group, nucleic acid of the chemical group to individual nucleic acid base or as a whole Mix other charge, polarizability (polarizability), hydrogen bonding, electrostatic interaction and/or functionality.It is such to repair Decorations may include base modification, and such as 2 '-positions are sugar-modified, the position 5- pyrimidine is modified, the position 8- purine is modified, in cytimidine ring The modification of outer amine, the substitution of 5-bromouracil, backbone modification, abnormal bases combinations of pairs such as isobase (isobase), different born of the same parents Glycosides (isocytidine) and isoguanidine (isoguanidine) etc..
More specifically, in certain embodiments, nucleic acid may include polydeoxyribonucleotide (comprising 2- deoxidation-D- Ribose), polyribonucleotide (include D-ribose) and any other types of nuclear for purine or N- the or C- glucosides of pyrimidine bases Acid, and the other polymers comprising non-nucleotide skeleton, such as polyamide (for example, peptide nucleic acid (PNA)) and poly- morpholine (as Neugene is obtained commercially from Anti-Virals Inc., Corvallis, Oregon) polymer and other synthesis sequences Specific nucleic acid polymer, condition are that the polymer includes the nucleobase (nucleobases) for being in following configuration: being allowed such as The base pairing and base stacking found in DNA and RNA.Term nucleic acid further include in U.S. Patent No. 6,794,499,6, Chain nucleic acid (linked nucleic acids) described in No. 670,461, No. 6,262,490 and No. 6,770,748 (LNA), the United States Patent (USP) is hereby incorporated by reference in its entirety about the disclosure of its LNA by reference.
Nucleic acid can derive from biological source from completely chemical synthesis process, the chemical synthesis that such as solid phase mediates, Such as by any species separation from generation nucleic acid, or from the mistake involved through biology tool operation nucleic acid Journey, such as DNA replication dna, amplification (such as PCR amplification), reverse transcription, or the combination from these processes.
Term " template " is herein for referring to the template as polymerase to synthesize the nucleic acid molecules of complementary nucleic acid molecule.
For example, " DNA profiling " can be used for DNA sequencing, usually promote one or more of nucleotide of DNA sequencing in addition Sequence (for example, bar code, unique molecular identifier, the binding site for DNA sequencing primer and/or sequencing adapter, such as For example, can be used for bridge-type sequencing in fasciation at flow cell sequence) after.
As used herein, term " nucleotide bar code " and " bar code " refer to coding about in reverse transcription use bar shaped CDNA that code primer or when oligonucleotides generate or about in the amplification reaction using one or more of bar coded primers when The specific nucleotide sequence of the information of the amplicon of generation.
In some embodiments, the item of barcode encoding capture site information.For example, in matrix type microfluid The reaction carried out on device, bar code can encode the row or column in capture site.Two bar codes, a coding introduce bar code Row, another coding introduce the bar code column, can limit and reside in by the crosspoint of the row and column of bar code recognition Specific capture site.
As used herein, " UMI " is the acronym of " unique molecular identifier ", also referred to as " molecular marker symbol ".UMI It is one in a group identifier, each identifier can be separated with the identifier field of any other in group in a group identifier.It is real A kind of method of existing this " uniqueness " is using a string of nucleotide.For example, if the length of the character string is 10 bases, Have more than 1,000,000 unique sequences；If it is that 20 bases are long, will there is 1012A unique sequences.Referring to Hug and Schuler, “Measurement of the Number of Molecules of a Single mRNA Species in a Complex MRNA Preparation ", J.Theor.Biol. (2003) 221,615-624 and Hollas and Schuler, " A Stochastic Approach to Count RNA Molecules Using DNA Sequencing Methods " exists Algorithms in Bioinformatics (2003): Third International Workshop, WABI 2003, Budapest, Hungary, 2003 years Septembers 15-20 days, serial title: Lecture Notes in Computer Science Volume 2812, the 55-62 pages (editor Benson and Page), the description of UMI concept is incorporated herein by reference.
The term as used herein " target nucleic acid " or " target RNA " refer to the particular core to be detected in method described herein Acid.Correspondingly, for example, the amplification of specific RNA transcript is an example of target-specific amplification, and " full transcript group amplification " It is an example of the amplification that purpose is all transcripts present in the given cell of amplification.It is sequenced when to amplified production When, the sequencing of specific transcript is known as " target-specific " or " targeting " sequencing, and " sequencing of transcript group " is intended to deposit in cell All transcripts sequencing.
As used herein, term " target nucleotide sequences " refers to the molecule of the nucleotide sequence comprising target nucleic acid, such as, example The cDNA generated after the amplified production or reverse transcription RNA target nucleic acid that are such as obtained by amplification target nucleic acid.
As used herein, term " complementation " refers to the ability of perfect match between two nucleotide.That is, if nucleic acid gives Nucleotide on position can with the nucleotide hydrogen bonding of another nucleic acid, then the two nucleic acid be considered on the position that This is complementary.Complementarity between two single stranded nucleic acid molecules can be " part ", wherein only some nucleotide combine, or work as When there is total complementary (total complementarity) between single chain molecule, it be can be completely.Between nucleic acid chains Complementary degree, which has the efficiency of the intermolecular hybrid of nucleic acid chains and intensity, to be significantly affected.If the first nucleotide sequence and second Nucleotide sequence is complementary, then the first nucleotide sequence is referred to as " complementary series " of the second sequence.If the first nucleotide sequence Complementary with for the sequence of reversed (i.e. nucleotide sequence is reversed) of the second sequence, then the first nucleotide sequence is referred to as the second sequence " reverse complementary sequence " of column.
" specific hybrid " refers to the combination of nucleic acid and target nucleotide sequences under the stringent condition of definition, may be not present to miscellaneous The essence of other nucleotide sequences present in mixture is handed over to combine.Those skilled in the art recognize, loosen hybridization conditions Stringency allows to be resistant to sequence mismatch.
In specific embodiments, hybridization carries out under stringent hybridization conditions.Wording " stringent hybridization condition " is often referred to Definition ionic strength and pH be lower than particular sequence melting temperature (Tm) from about 5 DEG C to about 20 DEG C or in the range of 25 DEG C Temperature.As used herein, TmBecome temperature when half is dissociated into single-stranded for double-stranded nucleic acid molecule group.Calculate nucleic acid TmMethod be it is well known in the art (see, e.g., Berger and Kimmel (1987) METHODS IN ENZYMOLOGY, Volume 152: GUIDE TO MOLECULAR CLONING TECHNIQUES, San Diego:Academic Press, Inc. and Sambrook etc. (1989) MOLECULAR CLONING:A LABORATORY MANUAL, second edition, the 1-3 volumes, Cold Spring Harbor Laboratory), the two is both incorporated herein by reference).As shown in Standard reference works, when nucleic acid exists When in 1M NaCl aqueous solution, T can be calculated by following equationmThe simple method of estimation value of value: Tm=81.5+0.41 (%G+C) (ginseng See for example, Anderson and Young, Quantitative Filter Hybridization in NUCLEIC ACID HYBRIDIZATION(1985)).The melting temperature (and the condition for being accordingly used in stingent hybridization) of hybrid is by many factors shadow It rings, the length and property (DNA, RNA, base composition) of many factors such as primer or probe and the property of target nucleic acid The concentration of (DNA, RNA, base composition, exist in solution or be fixed) and salt and other components is (for example, formamide, sulphur The existence or non-existence of sour glucan, polyethylene glycol).The influence of these factors is well known in the art, and in this field It is discussed in Standard reference works.The exemplary stringent condition for being adapted for carrying out the specific hybrid of most Number Sequence is: temperature is extremely Lacking about 60 DEG C and salinity is about 0.2 mole, in pH 7.
Term " oligonucleotides " for refer to be it is relatively short, be usually shorter than 200 nucleotide, more particularly, shorter than 100 Nucleotide, even more particularly, shorter than 50 nucleotide, and most particularly, shorter than 40,30,20,15,10 or 5 nucleotide Nucleic acid.In general, oligonucleotides is single strand dna.
The nucleotide of one section of same type be referred to as example " widow-riboG " (guanine duplicate for one section) or " poly-A " (adenine duplicate for one section).
Term " primer " refers in buffer appropriate and in suitable temperature, under suitable condition (that is, four In the presence of the different ribonucleoside triphosphote of kind and the agent for polymerization, such as DNA or RNA polymerase or reverse transcriptase) and nucleic acid Hybridize (also known as " annealing ") and is used as the oligonucleotides of the initiation site for nucleotide (RNA or DNA) polymerization.Term " draws The target nucleic acid section that level point " or " primer binding site " guide object to be hybrid with it.
If the nucleotide sequence hybridization in primer or part of it and another nucleic acid, the primer are referred to as and the nucleic acid " annealing ".The narration that primer hybridizes with specific nucleotide sequence is not intended to imply primer and the nucleotide sequence fully or arranges He hybridizes on ground.For example, a part of of primer can anneal with specific nucleic acid, in this case, which is referred to as " special In " nucleic acid.
Primer can be with target nucleic acid sequence complete complementary, or can less complete complementary.In certain embodiments, draw The complementary series of object and target nucleic acid sequence is more typically in the range of 10-30 nucleotide in the sequence of at least seven nucleotide Sequence on, and usually in the sequence of at least 14-25 nucleotide at least 65% identity, and more generally have Have at least 75% identity, at least 85% identity, at least 90% identity or at least 95%, 96%, 97%, 98% or 99% identity.It will be understood that certain bases (for example, 3 ' bases of primer) can usually it is expected base corresponding to target nucleic acid sequence Complete complementary.Primer and probe is usually annealed with target sequence under stringent hybridization conditions.
Term " nucleotide label " is usually added to another nucleotide for referring to herein during reverse transcription or amplification The predetermined nucleotide sequence of sequence.Nucleotide is easily added using the primer with non-hybridization portion (i.e. " label ") Label.Nucleotide label may include such as the primer binding site of sequencing primer, bar code, UMI, sequencing adapter.
As used herein, term " bar code primer " refers to the primer comprising particular bar nucleotide sequence, this is specific The nucleotide sequence coded information about the amplicon generated when using bar code primer in the amplification reaction of bar code.
" connector (linker) " can with but need not be nucleic acid or including nucleic acid.Polynucleotide adapter can be added to be amplified Nucleotide sequence either end, to promote unbiased amplification using the primer special to polynucleotide adapter, polynucleotide adapter can With identical or different.
What the part of primer as mentioned above used, term " target-specific " nucleotide sequence refers in suitable annealing conditions The sequence that can be annealed with target nucleic acid or target nucleotide sequences specificity down.
As used herein, " anchor sequence ", which refers to, keeps oligonucleotides and complementary nucleotide sequence in oligonucleotides (such as primer) The sequence of column stable bond.
As used herein, " bait sequences ", which refer to, only instantaneously combines complementary nucleotide sequence in oligonucleotides (for example, primer) The sequence of column.When being used in combination with anchor sequence, bait sequences will form the heterozygote more more unstable than anchor sequence.
As being used in combination with anchor sequence and bait sequences, " insert " refers between anchor sequence and bait sequences Non- hybridization element, insert are usually nucleotide sequence, but not limited to this.
Term " flank is " has other nucleotide sequences in either side for describing central nucleotides sequence herein The case where.
As used herein, when two self-complementary regions of nucleic acid molecules (usually oligonucleotides) hybridize each other, shape At " stem-duplex ".
Two self-complementary regions of stem-duplex usually pass through nucleotide ring and connect, to be lower than stem-duplex Tm Temperature formed " hair clip " configuration.
" clamp primers " can cause nucleotide polymerization (such as amplification) and hairpin structure is presented in lower temperature Oligonucleotides.
If primer has the T higher than the temperature (such as 37-42 DEG C) for reverse transcriptionmStem-duplex, then claim its tool There is " hairpin structure during reverse transcription ".In this configuration, primer cannot play the role of causing nucleotide polymerization.It is practical On, primer is " closing ".
Primer, which is referred to as, has " linear configuration " during amplification, allows it with sequence anneals complementary enough and draws Send out nucleotide polymerization.In fact, primer is " unlatching ".When being expanded by polymerase chain reaction (PCR), primer exists Linear configuration is presented when denaturation, is kept in annealing (for example, at 50-65 DEG C) and during extending.
The amplification of introduction according to the present invention includes that at least part of at least one target nucleic acid uses duplication (usually with mould Plate dependence mode) any means, including but not limited to, for linear or exponential amplification nucleic acid sequence wide range of technologies. Exemplary instrumentation for carrying out amplification step includes ligase chain reaction (LCR), Ligase detection reaction (LDR), connection It is followed by Q- duplication enzymatic amplification, PCR, primer extend, strand displacement amplification (SDA), hyperbranched strand displacement amplification (hyperbranched strand displacement amplification), multiple displacement amplification (MDA) are based on nucleic acid The amplification (NASBA) of chain, the amplification of two step multi multiplexings, rolling circle amplification (RCA) etc., including its multiple version and combination, for example, But it is not limited to, OLA/PCR, PCR/OLA, LDR/PCR, PCR/PCR/LDR, PCR/LDR, LCR/PCR, PCR/LCR (also known as group Close chain reaction (combined chain reaction) -- CCR) etc..The description of such technology can be in addition to other sources Following source in find: Ausbel etc.；PCR Primer:A Laboratory Manual, Diffenbach are compiled, Cold Spring Harbor Press(1995)；The Electronic Protocol Book, Chang Bioscience (2002)；Msuih etc., J.Clin.Micro.34:501-07 (1996)；The Nucleic Acid Protocols Handbook, R.Rapley are compiled, Humana Press, Totowa, N.J. (2002)；Abramson etc., Curr Opin Biotechnol.1993Feb.；4 (1): 41-7, U.S. Patent No. 6,027,998；U.S. Patent No. 6,605,451, Barany etc., PCT Publication WO 97/31256；Wenz etc., PCT Publication WO 01/92579；Day etc., Genomics, 29 (1): 152-162 (1995), Ehrlich etc., Science 252:1643-50 (1991)；Innis etc., PCR Protocols:A Guide to Methods and Applications, Academic Press (1990)；Favis etc., Nature Biotechnology 18:561-64 (2000)；With Rabenau etc., Infection 28:97-102 (2000)； Belgrader, Barany and Lubin, Development of a Multiplex Ligation Detection Reaction DNA Typing Assay,Sixth International Symposium on Human Identification, nineteen ninety-five (can obtain: promega.com/geneticidproc/ussymp6proc/ on the world wide web (www blegrad.html-)；LCR kit service manual, catalog number (Cat.No.) 200520, Rev.#050002, Stratagene, 2002； Barany, Proc.Natl.Acad.Sci.USA 88:188-93 (1991)；Bi and Sambrook, Nucl.Acids Res.25: 2924-2951(1997)；Zirvi etc., Nucl.Acid Res.27:e40i-viii (1999)；Dean etc., Proc Natl Acad Sci USA 99:5261-66 (2002)；Barany and Gelfand, Gene 109:1-11 (1991)；Walker etc., Nucl.Acid Res.20:1691-96 (1992)；Polstra etc., BMC Inf.Dis.2:18- (2002)；Lage etc., Genome Res.2003Feb.；13 (2): 294-307 and Landegren etc., Science 241:1077-80 (1988), Demidov, V., Expert Rev Mol Diagn.2002Nov.；2 (6): 542-8., Cook etc., J Microbiol Methods.2003May；53 (2): 165-74, Schweitzer etc., Curr Opin Biotechnol.2001Feb.；12 (1): 21-7, U.S. Patent No. 5,830,711, U.S. Patent No. 6,027,889, U.S. Patent No. 5,686,243, PCT Publication WO0056927A3 and PCT Publication WO9803673A1.
In some embodiments, amplification include at least one circulation following sequential programme: make at least one primer with Complementation at least one target nucleic acid or the sequence anneals being substantially complementary；It is synthesized using polymerase with template dependent manner At least one nucleotide chain；And make the nucleic acid duplex newly formed denaturation to separate chain.Circulation can repeat or can also Not repeat.Amplification be may include thermal cycle or can be carried out with isothermal.
" full transcript group amplification " (" WTA ") refers to that purpose is to generate any amplification method of amplified production, the expansion Volume increase object, which represents, to prepare the RNA group of the cell of RNA since it.A kind of illustrative WTA method needs to generate at either end CDNA with connector, to promote unbiased amplification.In many embodiments, WTA is carried out to analyze courier (poly-A) RNA.
The term " substantially " used referred to herein as parameter is it is meant that the parameter is enough to provide useful result.Therefore, it answers " being substantially complementary " for nucleic acid sequence generally means that sufficiently complementation is in the context to work.In general, base Complementation means that sufficiently complementation to hybridize under the conditions employed in sheet.
" reagent " broadly refers to any examination used in reaction in addition to analyte (for example, analyzed nucleic acid) Agent.Illustrative reagent for nucleic acid amplification reaction includes but is not limited to, buffer, metal ion, polymerase, reverse transcriptase, Primer, nucleotide, oligonucleotides, marker, dyestuff, nuclease etc..Reagent for enzymatic reaction includes for example, substrate, auxiliary The factor, buffer, metal ion, inhibitor and activator.Term reagent further includes any group for influencing cell growth or behavior Point, such as buffer, culture medium or its component, agonist or antagonist etc..
Term " marker " as used herein, refer to can be used for providing it is detectable and/or can quantifiable signal any original Son or molecule.In particular, marker can directly or indirectly be attached to nucleic acid or albumen.It attaches to the suitable label of probe Object includes but is not limited to, radioactive isotope, fluorogen, chromophore, mass labels, electron dense granules, magnetic-particle, from Revolve marker, the chemiluminescent molecule of transmitting, electrochemically active molecules, enzyme, co-factor and zymolyte.
As used herein in regard to reaction, reaction mixture, reaction volume etc., term " individual " refers to wherein reaction and its He reacts reaction, reaction mixture, the reaction volume etc. that isolation carries out.The packets such as individual reaction, reaction mixture, reaction volume It includes those of progress in drop and (authorizes the entitled of Quake etc. see, e.g., on November 13rd, 2007 U.S. Patent No. 7,294,503 of " Microfabricated crossflow devices and methods ", pass through Reference is hereby incorporated by reference in its entirety and especially with regard to it to being used to form and the description of the device and method of analysis of the droplet；By It announces within Link etc. on 2 28th, 2010, the U.S. Patent Publication of entitled " Droplet libraries " the It No. 20100022414, is hereby incorporated by reference in its entirety by reference and especially with regard to it to being used to form and analysis of the droplet Device and method description；And entitled " the Manipulation of on January 6th, 2011 announced by Miller etc. The U.S. Patent Publication of Microfluidic Droplets " the 20110000560th is integrally incorporated this by reference with it Text and especially with regard to its to be used to form and the description of the device and method of analysis of the droplet), drop can with but need not be cream The form of liquid, and in those of wherein reaction, reaction mixture, reaction volume etc. are separated by mechanical barrier, such as singly Those of carried out in only individual hole of container, microtiter plate or the individual compartment of matrix type microfluidic device.
Term " fluid isolation " is herein for referring to that two or more elements of wherein microfluidic device do not flow each other The state of body connection.
Term " elastomer " has general sense used in the art.Thus, for example, Allcock etc. (Contemporary Polymer Chemistry, the second edition) by elastomer be described as usually in its glass transition temperature and Polymer existing for temperature between condensing temperature.Elastic material demonstrates flexibility characteristic, because polymer chain is subjected to turn round Transhipment is dynamic to allow skeleton that force-responsive is unfolded, and skeleton rebounds in the case where no power previous shape is presented.In general, Elastomer is deformed in applied force, but elastomer restores its original-shape when removal force.
As used herein, " fixative " be stablize for the cell of subsequent analysis, eucaryotic cell structure and/or macromolecular (such as RNA the mixture of compound or compound).
When mentioning T cell or B cell in use, term " activation " refers to the immune response in being exposed to stimulation cell The state of cell after antigen.
Use unicellular transcript sequencing-ordinary circumstance of fixed cell
Method described herein can be used for the DNA profiling from single fixed cell preparation for sequencing.Template can from appoint The RNA preparation of what type, for example, from Microrna to mRNA.Template can be by the specific RNA target or one kind in unicellular Prepared by the full complements of RNA, for example, all mRNAs in full transcript group sequencing.It is made although present disclosure concentrates on It is ready for use on the DNA profiling of determining RNA sequence, but those skilled in the art understand that can determine rna expression water in sequencing procedure It is flat, because expression is related to the quantity of sequencing read obtained.In addition, if those skilled in the art are from following discussion It will readily appreciate that, these are used to generate DNA profiling and can be with nucleic acid, protein or slender to the method for DNA profiling sequencing The otherwise other kinds of analysis of born of the same parents combines.Because being carried out in the independent reaction volume that can be used in these methods A plurality of types of analyses, it is possible to which the various features for identifying individual cells promote specific RNA sequence (optionally in specific water It is flat) it is associated with phenotype.In Darmanis S, Gallant CJ, Marinescu VD, Niklasson M, Segerman A, Flamourakis G, Fredriksson S, Assarsson E, Lundberg M, Nelander S etc.: Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells.Cell Rep 2016,14: An example of this type method is described in 380-389, is incorporated herein the description by quoting.
The cell of analysis
Method described herein can be used for analyzing the transcript from any type cell, such as any self-replacation, The biological entities or its any not replicated, film combination offspring that film combines.Not replicated offspring can be senile cell, terminal point Change cell, cytochimera, serum starved cells, infection cell, not replicated mutant, cytode, intact cell core and consolidates Fixed complete (death) cell etc..Cell used in method described herein can have any source, genetic background, health The features such as state, stationary state, film permeabilization, pretreatment and/or group's purity.Suitable cell can be eukaryocyte, original Nucleus, archeobacteria (archaeon) etc., and can come from animal, plant, fungi, protist, bacterium and/or similar Object.In illustrative embodiment, people's cell is analyzed.Cell can come from any stage of biological development, for example, in lactation In the case where zooblast (such as people's cell), embryo, fetus or adult cell can analyze.In certain embodiments, carefully Born of the same parents are stem cell.Cell can be wild type；Naturally, chemistry or virus mutant；It is engineered mutant (such as transgenosis)； And/or similar cell.In addition, other than other states, cell can be growth, static, aging, conversion and/or It immortalizes.In addition, cell can be monoculture, it is typically derived from gram of unicellular or closely similar a small group cell Grand group；It can be pre-selected by any suitable mechanism, such as affine combination, FACS, medicament selection etc.；And/or it can be with It is mixing or the heterogeneous population of different cell types.
In certain embodiments, cell is pre-selected T or B cell group.The two is (thin together with natural killer T Born of the same parents or NKT cell and monocyte) it is all peripheral blood mononuclear cells (PMBC), standard method separation can be used.It can also be with Use the desired group of standard method enrichment PMBC.For example, t helper cell can be enriched with by selection CD4+ cell (TH)；It can be with enrichment of cell cytotoxic T cell (T by selection CD8+ cellCCell or CTL)；Memory T cell can pass through selection CD45RO+ cell is enriched with；Etc..
One advantage of method described herein is that they can be used for analyzing the unicellular of substantially any quantity, such as in spy Determine in cell colony.In various embodiments, the single celled quantity analyzed may, for example, be at least appointing in following values One: 10,50,60,70,80,90,100,200,300,400,500,600,700,800,900,1000,2000,3000, 4000,5000,6000,7,000,8000,9,000 or 10,000.When cell poor to be analyzed, method described herein is mentioned The advantages of for being better than cell sorting, i.e. analysis, need less cell.In various embodiments, the single celled quantity of analysis It can be less than following any value: 10,000,9,000,8,000,7,000,6,000,5,000,4,000,3,000,2,000 or 1, 000.In specific embodiments, the cell quantity of analysis can fall in the range defined by any two value listed above It is interior, such as 300-1,300,400-1,200,500-1,100,600-1,000 or 700-900.Illustrative embodiment purport Analyzing 800 cells.
Fixed cell
With cell permeabilization fixative processing cell can expectability can interfere subsequent reactions, such as reverse transcription and/or amplification.It enables People surprisingly, is based on work as described herein, it has now been found that fixed cell can improve to by reverse transcription, then amplification The quality for the result observed after the DNA profiling sequencing of generation.
Therefore, method described herein makes it possible to generate DNA profiling from from single celled transcript, high-efficient In the efficiency (for example, without fixative) being previously possible.In various embodiments, these methods make it possible to from independent Reaction volume in separated be greater than: 50%, any sense of 60%, 70%, 80%, 85%, 90%, 95% cell is emerging The transcript sequencing of interest and/or it is quantitative it is horizontal, wherein the quantitative range of isolated cell is such as 90-10,000,100-5, 000,200-1,500,300-1,300,400-1,200,500-1,100,600-1,000 or 700-900.For example, using herein The method of description, more any simpler scheme of available solutions than in the past can be used in people, and, in 200-1,500 points cellifugal More than 85%, more than 90% or more than 95% in obtain the sequence (and optionally expression) of TCR or Ig chain, and optionally One or more of phenotypic markers.In certain embodiments, suitable fixative splits cell by stablizing nucleus Solution is less likely to destroy nucleus (percentage of RNA in its nucleic acid for increasing release) and/or be provided in this way by stablizing RNA Result.
In illustrative embodiment, fixative is biomarker and histology preservative (BHP) and/or two thiobis (succinyl phosphorons amino propyl acid ester) (DSP).BHP is described in Mueller etc., " One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens (in August, 2011) PLos ONE, 6 (8) e23780, and in Espina etc., US 2013/ On May 30th, 0137094,2013 announces, and is both incorporated by reference into this description.The table 1 of Mueller etc. is about BHP group At offer the following contents:
The generation of illustrative BHP described below of US 2013/0137094:
1. the scheme of haemocyte fixative of the preparation without lactic acid:
10% polyethylene glycol (MW 8000) (Fisher), 100mM sodium orthovanadate (Sigma) are prepared in 1 type SILVER REAGENT water With the stock solution of 1.0M β glycerophosphate (Calbiochem).200mM genistein is prepared in DMSO (Genistein) stock solution of (Alexis Biochemicals).
0.05mg DSP (Pierce) is dissolved in 500 μ L DMSO.0.05mg DTBP is dissolved in 500 μ L, 1 type SILVER REAGENT In water.
38mL hanks' balanced salt solution (Hyclone, Fisher) is added in the 200proof ethyl alcohol (Sigma) of 6.0mL In.
To alcohol/hanks' balanced salt solution be added 250 μ L, 10% polyethylene glycol, 1000 μ L sodium orthovanadates (Sigma), Instant 1.0mM staurosporin in 3.75mL β acetin (Calbiochem), 50.0 μ L DMSO (Staurosporine) (Sigma cat#S6942) and 2.5 μ L genisteins (Alexis Biochemicals), 500 μ L DSP solution and 500 μ L DTBP solution.It is gently mixed.
By the way that BHP is added in cell in room temperature, cell can be fixed with BHP.
Fixative DSP is described in " Using DSP, a reversible cross-linker, the to fix of Xiang etc. tissue sections for immunostaining,microdissection and expression profiling” In (on December 16th, 2004) Nucleic Acids Res., 32 (22) e185.DSP, also referred to as Lomant reagent are a kind of thin The mercaptan cleavable molecule of born of the same parents' permeabilization, homotype difunctional (homobifunctional), it is believed that it is in pH between 6.5-8.5 Aqueous buffer solution in primary amino group is connected to each other.Cell can be fixed, for example, as described in Xiang etc..In brief, make Fibroblastic growth converges to about 85%, washed once with 1X PBS buffer solution, then the DSP to the final concentration of 1mg/ml (Pierce, Rockford, IL) fixes 5 minutes.Prepare DSP 100% anhydrous DMSO (Sigma-Aldrich, St Louis, MO stock solution in) is simultaneously stored in -80 DEG C.Stock solution is being diluted to working concentration with 1X PBS immediately using preceding.When When DMSO stock solution is added in PBS, DSP is precipitated in order to prevent, and PBS is gently vortexed and stock solution is added dropwise.
Cell is assigned in individual reaction volume
Individual reaction volume can be created and safeguarded by any available mode.For example, individually reaction volume can By individual fluid section in the separate hole in plate, the individual drops in lotion, channel or individual in microfluidic device Reaction site (such as room) composition.
At least there are four types of standard method/systems can be used for separating cell for unicellular sequencing: micromanipulation, laser capture Micro-dissections (LCM), fluorescence-activated cell sorting (FACS) and microfluidic system.Last two methods can provide reliably anti- High throughput needed for reflecting the heterogeneous required large sample number of cell colony.Referring to Livak, " Eukaryotic Single- Cell mRNA Sequencing,”Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing, Springer, ISBN 978-3-319-31348-1 (2016), for unicellular The description of mRNA sequencing is incorporated herein by reference.
In some embodiments, step is allocated to increase the number of the independent reaction volume only containing a cell Amount.The method for realizing this purpose is well known, and including such as limiting dilution.In certain embodiments, this method needs Determine which reaction volume contains the cell individually separated.
Easily, microfluidic device progress can be used in this method, which facilitates in multiple capture sites Capture individual cells.In some embodiments, capture site can be fluidly isolated from one another, for example, the cell in whole device After distribution.In certain embodiments, capture site respectively has capture feature, which protects cell or cell group It stays in the position.In some embodiments, capture feature is located at interior, which can be with other room fluids in capture site Isolation.The device can be configured so that can provide one or more of first reagents to each capture site, and can be with One or more of second reagents are provided to each capture site, wherein the second reagent is different from the first reagent, and with first Reagent is provided separately.For example, each pair of reagent can be supplied to a pair of of fluid in capture site can isolation ward, the room is each other not Together, and optionally, different from the room for cell capture.
In some embodiments, at least one surface of microfluidic device is transparent, to allow cell and/or come from The visualization of the signal of label.In such embodiment, this method occupies cell before can be optionally included in reverse transcription Capture site imaging.
Matrix type microfluidic device
In some embodiments, method described herein can carry out on matrix type microfluidic device, facilitate It is introduced into the bar code of the particular row in identification device and the bar code of identification particular column, thus the combination uniquely identifies specifically Site is captured, and therefore identifies the specific cells or cell colony of derivatization reaction product.This method is on such device It is tested and is proved to be feasible (referring to embodiment 3).
In certain embodiments, useful matrix type microfluidic device includes the square arranged with R row and C in the above-mentioned methods The capture site of battle array arrangement, wherein R and C is greater than 1 integer.Each capture site may include capture feature, and the capture is special Sign can only capture a cell, alternatively, the capture feature can only capture thin no more than every group when by grouped analysis cell Cell quantity needed for born of the same parents.After cell to be assigned to capture site, capture site can be fluidly isolated from one another.The device also wraps One group of R the first input lines are included, the capture site being delivered to the first reagent in particular row and one group C are configured as Second input line is configured as capture site of the second reagent of delivering into particular column, wherein the first examination of the delivering and delivering Agent separates.Such exemplary means are schematically shown in figure 1A.Figure 1B is shown by R different first Input line delivers R different bar codes to capture site.Fig. 1 C, which is shown, to be delivered by C different input lines to capture site C different bar codes.In specific embodiments, all bar codes will be unique, that is, be supplied to each of device its His bar code is different.Fig. 1 D explanation, after being reacted, can from each column collecting reaction product as pond, for example, pass through by It collects fluid and is applied to C the second input lines to release reaction product from the outlet of input line one end.(those skilled in the art It being readily appreciated that, " row " and the specified of " column " are arbitrary, because if device is rotated by 90 °, then row becomes column, and vice versa, In this case, reaction product will be collected as pond from every row.) Fig. 2 shows the photographs of the device schematically shown in Fig. 1 Piece.
In certain embodiments, matrix type microfluidic device allows to analyze individual cells or is for example up to (and including) 1000 cell group.After one or more cells are captured or separate in each capture site, cell be can be completely Or partially or completely destroy (for example, permeabilization or cracking).In the latter case, which is configured to supply the function.? In some embodiments, described device be at least one surface it is transparent, with allow be imaged make cell number or phenotype can Depending on changing (for example, when cell or its content are reacted with optics detectable marker).In some embodiments, described Device be configured to execute " X-Y " combination it is bar coded, it is possible thereby to which reaction product is output to one or more pond (itself Can merge) in and further multiple analysis (for example, passing through amplification), then " remove multiplex (de-multiplexing) " (" demux ") is to distribute to specific capture site for specific reaction product.It is such bar coded as shown in Figure 1, it is aobvious Show that same group of 3' bar code (" 3'BC " in Figure 1B) is delivered to each column and same group of 5' the bar code (" 5' in Fig. 1 C BC ") it is delivered to every a line.
In various embodiments, next from about 90 to about 10,000 independent microfluidic devices for capturing sites using having Implement one or more of methods as described herein, especially from about 90 to about 5,000 capture sites, more particularly from about 90 To about 2,500 capture sites, or even more particularly from about 90 to about 1,000 capture sites.In some embodiments In, microfluidic device can have greater than 100, be greater than 200, be greater than 300, be greater than 400, be greater than 500, be greater than 600, be greater than 700, be big In 800, greater than 900 or greater than 1000 capture sites.In illustrative embodiment, microfluidic device has in 300- 1300, several capture sites in 400-1200,500-1100,600-1000,700-900 or 800 ranges.
In some embodiments, capture site has one or more reaction chambers, and range is from about 0.2nL to about 500nL.Chamber volume is lower, and the effective concentration of any target nucleic acid is higher.In certain embodiments, reaction chamber is from about 0.2nL to about 50nL, preferably 0.5nL to about 5nL, more preferably from about 1nL to about 4nL.In some embodiments, chamber body is reacted Product is 1.5nL, 2.0nL, 2.5nL, 3.0nL or 3.5nL, or is fallen into any range defined by any value in these values.
The system for meeting the microfluidic device of specification described herein and executing disclosed method using them can be based on The guidance of this paper is designed and manufactured with previous jointly owned patent disclosure, such as the U.S. that on May 12nd, 2013 announces is special Benefit announcement the 2013/0323732nd, Anderson etc. and 2 months 2016 U. S. applications submitted for 26th the 15/055th, 252, It (is both incorporated by reference into the description of single cell analysis method and system) by Conant etc..For example, can be from The C that Fluidigm Corporation (South San Francisco, CA) is obtained1 TMSingle-Cell Auto Prep System provides IFCTMIn multiple separation, cracking and reaction from single celled nucleic acid desk-top automation.In particular, C1Single-Cell Auto Prep Array IFC is a kind of matrix type microfluidic device, is facilitated single from up to 96 Capture and height prepare product in parallel in cell.Fluidigm also sells the high-throughput version of this types of devices, referred to as C1MRNA Seq HT Array IFC, it facilitates from up to 800 individual cells captures and prepares product.If used When each capture site capture one in chip is unicellular.Sometimes, site may capture zero, two or more cells； However, C1The exact amount of the cell captured in each capture site of chip is easy to be verified with high confidence level, and It is easy to record in microcosmic picture.In certain embodiments, it captures cell and is carried out in each individual reaction volume It is bar coded to generate bar coded nucleic acid molecules, by DNA sequencing, (either Sanger sequencing, next-generation sequencing are also It is third generation sequencing) optionally most conveniently analyzed after pre- amplification.
C1Structure makes it possible to combine any multi-step biochemical process for promoting analysis intracellular macromolecules and handles discrete catch The cell obtained.In addition to preparing the template for DNA sequencing, this class process further include the neighbouring connection measurement of such as multiplexed protein matter or Multiplexed protein matter is neighbouring to extend measurement with quantitative specific protein, and multiple microRNA expands in advance, the target of RNA transcript or DNA sequence dna Specific amplification (for example, being used for Genotypingpolymorphism marker, such as SNP, or otherwise analyzes hereditary variation, example Such as copy number variation), or any combination thereof.The structure can also be used for the cell that discrete capture is cultivated under the conditions of any required, The condition can be modified on chip by the agonist or antagonist of addO-on therapy such as special receptor.
Generate the DNA profiling of coding
Once cell is assigned in individual reaction volume, by individual cells permeabilization or destroy to discharge RNA.It is preferred that Ground, cell are destroyed (for example, cracking), and any conventional means for realizing this purpose can be used, and such as use albumen Enzyme K processing.Exemplary cracked solution is 0.5%NP-40,50mM Tris-HCl, pH 8.4,1mM EDTA.This is provided to inverse The optimal pH of transcriptase, and NP-40 does not inhibit reverse transcriptase.It is enough to crack many in 65-70 DEG C of of short duration incubation (1-2 minutes) Mammalian cell.If necessary to tightened up cracking, which can supplement 30 μ g/mL Proteinase Ks, and being incubated for can be 50 DEG C carry out 30 minutes, then carry out 1 minute at 70 DEG C.If in cracked solution including Proteinase K, cathepsin K inhibitor AAPF (catalog number (Cat.No.) 539470, EMD Millipore) can be included in reverse transcriptase reaction with the concentration of 0.33mM.It can quotient The cracked solution of purchase includes CelluLyserTM(TATAA Biocenter)、RealTime readyTM Cell Lysis (Roche Diagnostics) and Single Cell-to-CTTM(Life Technologies)。
It the use of the advantage to work from single celled RNA is that RNA does not need to purify.Single celled volume is picoliters Grade.Even if cell lysate, which can also be diluted to, to be enough to make enzymatic reaction can in commonly used in nanoliter rank of microfluid To be carried out directly in lysate.
In certain embodiments, reverse transcription reagents are added in individual reaction volume and carry out reverse transcription.In spy In fixed embodiment, then amplifing reagent is added in individual reaction volume and is expanded.
In some embodiments, what is carried out in each reaction volume (separating with other each reaction volumes) reacts production Raw DNA profiling, encode about reaction volume identity and/or cell and/or target one or more items of information (for example, It targets in transcript sequencing).DNA profiling can be recycled, is optionally merged, and carry out DNA sequencing, DNA sequencing determines DNA profiling Both sequence and the item of information wherein encoded.In specific embodiments, this allows for specific DNA profiling to be accredited as from spy Determine unicellular in reaction volume.
A kind of mode that this identification may be implemented is by one or more bar code nucleotide sequences (" bar code ") It mixes in DNA profiling.Bar code can actually be any length, although in some embodiments, shorter bar code (example Such as, 4-6 length of nucleotides) it can be preferably.In various embodiments, suitable Barcode Length be 2,3,4,5,6, 7, it 8,9,10,11,12,13,15,16,17,18,19 or 20 nucleotide or can fall by any one of these values boundary Fixed range, such as 2-10 or 3-8.
In some embodiments, each reaction can mix at least one unique molecular identifier (" UMI "), be only Spy identifies the nucleotide sequence of its molecule mixed.Kivioja etc. (2012), which is described, calculates molecule absolute quantity using UMI Process.In some embodiments, UMI is random sequence label (usually N4 to N10), before any amplification step Attach to molecule to be sequenced.Conventional RNA is sequenced, it is fixed to infer from the sum for the read for being mapped to each specific transcript Amount.For UMI, completed by calculating the quantity of the unique UMI observed for each specific transcript quantitatively, but regardless of every A UMI is read how many times.It tags for the end 5', UMI can be incorporated into template switch oligonucleotide.For 3'- End tags, and UMI can be impregnated in such as oligo dT primer.With regard to for UMI random nucleotide quantity for, N5 for Most of mammalian cells should be enough.For the expected relatively maxicell with more total transcripts, may suggest making With N6 or N7.
In the version of these embodiments, other than one or more UMI, reaction also mixes one or more Multiple bar codes are (for example, two bar codes add UMI with the row and column of encoder matrix type microfluidic device to encode original RNA The molecular identity of template).UMI can be any length, and will be with unique point to be identified to the desired length of setting analysis The quantity of son increases and increases.In various embodiments, suitable UMI length be 2,3,4,5,6,7,8,9,10,11,12, 13,15,16,17,18,19 or 20 nucleotide or the range defined by any one of these values, such as 2- can be fallen into 10,3-8,4-7 or 5-6.
The unicellular sequencing of T cell receptor or immuno globulin transcripts
In certain embodiments, the above method can be carried out respectively in single T or B cell to T cell receptor (TCR) or immunoglobulin (Ig) transcript is sequenced.In some embodiments, T or B cell is activated to can be used for analyzing to increase TCR or Ig transcript level.Any method activation T cell or B cell well known by persons skilled in the art can be used.Example Such as, when the MHC II class molecular presentation peptide antigen expressed on by the surface antigen presenting cell (APC), t helper cell (TH) quilt Activation.Cytotoxic T cell (TCCell or CTL) divided by combining with the MHC I class being present on all karyocyte surfaces Son association antigen and be activated.B cell is combined the antigenic activation of cell surface receptor.
TCR transcript generates
Each T lymphocyte expression combines the TCR of antigen.Antigen binding is the critical event in immune response cascade.Greatly The heterodimer that most TCR are made of the α-chain and beta chain that are encoded respectively by TRA and TRB gene.Sub-fraction TCR is difference The heterodimer being made of the γ-chain and δ-chain of TRG and TRD gene coding.
The multiplicity of antigen recognizing is generated by body cell V (D) the J recombination occurred at TRA, TRB, TRG and TRD locus Property.For the ease of discussing, method as described below concentrates on respectively is sequenced the transcript from TRA and TRB locus, But these methods are equally applicable to the transcript from TRG and TRD locus.Under unicellular resolution ratio, determine TRA and The sequence of the appropriate part of TRB serves as the unique identifiers of T cell ancestors, because any two T for expressing identical TCR α β couple is thin Born of the same parents may be from common T cell clone.This disclosure has described for targeting unicellular transcript sequencing to determine T cell The improved method of cloned identity.Improved method is convenient to carry out on microfluidic device, such as those described herein dress It sets, for example, such as the C of Fluidigm sale1Single-Cell Auto Prep ArrayTMIFC or C1mRNA Seq HT Array IFC。
TRA and TRB has the labyrinth illustrated in Fig. 3.In any given T cell, V (D) J is recombinated in TRA One in many variable (V), connection (J) and diversity (D) section is connected to constant (C) section to generate and compile at TRB The gene of α-chain and beta chain that code is expressed by the cell.In this process, non-template nucleotide (N) insertion is designated as CDR3 Section in.The sequence of CDR3 is the best marker for determining cloned identity.By using the primer to V and C specificity, It can expand and be sequenced the section containing CDR3.Because needs wrap in PCR mixture there are many different V sections Include many different TRAV and TRBV primers.However, for any given cell, usually only a kind of TRAV and a kind of TRBV Primer participates in PCR.
DNA profiling is prepared from TRC by reverse transcription and amplification
It is outlined above synoptically to describe the side that the DNA profiling of two kinds of TCR transcript is prepared from single T cell Method.These methods are enabled to use a kind of only amplification, this from the unicellular any available solutions for preparing TCR template are simple than for obtaining It is more.In addition, these methods separate reverse transcription step and amplification step, this provides higher specificity.In some embodiment party In case, specificity is further enhanced by design of primers as described below.
These methods can by art technology level in it is various in a manner of implement.In specific embodiments, exist C1The purpose that unicellular TCR sequencing (scTCRseq) is carried out on mRNA Seq HT Array IFC is to generate to have appropriate bar shaped 800 unicellular libraries of code and sequencing adapter, allow to merge the material collected from IFC, are cleared up with pearl, and directly add It is downloaded on Illumina sequenator.The first step after capturing cell is using C120 be included in mouth for reverse transcriptase (RT) reagent It is added in the cell of capture.With reference to Fig. 4 A, RT reagent includes two kinds of RT primers, the first RT has to encoding T cell receptor The first chain RNA constant section (CS) specificity part, and the 2nd RT primer has for encoding T cell receptor The part of constant section (CS) specificity of the RNA of two chains.First and second RT primers respectively additionally comprise the first nucleosides acidity scale Label, the first nucleotide label include the first primer binding site for the first DNA sequencing primer, and the first nucleotide label is in CS The 5' of specificity portion.
RT reagent includes another type of primer, referred to as " the first bar code primer ", and from 3 ' to 5 ' include drawing to first Part, the first bar code nucleotide sequence and the first sequencing adapter of object binding site specificity.As shown in Figure 4 A, each Different first bar code primers of the addition with different bar codes are (so that each bar code uniquely identifies specifically in column Column).TRAC and TRBC sequence is complementary with the mRNA of TCR α and β, and is used as specific primer during reverse transcriptase reaction.? In first bar code primer shown in Fig. 4 A, Rd2 is 2 sequence of Illumina TruSeq Read, BC1-20 refer to 20 kinds not Same bar code, and P7 is one of Illumina sequencing adapter.P7.BC.Rd2 primer is not involved in reverse transcription reaction, but There makes the end that bar code is added to amplification section during amplification step.
For two kinds of RT primers (TRAC and TRBC) and the first bar code primer, (P7.BC1-20.Rd2, i.e., 20 kinds different First bar code primer) design exemplary sequence it is as follows:
AC.A1:gtgactggagttcagacgtgtgctcttccgatctTGAATAGGCAGACAGACTTGTCA(SEQ ID NO:1)
BC.A1:gtgactggagttcagacgtgtgctcttccgatctCACACCAGTGTGGCCTTT(SEQ ID NO: 2)
P7.BC.Rd2x:CAAGCAGAAGACGGCATACGAGAT [bar code sequence] GTGACTGGAGTTCAGACGT (SEQ ID NO:3)
After these RT reagents are added, lytic cell, such as by the way that Proteinase K/NP-40 mixture is added and in raised temperature (50 DEG C) incubations of degree.Then, by component other needed for reverse transcription (for example, buffer, dNTP, cathepsin K inhibitor, inverse Transcriptase and C1 TMLoad reagent (Fluidigm 100-5170)) cell of capture is transferred to from common storage cavern and is reversed Record.
The illustrative methods are using C in next step140 line entries add amplifing reagent.B referring to fig. 4, amplifing reagent Including two groups of amplimers, one group of first amplimer, each first amplimer has the RNA to encoding T cell receptor α chain Difference can be changed section (VS) specificity part and one group of second amplimer, each second amplimer have to encode T The difference of the RNA of cell receptor β chain can be changed the part of section (VS) specificity.First and second amplimers respectively additionally comprise Second nucleotide label, it includes the second primer binding sites for the second DNA sequencing primer, and the second nucleotide label is in VS The 5' of specificity portion.
Amplifing reagent includes another type of primer, referred to as " the second bar code primer ", and from 3 ' to 5 ' include to second The part of primer binding site specificity, the second bar code nucleotide sequence and the second sequencing adapter.As shown in Figure 4 B, every Addition has different the second bar code primers (so that each bar code uniquely identifies particular row) of different bar codes in row. TRAV and TRBV sequence specific is in may be in the variable section in the mRNA of TCR α and β.Because there are many different variable sections, So multiple TRAV and TRBV primers must be used in each capture site.Rd1 is 1 sequence of Illumina TruSeq Read, BC1-40 refers to 40 kinds of different bar codes, and P5 is one of Illumina sequencing adapter.For two groups of amplimers (38TRAV and 31TRBV) and the second bar code primer (P5.BC1-40.Rd1, i.e., 40 kinds the second different bar code primers) are set The exemplary sequence of meter is as follows:
P5.BC.Rd1x:AATGATACGGCGACCACCGAGATCT [bar code sequence] ACACTCTTTCCCTACACGA (SEQ ID NO:73)
Other than above-mentioned primer, amplifing reagent further includes other components for carrying out amplification reaction (for example, PreAmp Master Mix (Fluidigm 100-5581) and C1 TM Loading Reagent(Fluidigm 100-5170))。
RT primer (TRAC and TRBC) and the first bar code (P7.BC.Rd2) primer are still present in RT step and are expanding It is used during increasing step.The combination of 40 bar codes and 20 bar codes on an opposite end on this one end of amplification section It is arranged as each of 800 cells and provides unique bar code identity.
It should be had a structure that in the amplicon that 20 collection ports are collected
P5-BC-Rd1-V (α or β)-CDR3 (α or β)-C (α or β)-Rd2-BC-P7
Because each cell has the combination bar code of their own, it is possible to merge 20 gleanings, use pearl or one A little other methods purifying, and be loaded on Illumina sequenator with the CDR3 sequence of each cell of determination.By It is used for other IFC using different groups of 20 bar codes in P7.BC.Rd2 primer, the library from multiple IFC can be surveyed It is pooled together before sequence.
In specific embodiments, amplified reaction is PCR, is preferably carried out under the conditions of thermal starting to improve amplifying specific Property.
Super-selective primer (Super Selective primer)
In some embodiments of methods described herein, it can be usedSuper-selective(also referred to as " ring ") primer (Marras S, Vargas-Gold D, Tyagi S, Kramer FR, PCT/US2014/015351, aboutSuper-selectiveThe description of primer It is incorporated by reference into) further enhance specific amplification.It is schematically shown in Fig. 5 exemplarySuper-selectivePrimer.Anchoring area Section (usual 18-35 nucleotide) combines template with keeping primer stability.Due to unpaired insert/ring region, bait district Section (usual 5-10 nucleotide) only shortly hybridizes with template.Once in a while, during the hybridization time, primer is prolonged by polymerase It stretches.Any mispairing of bait section can all greatly reduce the holding time of any hybridisation events, and thereby substantially reducing primer will A possibility that being extended.Therefore, it should which the unique template for participating in primer extend is that have anchor sequence and neighbouring, exact matching The template of bait sequences.Exemplary super-selective primer can have the insert of the anchoring area section of 24 nucleotide, 14 nucleotide With the bait sequences of 5-7 nucleotide.It is not needed by the ring that unpaired template nucleotide is formed long with the insert in primer It spends identical.For example, the ring opposite with the insert of 14 nucleotide may only contain 10 nucleotide.
TCR is sequenced, the identical program of above-outlined can be used, with following modification: TCR specific primer includes The insert not hybridized with TCR transcript.Fig. 6 A is illustratedSuper-selectiveUse of the primer in reverse transcription, and Fig. 6 B is illustrated Their uses in amplification.
Referring to Fig. 6 A, the CS specificity portion of the first RT primer includes that the CS not with the RNA of the α chain of coding TCR anneals The CS specificity portion of insert and/or the 2nd RT primer includes the not insertion with the CS annealing of the RNA of the β chain of coding TCR Object.The flank of insert is 5' anchor sequence and 3' bait sequences, is both annealed with CS.Preferably, the first and second RT primer It include insert；In some embodiments, insert is similar or identical in terms of sequence and/or length.
Referring to Fig. 6 B, the VS specificity portion of multiple first amplimers includes the not VS with the RNA of the α chain of coding TCR The VS specificity portion of the insert of annealing and/or multiple second amplimers include not with coding TCR β chain RNA VS The insert of annealing.The flank of insert is 5' anchor sequence and 3' bait sequences, is both annealed with VS.Preferably, the first He Second amplimer includes insert；In some embodiments, insert is similar in terms of sequence and/or length or phase Together.
In various embodiments, the first and second RT primers may include insert, and wherein standard primer is (that is, without insertion Object) for expanding；Standard primer can be used for reverse transcription together with the amplimer for including insert；Or two groups of primers may each comprise Insert.As the example of later embodiment, set forth below is RT primer (1TRAC and 1TRBC) and amplimer (41TRAV And 31TRBV) exemplary super-selective form sequence:
Using these super-selective primers, obtained amplicon general structure (P5-BC-Rd1-V (α still having the same Or β)-CDR3 (α or β)-C (α or β)-Rd2-BC-P7) and can merge and be sequenced as described above.
In the certain preferred embodiments of the above method, super-selective primer is not used in reverse transcription for expanding, because The generation of desired product is quite surprisingly enhanced for the combination of this primer.
In some embodiments, the concentration of " outside " bar code primer is more than the concentration of " inside " target specific primer. For example, external bar code primer can be 100 times, 75 times, 50 times, 40 times, 30 times, 20 times, 10 times than internal target specific primer Or 5 times be excessively used, or the excess to fall in any range that any of these values define, such as 30 times to 50 times make With.For example, in C1In embodiment on chip, using 50nM inside target specific primer and be 40 times excessive 2 μM External bar code primer obtains good result.
DNA profiling is prepared by reverse transcription, template switch and amplification
In some embodiments, template switch can be used and prepare DNA profiling from unicellular.This well-known skill Art is in Zhu YY, (2001) the Reverse transcriptase such as Machleder EM, Chenchik A template Switching:a SMART approach for full-length cDNA library It summarizes in construction.Biotechniques 30:892-897, is incorporated herein this description by reference.It is above general It states synoptically to discuss and switches the method for preparing DNA profiling described herein using template.Fig. 7 illustrates a reality of the technology The application of scheme is applied, to generate the DNA profiling (sequencing of targeting transcript) of specific coded sequence of target transcript.The quantity of target specific primer and Identity is determined by mRNA to be sequenced.These target specific primers are usually located at its respectively near the end 5' of mRNA.In Fig. 7 In, RT primer is shown with insert, but the primer of no insert also can be used.Reverse transcriptase extends target specific primer, Then the copy choice model, the information in duplication template switch oligonucleotide (Rd1-UMI-GGG) are utilized.It, can by mixing UMI To obtain the more accurate quantitative information for targeting mRNA." GGG " indicates widow-riboG sequence.Most typically, turn in template It changes using three guanines in oligonucleotides, but any effective number can be used.One or more guanines can be Lock nucleic acid (LNA).
By using RT primer, this method can be adapted for full transcript group sequencing, and wherein target specific moiety is right It replaces the part (for example, poly-dT) of the poly-A tail specificity of mRNA molecule.In any case, template can be expanded simultaneously Use bar code primer such as those described above (for example, P5-BC-Rd1 and Rd2-BC-P7) addition bar code and sequencing rank Son is connect, then merges and is sequenced as described above.If carrying out full transcript group sequencing, standard biological information can be used Method determines TCR and Ig sequence from the data obtained collection, to avoid to above-mentioned special unicellular TCR or Ig transcript sequencing The needs of method.Illustrative bioinformatics method sees Nat Methods.2016Apr；13 (4): 329-32.doi: 10.1038/nmeth.3800.Epub .T cell fate and clonality inference on May 7th, 2016 from Single-cell transcriptomes.Stubbington MJ,T, Proserpio V, Clare S, This description is incorporated herein by Speak AO, Dougan G, Teichmann SA by reference.In buffering technique, Ke Yijin Row template switch corresponds to the template of full transcript group to obtain, and then carries out TCR- or Ig- transcript specific amplification.
Optionally, any one of the sequencing of targeting transcript or the sequencing of transcript group or both can be with above-mentioned unicellular TCR Or Ig transcript sequencing approach combination.
In some embodiments, another acquisition TCR/Ig sequence information is provided using template switch oligonucleotide Mechanism.In this case, reverse transcription step by with TRAC primer, TRBC primer, optionally for other mRNA target or Poly A specific primer, P7.BC.Rd2 primer and template switch oligonucleotide carry out.By TRAC and TRBC primer extend to TCR The end 5' of mRNA, then carries out template switch.For amplification step, addition in need be include P5.BC.Rd1 primer Amplifing reagent.It does not need to add all different TRAV and TRBV primers.If desired, the quantity of sequencing circulation can be increased CDR3 sequence is obtained to determine.
In specific embodiments, template switch method carries out in microfluidic devices, as described above.In such case Under, RT primer can be delivered to capture site through one group of input line, and 5 ' oligonucleotides can be delivered via another group of input line To capture site.
Ig transcript generates
Natural antibody usually has two identical Ig heavy chains.By body cell recombinate with above to TCR description class As mode from multiple possible V, D, J and C sections assemble each Ig heavy chain gene.The example of heavy chain rearrangement is shown in Fig. 8 A In.There are multiple and different C sections (encoding constant regions), generate different isotypes.Natural antibody be generally also provided with two it is identical Ig light chain can be κ light chain or lambda light chain.It is light from each Ig of multiple possible V, J and C sections assemblings by body cell recombination Chain gene.One example of κ light chain rearrangement is as shown in Figure 8 B.As readily understood by the skilled person, this can also be carried out Text is annealed about the strategy that the description of TCR transcript is sequenced with the area V and C simply by design and Ig rather than the V of TCR and C The primer of region annealing carries out the sequencing of Ig transcript.
DNA sequencing
In some embodiments, method described herein include make generate DNA profiling be subjected to DNA sequencing, such as Sanger sequencing, next-generation sequencing (such as bridge-type sequencing) or third generation sequencing.It, can in the version of such embodiment To identify that the sequence obtained from DNA sequencing is from specific capture site based on one or two bar code.
As described above, the reaction product of the specific row or column from matrix type microfluidic device can be used as pond output.Reaction Any subsequent characterizations of product, such as DNA sequencing can carry out in single outlet pond.However, it is also contemplated that it can be further Merge pond itself before characterization.In this case, the DNA profiling from the independent capture site of each of microfluidic device is logical It is often different, this can easily be realized, such as be captured by using two bar code sequences to encode in microfluidic device The row and column position in site.
In some embodiments, it is advantageous in the amplified reaction product that takes a step forward for carrying out DNA sequencing.When all anti- When answering product that there is common end sequence, all reaction products to be sequenced can be merged and be used special to end sequence Primer (that is, in the illustrative embodiment for preparing above-mentioned TCR template, P5 and P7 primer will be used) expand together.
Primer combination
Above-mentioned any primer or oligonucleotides can be combined to form primer combination.In general, primer combination include 2,3,4, 5,10,20,30,40,50,60,70,80,90,100 or more primers or oligonucleotides, they are in all sides as described herein It is used together in method.When in the reaction as one group in use, individually primer individually can be packed or be packaged together.Example Such as, when primer is used to that TCR or Ig to be sequenced, the group of all possible variable section specific primer is advantageously packaged in one It rises.
Kit
Kit according to the present invention may include for practice one or more of method described herein it is useful one Kind or more reagent.Kit generally comprises the packaging with one or more containers, one or more container Reagent is accommodated as one or more of individual compositions, or optionally, in the case where the compatibility of reagent will allow, is made For mixture.Kit may also include be from user perspective can be desired other materials, such as buffer, diluent, standard Product and/or useful any other materials in sample treatment, any other step washed or be measured.Specific In embodiment, kit includes one or more of matrix type microfluidic device and/or primer/oligonucleotides discussed above Or combinations thereof.
It it should be understood that embodiment described herein the purposes with being given for example only property of embodiment, and is ability Field technique personnel teach the various modifications or change according to it, and be included in spirit and scope and it is appended as In the scope of the claims.
In addition, herein cited every other publications, patents and patent applications are by quoting with its entirety in order to all Purpose is incorporated herein.
Embodiment
Embodiment 1: super-selective primer is used to generate the purposes of T cell receptor template
RT primer sets 1 (RT- is acyclic) are the mixture of AC.A1 and BC.A1.RT primer sets 2 (RT- ring) be AC.L1 and The mixture of BC.L1.V primer sets 1 (V- is acyclic) are mixtures below: AV01.A1, AV02.A1, AV03.A1, AV04.A1, AV05.A1、AV06.A1、AV07.A1、AV08.A11、AV08.A12、AV08.A13、AV09.A1、AV10.A1、AV12.A1、 AV13.A11、AV13.A12、AV14.A1、AV16.A1、AV17.A1、AV18.A1、AV19.A1、AV20.A1、AV21.A1、 AV22.A1、AV23.A1、AV24.A1、AV25.A1、AV26.A11、AV26.A12、AV27.A1、AV29.A1、AV30.A1、 AV34.A1、AV35.A1、AV36.A1、AV38.A1、AV39.A1、AV40.A1、AV41.A1、BV02.A1、BV03.A1、 BV04.A1、BV05.A11、BV05.A12、BV06.A11、BV06.A12、BV07.A11、BV07.A12、BV07.A13、 BV07.A14、BV09.A1、BV10.A11、BV10.A12、BV10.A13、BV11.A1、BV12.A11、BV12.A12、 BV13.A1、BV14.A1、BV15.A1、BV16.A1、BV18.A1、BV19.A1、BV20.A1、BV24.A1、BV25.A1、 BV27.A1, BV28.A1, BV29.A1 and BV30.A1.V primer sets 2 (V- ring) are mixtures below: AV01.L1, AV02.L1、AV03.L1、AV04.L1、AV05.L1、AV06.L1、AV07.L2、AV08.L11、AV08.L12、AV08.L13、 AV08.L14、AV9.L11、AV9.L12、AV10.L1、AV12.L11、AV12.L12、AV12.L13、AV13.L11、 AV13.L12、AV14.L1、AV16.L1、AV17.L1、AV18.L1、AV19.L1、AV20.L1、AV21.L1、AV22.L1、 AV23.L1、AV24.L1、AV25.L1、AV26.L11、AV26.L12、AV27.L1、AV29.L1、AV30.L1、AV34.L1、 AV35.L1、AV36.L1、AV38.L1、AV39.L1、AV40.L1、AV41.L1、BV02.L1、BV03.L1、BV04.L1、 BV05.L11、BV05.L12、BV06.L11、BV06.L12、BV07.L11、BV07.L12、BV07.L13、BV07.L14、 BV09.L1、BV10.L11、BV10.L12、BV10.L13、BV11.L1、BV12.L11、BV12.L12、BV13.L1、BV14.L1、 BV15.L1、BV16.L1、BV18.L1、BV19.L1、BV20.L1、BV24.L1、BV25.L1、BV27.L1、BV28.L1、 BV29.L1 and BV30.L1.In experiments described below, these primers are applied in combination with following:
1: acyclic RT primer and acyclic V primer
2: ring RT primer and acyclic V primer
3: acyclic RT primer and ring V primer
4: ring RT primer and ring V primer
Reverse transcriptase reaction system includes 100ng total serum IgE, every kind of 220nM from human peripheral blood mononuclear cell (PBMC) RT primer (RT- acyclic or RT- ring), 15mM Tris-HCl, pH 8.4,75mM KCl, 10mM MgCl2, 5% (v/v) glycerol, 10mM dithiothreitol (DTT), 0.8 unit/μ L RNaseOUTTM(Thermo Fisher Scientific), 500 μM of every kind of dNTP and 8 units/μ LReverse transcriptase (Thermo Fisher Scientific) is in the volume of 11.5 μ L.It will These reaction systems are incubated for 10 minutes at 25 DEG C, are incubated for 60 minutes, are subsequently placed on ice at 42 DEG C.Add into each reaction system Enter the 14 pre- amplified matters of μ L (preamp)/primer mixture, so that ultimate density is 1 × PreAmp Master Mix (Fluidigm) and every kind of V primer of 50nM (V- acyclic or V- ring).The condition of PCR be 95 DEG C 5 minutes, 20 96 DEG C 5 seconds and 60 Then DEG C of 6 minutes circulations keep 4 DEG C.10 microlitres are added into each reaction system by 2 μ L exonuclease I (New England BioLabs), 1 μ 10 × exonuclease I of L reaction buffer, 7 μ L water composition mixture.By these reactants It ties up to 37 DEG C to be incubated for 30 minutes, is incubated for 15 minutes, is subsequently placed on ice at 80 DEG C.90 microlitres are added into each reaction system 10mM Tris-HCl, pH 8.0,1mM EDTA.In order to purify, by 50 every kind of samples of μ L and 50 μ L AMPure XP pearls (Beckman Coulter) mixing, is sufficiently mixed, and is kept for 5 minutes in room temperature.Each sample cell is placed on magnetic sheet 5 minutes, Then liquid is discarded supernatant.Twice with freshly prepd 70% ethanol washing pearl.It, then will be every by pearl at drying at room temperature at least 7 minutes A sample cell is resuspended in 30 μ L 10mM Tris-HCl, pH 8.0,0.1mM EDTA.It is being placed at room temperature for after five minutes, it will be each Sample cell is placed on magnetic sheet 2 minutes, and every kind of supernatant is transferred in new pipe.Use High Sensitivity DNA reagent Box (Agilent) analyzes 1 μ L aliquot of each sample in 2100Bioanalyzer system.
As a result shown in Figure 9.Magnitude range from the expectation DNA fragmentation of TCR transcript is 250 to 350 nucleosides Acid.The magnitude range of unwanted non-specificity segment is 100 to 220 nucleotide.For combination 3, desired segment is observed With the best ratio of undesirable segment, combination 3 is acyclic RT primer and ring V primer.
Embodiment 2: the recycling for the DNA profiling that fixed enhancing is generated from RNA transcript
Use the CD4 of magnetic beads for purifying enrichment human peripheral blood mononuclear cell (PBMC)+Cell.It is solidifying by 2 μ g/mL plants of addition Collect the sedimentation cell that plain (PHA) activation is resuspended in Dulbecco improvement Eagle culture medium (DMEM) containing IL-2 and IL-7. After activation five days, washs cell and reuse magnetic beads for purifying enrichment CD4+Cell.Two aliquots of these cells are sunk It forms sediment.Fresh cell will be appointed as to be resuspended in phosphate buffered saline (PBS) (PBS).To be appointed as fixed cell be resuspended in containing In the PBS of 1mg/mL 3,3'- dithiodipropionic acid two (N-hydroxy-succinamide ester) (DSP, Sigma-Aldrich).It will 800 fresh or fixed cell precipitations are simultaneously resuspended in 5.5 μ L cleavage mixtures, and the mixture is by 50mM Tris-HCl, pH 8.4,40mM dithiothreitol (DTT), 0.5%NP-40 detergent, 8 units/mL Proteinase K (New England BioLabs), The acyclic primer of every kind of RT- of 230nM, 9.2 μM of P7.rcCBC001.Rd2x primer (CAAGCAGAAGACGGCATACGAGATcgcg ActgaaGTGACTGGAGTTCAGACGT) (SEQ ID NO:149) and 1 × C1 load reagent (Fluidigm) composition.By these Reaction system is incubated for 30 minutes at 50 DEG C, is incubated for 1 minute, is subsequently placed on ice at 72 DEG C.6 μ L are added into each reaction system RT mixture so that ultimate density be 15mM Tris-HCl, pH 8.4,75mM KCl, 10mM MgCl2, 5% (v/v) it is sweet Oil, 360 μM of AAPF cathepsin K inhibitors (EMD Millipore), 500 μM of every kind of dNTP, 8 units/μ LReverse transcriptase and 1 × C1 load reagent.These reaction systems are incubated for 60 minutes at 42 DEG C, are incubated at 85 DEG C It educates 5 minutes, is subsequently placed on ice.Pre- amplified matter/the primer mixture of 14 μ L is added into each reaction system, so that ultimate density For every kind of V- ring primer of 1 × PreAmp Master Mix (Fluidigm) and 50nM and 2 μM of P5.Rd1x primer (AATGATA CGGCGACCACCGAGATCTACACTCTTTCCCTACACGA) (SEQ ID NO:150) and 1 × C1 load reagent.The item of PCR Part be 95 DEG C 5 minutes, then 20 96 DEG C 20 seconds and 60 DEG C of 6 minutes circulations keep 4 DEG C.It is added into each reaction system 25 microlitres of 10mM Tris-HCl, pH 8.0,1mM EDTA.In order to purify, by each sample and 35 μ L AMPureXP pearls (Beckman Coulter) mixing, is sufficiently mixed, and is kept for 5 minutes in room temperature.Each sample cell is placed on magnetic sheet 5 minutes, Then liquid is discarded supernatant.Twice with freshly prepd 70% ethanol washing pearl.It, then will be every by pearl at drying at room temperature at least 7 minutes A sample cell is resuspended in 20 μ L10mM Tris-HCl, pH 8.0,1mM EDTA.It is being placed at room temperature for after five minutes, by each sample Quality control is placed on magnetic sheet 2 minutes, and every kind of supernatant is transferred in new pipe.Following substance: 2.5 μ L is added to each sample 10 μM of P5 primers (AATGATACGGCGACCACCGAGATCTACAC) (SEQ ID NO:151), 2.5 μ L10 μM P7 primers (CAAGCAGAAGACGGCATACGAGAT) (SEQ ID NO:152) and 25 μ LHot Start HiFi PCR Master Mix(New England BioLabs).The condition of PCR be 98 DEG C 30 seconds, 18 98 DEG C 10 seconds and 62 DEG C 2 minutes Circulation, 75 DEG C 2 minutes, then keep 4 DEG C.In order to purify, by each sample and 35 μ L AMPureXP pearl (Beckman Coulter it) mixes, is sufficiently mixed, and kept for 5 minutes in room temperature.Each sample cell is placed on magnetic sheet 5 minutes, is then discarded Supernatant.Twice with freshly prepd 70% ethanol washing pearl.By pearl at drying at room temperature at least 7 minutes, then by each sample cell It is resuspended in 20 μ L 10mM Tris-HCl, pH 8.0,1mM EDTA.It is being placed at room temperature for after five minutes, each sample cell is being placed on 2 minutes on magnetic sheet, and every kind of supernatant is transferred in new pipe.
1 μ of each sample is analyzed in 2100Bioanalyzer system using High Sensitivity DNA kit L aliquot.As a result shown in Figure 10.Due to being added to P5, P7 and other sequences, from the expectation DNA piece of TCR transcript The magnitude range of section is 320 to 400 nucleotide.The result shows that fixed cell generates more much better expectation than fresh cells Segment yield.
Embodiment 3: unicellular T cell receptor template is generated using C1 mRNA SeqHT Array IFC
In following program, any pair of referring to for standard scheme refers to " using C1 high throughput IFC generation for mRNA survey The unicellular cDNA library of sequence " (Fluidigm PN 100-9886).This document additionally provides the details of instrumentation.
Liquid storage
5 × RT buffer
75mM Tris-HCl, pH 8.4
375mM KCl
50mM MgCl2
25% glycerol (50%, Teknova G1796, G1797, G1798, G1799)
18mM AAPF cathepsin K inhibitor
10mg AAPF cathepsin K inhibitor is dissolved in 1mL DMSO
It is stored in -20 DEG C
C1 mixture
20×Column mixture
Mixture:
187.5 μ L cell rinse reagents (Fluidigm)
12.5 μ L C1 load reagent (Fluidigm 100-5170)
8 μ L are distributed in each hole into 20 holes
2 μ L, 100 μM of P7.rcCBC001-020.Rd2x are added, different bar codes is added in every hole
During setting causes (Prime) step, each by 8 μ L is transferred to 20 entrances labeled as " being included in mouth " Each of.The addition of bar code mixture will actually occur after cell dyeing.
Cleavage mixture(163.5μL)
15 μ L 1M Tris-HCl, pH 8.4
12 μ L 1M dithiothreitol (DTT)s
15 μ L 10%NP-40 (0.5% in final rxn)
The acyclic primer of every kind of RT- of 6.9 10 μM of μ L
3 800 units of μ L/mL (20mg/mL) Proteinase K (8 units/mL in final rxn)
8.2 μ L C1 load reagent (Fluidigm 100-5170)
103.4μL H2O
During end reaction system is set, 130 μ L cleavage mixtures are transferred to entrance L2 (bulk container).
RT mixture(26μL)
10 μ L 5 × RT buffers
1 every kind of dNTP of μ L 25mM
1 μ L 18mM AAPF cathepsin K inhibitor (in final rxn 360 μM)
1 200 units of μ L/μ LReverse transcriptase
1.3 μ L C1 load reagent (Fluidigm 100-5170)
11.7μL H2O
During end reaction system is set, 20 μ L RT mixtures are transferred to entrance RT.
40 × row mixture
PCR mixture(225μL)
130 μ L 5 × PreAmp Master Mix (Fluidigm 100-5581) (1 × in final rxn)
65 every kind of μ L 500nM V- ring primers (every kind of primer 50nM in final rxn)
18 μ L C1 load reagent (Fluidigm 100-5170)
12μL H2O
5 μ L PCR mixtures are assigned in each of 40 holes
2.9 μ L, 10 μM of P5.rcRBC001-040.Rd1x are added, different bar codes is added in every hole
During end reaction system is arranged, each by 5 μ L is transferred to the entrance labeled as " row bar code ".
Collect mixture(200μL)
194 μ L C1 collect reagent (Fluidigm 100-7081)
6 μ L 10mg/mL yeast tRNA (Thermo Fisher Scientific AM7119)
During end reaction system is set, 180 μ L to each collection entrance.
C1 step
1. causing:
A. it follows standard and causes loading figure, with pipettor withdraw mix.For valve fluid (Valve Fluid), addition Polysorbas20 to ultimate density is 0.05%, and respectively loads 250 μ L to Acc1 and Acc2.
B. every kind of column mixture of 8 μ L is drawn with pipettor be included in mouth to 20
C. operation causes script: " mRNA Seq Prime R&C barcode ".~51 minutes
2. loading cells:
A. liquid is replaced according to standard scheme
B. column mixture 20 are retained in be included in mouth
C. CD4+T cell that press the activation of preparation described in embodiment 2, that DSP is fixed is used, by 20 μ L cell suspending liquids Distribution is each of to two cell entries
D. if you want cell load and dyeing: Run Script " mRNA Seq HT:Cell Load&Stain with Barcode "~39 minute Column
E. if you only want to cell load and washing: Run Script " mRNA Seq HT:Cell load with Barcode "~9 minute column
3. end reaction:
A. liquid relevant to cell is replaced according to standard scheme.
B. cleavage mixture is drawn to the area L2 (upper right corner) ,~130 μ L with pipettor
C. RT mixture is drawn to RT entrance, about 20 μ L with pipettor
D. the PCR mixture containing bar code primer is drawn into 40 line entries with pipettor, each~5 μ L
E. before IFC is inserted into machine, whole reagents are checked, such as collect reagent.
F. Run Script " scTCR Seq HT "~6 hours.Setting time postpones as usual.
End reaction is made up of:
1. for room 0+1'sCleavage mixture
50 DEG C, 30 minutes (1800 seconds)
72 DEG C, 1 minute (60 seconds)
10 DEG C, 1 minute (60 seconds)
2. for room 0+1+2'sRT mixture
42 DEG C, 60 minutes (3600 seconds)
85 DEG C, 5 minutes (300 seconds)
3. for room 0+1+2+3'sPCR mixture
70 DEG C, 30 minutes (1800 seconds)
95 DEG C, 5 minutes (300 seconds)
20 circulations: 96 DEG C, 20 seconds
60 DEG C, 6 minutes (360 seconds)
4. collecting
20 collection samples are transferred in 96 orifice plates.
Merge 5 μ L of every kind of sample.
It is cleared up using 80 μ L AMPure XP pearls.It is eluted with 50 μ L 10mM Tris-HCl, pH 8.0,0.1mM EDTA.
It is cleared up using 40 μ L AMPure XP pearls.It is eluted with 20 μ L 10mM Tris-HCl, pH 8.0,0.1mM EDTA.
It is added:
2.5 10 μM of μ L P5 primers
2.5 10 μM of μ L P7 primers
25μLHot Start HiFi PCR Master Mix
98 DEG C, 30 seconds
20 circulations: 98 DEG C, 10 seconds
62 DEG C, 2 minutes
75 DEG C, 2 minutes
It 4 DEG C, keeps
It is cleared up using 35 μ L AMPure XP pearls.It is eluted with 20 μ L 10mM Tris-HCl, pH 8.0,0.1mM EDTA.
The primer sequence that front does not provide is as follows:
It is the example of the α CDR3 sequence detected in the CD4+T cell individually stimulated analyzed using the program below:
Uplink is the DNA sequence dna determining by sequencing.Downlink is the amino acid sequence inferred.When by being similar to Nat Biotechnol.2014Jul；32(7):684-92,"Linking T-cell receptor sequence to functional phenotype at the single-cell level,”Han A,Glanville J,Hansmann L, When unicellular from same community of analysis of method described in Davis MM, identical CDR3 sequence is detected.
Embodiment 4: C1 mRNA SeqHT is used Array IFC generates unicellular T cell receptor+coded sequence of target transcript template
The program is identical as in embodiment 3, the difference is that target RT primer is added in cleavage mixture, and will Template switch oligomer (TSO) is added to RT mixture.Modified formula is as follows:
Cleavage mixture(163.5μL)
15 μ L 1M Tris-HCl, pH 8.4
12 μ L 1M dithiothreitol (DTT)s
15 μ L 10%NP-40 (0.5% in final rxn)
The acyclic primer of every kind of RT- of 6.9 10 μM of μ L
6.9 every kind of 10 μM of μ L target RT primers
3 800 units of μ L/mL (20mg/mL) Proteinase K (8 units/mL in final rxn)
8.2 μ L C1 load reagent (Fluidigm 100-5170)
96.5μL H2O
During end reaction system is set, 130 μ L cleavage mixtures are transferred to entrance L2 (bulk container).
RT mixture(26μL)
10 μ L 5 × RT buffers
5μL 20μM TSO.Rd1.1
1 every kind of dNTP of μ L 25mM
1 μ L 18mM AAPF cathepsin K inhibitor (in final rxn 360 μM)
1 200 units of μ L/μ LReverse transcriptase
1.3 μ L C1 load reagent (Fluidigm 100-5170)
6.7μL H2O
During end reaction system is set, 20 μ L RT mixtures are transferred to entrance RT.
The sequence of template switch oligonucleotide TSO.Rd1.1 is/5'- biotin/rArCrArCrUrCrUrUrUrCrCrC RUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrUrNrNrNrHrHrHrH rGrGrG/3'- is amido modified Object/, r indicates ribonucleotide, and rN is rA, rC, rG or rU, and rH is rA, rC or rU (SEQ ID NO:214).For 96 The sequence of the target RT primer of a coded sequence of target transcript is:
Embodiment 5: unicellular T cell receptor template is generated using clamp primers
This embodiment describes the illustrative methods of the generation to the unicellular T cell receptor template for being designed to be used as pipe Modification be suitable for Fluidigm C1 TMHigh-throughput IFC (" HT-IFC ").
The method for being designed to be used as pipe is schematically shown in Figure 11 A-11B.In reverse transcriptase (RT) step (figure During 11A), primer Rd2.TRAC and Rd2.TRBC hybridize with the mRNA of TCR α and β respectively, and extend to generate TCR specificity cDNA.Primer Rd2.N7.T20VN (the Rd2-UMI- oligomerization dT in Figure 11 A) is generated from all polyA+mRNA in sample cDNA.Primer P7.rcCBC001.Rd2x (P7-CBC1-20-Rd2 in Figure 11 A) is present in reaction, but until PCR step Just used.During the initial cycle of PCR (Figure 11 B), primer Rd1.TRAV.L1 (42 kinds of different primers；In Figure 11 B Rd1-TRAV), Rd1.TRBV.L1 (31 kinds of different primers；Rd1-TRBV in Figure 11 B) and Rd1.Target.L1 (96 kinds are not Same primer；Rd1- target in Figure 11) primer extend production is generated on TCR- α cDNA, TCR- β cDNA and 96 kinds of target cDNA respectively Object.It is super, selective primer (Marras S, Vargas-Gold D, Tyagi by these design of primers to enhance specificity S, Kramer FR, PCT/US2014/015351；Vargas DY, Kramer FR, Tyagi S, Marras SA, “Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer,"PLoS One 11:e0156546,2016).At this point, DNA chain has Rd1 or Rd25' tail, and can with external primers P5.rcRBC001.Rd1x (P5-RBC11-40-Rd1 in Figure 11 B) and P7.rcCBC001.Rd2x (P7-CBC11-20-Rd2 in Figure 11 B) amplification.The program generate the library size overwhelming majority be 350-450bp.When sequencing, these libraries generate desired data, i.e. TCR sequence and the sequence from 96 coded sequence of target transcript.
However, library includes the non-of the usually less than 350bp of significant percentage when the program is used together with HT IFC Specific fragment.This seems to come from that PCR reagent and the suboptimum of RT reaction system mix.In PCR mixture, primer P5.rcRBC001.Rd1x (or one of its bar code counterpart) with high concentration with it is every other needed for archaeal dna polymerase and PCR Component exists together.When PCR mixture is loaded into IFC, the mixing with RT reaction system mainly passes through diffusion.Cause It is small for the primer ratio cDNA in RT reaction system, so these primers spread faster, and initially encounter Other primers in P5.rcRBC001.Rd1x and PCR mixture.Therefore, the false pain object (spurious including a variety of primers Product it) has the opportunity to be formed before generating any specific product including cDNA.By by primer P5.rcRBC001.Rd1x, which moves to RT reaction system, can partly overcome the problems, such as this.When completing the operation, produced in HT IFC Raw library has the desired product in 350-450bp magnitude range really, but still there are many 250bp and smaller non-spies Specific product.
It generates remaining nonspecific products and seems to come from that the Rehydration step used during PCR.It is being directed to HT IFC In the standard mRNA sequencing scheme of exploitation, rehydration is carried out every a PCR cycle.In TCR scheme, by by rehydration from It is to be recycled every 3 every 1 varying cyclically, specific product (350 to 450bp) and nonspecific products (being less than 250bp) Ratio improve.Ratio is more improved every 7 circulation rehydration although increasing to, effect is inappreciable.One It is that, when reaction is reduced to 25 DEG C, primer is organic to will form nonspecific products that kind, which is explained,.It is desirable that be lower temperature will The method of primer " closing ".This is completed by using clamp primers, each clamp primers by connected by ring flat end, The stem (" stem-duplex ") of self-complementary forms (Lao KQ, Straus NA, Livak KJ, " Hot start reverse Transcription by primer design ", United States Patent (USP) 8,993,240).The use of clamp primers solves another Problem.It may also lead to the formation of nonspecific products with too many primer in RT reaction.Hair clip used herein is designed to In 42 DEG C of closings of RT reaction, but 62 DEG C of annealing temperatures used in PCR are opened.Therefore, during RT reaction or in PCR Rehydration step during, when the temperature of HT-IFC is reduced to 25 DEG C, these primers do not work.
Following primer is replaced with hairpin formation (being expressed as .HP): P5.rcRBC001-040.Rd1x (40 kinds of primers), P7.rcCBC001-020.Rd2x (20 kinds of primers), Rd1.TRAV.L1 (42 kinds of primers), Rd1.TRBV.L1 (31 kinds of primers) and Rd1.Target.L1 (96 kinds of primers).Using the .HP form of these primers, from being trapped in HT IFC in HT-IFC It is unicellular to generate the specificity TCR library that magnitude range is 350-450bp, only with the non-specific segment of minimum.The plan Slightly schematically shown in Figure 12 A-12B.The library TCR is prepared from the mixing pit of the CD4+ or CD8+T cell of stimulation.Under The scheme that face provides, fixed unicellular of about 400 DSP are trapped on HT IFC and processed.As shown in figure 13, the party The library size overwhelming majority that method generates is 350-450bp.
Scheme:
Purchase
Thermo Fisher Scientific
Reverse transcriptase
18064-014
10%NP-40
PI-28324
DNTP mixture, every kind of 25mM
FERR1121
Yeast tRNA (10mg/mL)
AM7119
New England BioLabs
Proteinase K
P8107S
Hot Start HiFi PCR Master Mix
M0543S
EMD Millipore
AAPF cathepsin K inhibitor
539470
Teknova
1M Tris-HCl, pH 8.4
T1084
1M DTT (dithiothreitol (DTT))
D9750
DNA buffer suspension liquid
T0221
Beckman Coμlter
AMPure XP pearl
A63880
Liquid storage
5 × RT buffer
75mM Tris-HCl, pH 8.4
375mM KCl
50mM MgCl2
25% glycerol (50%, Teknova G1796, G1797, G1798, G1799)
18mM AAPF cathepsin K inhibitor
10mg AAPF cathepsin K inhibitor is dissolved in 1mL DMSO
It is stored in -20 DEG C
C1 mixture
20×Column mixture
Mixture:
187.5 μ L cell rinse reagents (Fluidigm)
12.5μL C1TMIt loads reagent (Fluidigm 100-5170)
8 μ L are distributed in each hole into 20 holes
2 μ L, 50 μM of P7.rcCBC001-020.Rd2x.HP (in PCR 1 μM) is added, different bar codes is added in every hole
Before loading cells and dyeing, by one be transferred in 20 entrances labeled as " being included in mouth " of every kind of 9 μ L It is a.Bar code mixing will occur after cell dyeing.
2 × cleavage mixture(245.4μL)
45 μ L 1M Tris-HCl, pH 8.4
36μL 1M DTT
45 μ L 10%NP-40 (0.5% in final rxn)
20.7 every kind of AC.A1/BC.A1 primers of 10 μM of μ L (110nM in RT rxn)
18.9 10 μM of μ L Rd2.N7.T20VN (100nM in RT circulation)
9 800 units of μ L/mL (20mg/mL) Proteinase K (8 units/mL in final rxn)
33.8μL C1TMIt loads reagent (Fluidigm 100-5170)
37μL H2O
40 × row mixture
5 μ 2 × cleavage mixtures of L are assigned in each hole in 40 holes
5 μ L, 17 μM of P5.rcRBC001-040.Rd1x.HP (in PCR 1 μM) is added, different bar codes is added in every hole
Every kind of 9 μ L are transferred to the entrance labeled as " row bar code "
RT mixture(26μL)
10 μ L 5 × RT buffers
1 every kind of dNTP of μ L 25mM
1 μ L 18mM AAPF cathepsin K inhibitor (in final rxn 360 μM)
1 200 units of μ L/μ L SuperScript II reverse transcriptase
1.3μL C1TMIt loads reagent (Fluidigm 100-5170)
11.7μL H2O
20 μ L RT mixtures are transferred to entrance RT
PCR mixture(150μL)
54.6μL 5×PreAmp Master Mix(Fluidigm 100-5581)
2.7 every kind of TRAV.L1.HP/TRBV.L1.HP primers of 5 μM of μ L (every kind of primer 50nM in final rxn)
2.7 every kind of 5 μM of μ L target .L1.HP primers (every kind of primer 50nM in final rxn)
7.5μL C1TMIt loads reagent (Fluidigm 100-5170)
82.5μL H2O
130 μ L PCR mixtures are transferred to entrance L2 (big storage cavern).
Collect mixture(200μL)
194 μ L C1 collect reagent (Fluidigm 100-7081)
6 μ L 10mg/mL yeast tRNA
180 μ L to collect entrance
C1 step
1. causing:
A. it follows scTCR small_v1xx v5 and causes loading figure, with pipettor withdraw mix.For valve fluid, add Add polysorbas20 to final concentration of 0.05%, or use valve fluid v2.
B. 9 μ L each column mixtures are drawn with pipettor and is included in mouth to 20
C. operation causes script: " scTCR small:26min Prime with Column Barcode (1911x) "
2. loading cells:
A. scTCR small_v1xx v5 replacement liquid is followed.
B. column mixture 20 are retained in be included in mouth
C. 20 μ L cell suspending liquids are assigned to each of two cell entries
D. 20 μ L cell rinse reagents are assigned to each of two cell dyeing entrances
E. Run Script " scTCR small:36min, Cell Load with column barcode (1911x) "
3. last reaction:
A. the relevant liquid of scTCR small_v1xx v5 replacement cell is followed.
B. cleavage mixture is drawn into 40 line entries with pipettor, each~9 μ L
C. RT mixture is drawn to RT entrance ,~20 μ L with pipettor
D. PCR mixture is drawn to the area L2 (upper right corner) ,~130 μ L with pipettor
E. before IFC is inserted into machine, whole reagents are checked, such as collect reagent.
F. Run Script " scTCR small:7hr50min Chemistry v5D (1911x) ".It is arranged as usual Time delay.
End reaction is made up of:
1.For room 0+1'sCracking mixingObject
50 DEG C, 30 minutes (1800 seconds)
72 DEG C, 1 minute (60 seconds)
10 DEG C, 1 minute (60 seconds)
2.For room 0+1+2'sRT mixture
42 DEG C, 90 minutes (5400 seconds)
85 DEG C, 5 minutes (300 seconds)
3.For room 0+1+2+3'sPCR mixture
95 DEG C, 2 minutes (120 seconds)
22 circulation: 95 DEG C 5 seconds
62 DEG C, 5 minutes (300 seconds)
4. collecting
Step after C1
20 collection samples are transferred in 96 orifice plates.
Merge 2.5 every kind of samples of μ L.
It is cleared up using 40 μ L AMPure XP pearls.It is eluted with 50 μ L DNA buffer suspension liquid.
It is cleared up using 40 μ L AMPure XP pearls.It is eluted with 20 μ L DNA buffer suspension liquid.
It is added:
2.5 μ L10 μM P5 primers
2.5 μ L10 μM P7 primers
25μL Q5Hot Start HiFi PCR Master Mix
98 DEG C 30 seconds
21 circulations: 98 DEG C, 10 seconds
62 DEG C, 2 minutes
75 DEG C, 2 minutes
It 4 DEG C, keeps
It is cleared up with 35 μ L AMPure XP pearls.It is eluted with 30 μ L DNA buffer suspension liquid.
It is cleared up with 21 μ L AMPure XP pearls.It is eluted with 20 μ L DNA buffer suspension liquid ...
1 μ L is checked on Bioanalyzer.
Primer:

Claims (15)

1. a kind of method for the DNA profiling for preparing the unicellular transcript sequencing for the RNA from cell colony, the method Include:
Cell from the group is assigned in individual reaction volume, so that multiple individual reaction volumes respectively contain It is unicellular, wherein the cell has been handled with fixative before a distribution, wherein the fixative is fixed comprising cell permeabilization Agent, the cell permeabilization fixative when making it possible to than there is no the cell permeabilization fixative higher efficiency from deriving from Single celled transcript generates DNA profiling；
Each cell in permeabilization or each individually reaction volume of destruction；
From the RNA reverse transcription cDNA in each individual reaction volume；With
The cDNA is expanded to generate DNA profiling, wherein the amplification incorporation promotes one kind of the DNA sequencing of the DNA profiling Or more nucleotide sequence.
2. the method as described in claim 1, wherein the fixative stablizes nucleus and/or stablizes RNA.
3. the method as described in claim 1, wherein the method includes pre-processing the cell with the fixative.
4. method as claimed in claim 1 or 3, wherein the fixative includes biomarker and histology preservative (BHP)。
5. method as claimed in claim 1 or 3, wherein the fixative includes two thiobis (succinyl phosphorons amino propyl acid ester) (DSP)。
6. method according to any one of claims 1 to 5, wherein with one or more ponds of DNA profiling from individually anti- Volume is answered to recycle the DNA profiling.
7. such as method of any of claims 1-6, wherein further expanding the DNA profiling after recycling.
8. wherein the method, which also comprises, undergoes the DNA profiling such as method of any of claims 1-7 DNA sequencing.
9. such as method of any of claims 1-8, wherein the method includes preparing for the T from the group The DNA profiling of the unicellular transcript sequencing of the RNA of cell receptor or immunoglobulin, in which:
The cell includes T cell or B cell；And
The DNA profiling is generated by the RNA of T cell receptor or immunoglobulin respectively.
10. method as claimed in claim 9, wherein the cell is T cell.
11. method as claimed in claim 9, wherein the cell is B cell.
12. method as described in claim 10 or 11, wherein the cell is activation.
13. it is a kind of for generating the primer combination of DNA profiling from the RNA of encoding T cell receptor or immunoglobulin chain, it is described to draw Object combination includes:
First reverse transcription (RT) primer, the first reverse transcription (RT) primer have to encoding T cell receptor or immunoglobulin The first chain RNA constant section (CS) specificity part, the T cell receptor or immunoglobulin also include second Chain；
Second reverse transcription (RT) primer, the second reverse transcription (RT) primer have respectively to encoding the T cell receptor or exempt from The part of constant section (CS) specificity of the RNA of the second chain of epidemic disease globulin；
Wherein the first RT primer and the 2nd RT primer respectively additionally comprise the first nucleotide label, first nucleosides Acidity scale label include the first primer binding site for the first DNA sequencing primer, and the first nucleotide label is special in the CS The 5' of specific portions；With
First bar code primer, the first bar code primer is from 3' to 5' comprising to the first primer binding site specificity Part, the first bar code nucleotide sequence and first sequencing adapter；
A variety of first amplimers, every kind of first amplimer have to the institute for encoding the T cell receptor or immunoglobulin The difference for stating the RNA of the first chain can be changed the part of section (VS) specificity；
A variety of second amplimers, every kind of second amplimer have respectively to the coding T cell receptor or immunoglobulin Second chain the RNA difference can be changed section (VS) specificity part；
Wherein first amplimer and second amplimer respectively additionally comprise the second nucleotide label, and described second Nucleotide label includes the second primer binding site for the second DNA sequencing primer, and the second nucleotide label is described The 5' of VS specificity portion；With
Second bar code primer, the second bar code primer is from 3' to 5' comprising to the second primer binding site specificity Part, the second bar code nucleotide sequence and second sequencing adapter.
14. it is a kind of for generating the primer combination of DNA profiling from the RNA of encoding T cell receptor or immunoglobulin chain, it is described to draw Object combination includes:
First reverse transcription (RT) primer, the first reverse transcription (RT) primer have to encoding T cell receptor or immunoglobulin The first chain RNA constant section (CS) specificity part, the T cell receptor or immunoglobulin also include second Chain；
Second reverse transcription (RT) primer, the second reverse transcription (RT) primer have respectively to encoding the T cell receptor or exempt from The part of constant section (CS) specificity of the RNA of second chain of epidemic disease globulin；
Wherein the first RT primer and the 2nd RT primer respectively additionally comprise the first nucleotide label, first nucleosides Acidity scale label include the first primer binding site for the first DNA sequencing primer, and the first nucleotide label is special in the CS The 5' of specific portions；With
First bar code primer, the first bar code primer is from 3' to 5' comprising to the first primer binding site specificity Part, the first bar code nucleotide sequence and first sequencing adapter；
5' oligonucleotides, the 5' oligonucleotides from 5 ' to 3 ' include the second primer knot for the second DNA sequencing primer Coincidence point, unique molecular identifier (UMI) and widow's-riboG sequence；With
Second bar code primer, the second bar code primer is from 3' to 5' comprising to the second primer binding site specificity Part, the second bar code nucleotide sequence and second sequencing adapter.
15. a kind of kit, the kit includes the combination of primer described in claim 13 or claim 14 and matrix type Microfluidic device, the matrix type microfluidic device includes:
With the capture site of R row and the C matrix arrangement arranged, wherein R and C is greater than 1 integer, and is wherein assigned in cell Behind the capture site, the capture site can be fluidly isolated from one another；
One group of R first input line, one group of R the first input lines are configured to for the first reagent being delivered in particular row Capture site；
One group of C second input line, one group of C the second input lines are configured to for the second reagent being delivered in particular column Site is captured, wherein the delivering is separated with the first reagent of delivering,
It wherein, after the reaction, can be from being recycled in the pond of the reaction product from each row or respectively arranged in the microfluidic device Reaction product.
CN201780044623.0A 2016-07-14 2017-07-12 Unicellular transcript sequencing Pending CN109661474A (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201662362425P 2016-07-14 2016-07-14
US62/362,425 2016-07-14
US201762463487P 2017-02-24 2017-02-24
US62/463,487 2017-02-24
PCT/US2017/041770 WO2018013723A1 (en) 2016-07-14 2017-07-12 Single-cell transcript sequencing

Publications (1)

Publication Number Publication Date
CN109661474A true CN109661474A (en) 2019-04-19

Family

ID=60951893

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201780044623.0A Pending CN109661474A (en) 2016-07-14 2017-07-12 Unicellular transcript sequencing

Country Status (5)

Country Link
EP (1) EP3485043A4 (en)
CN (1) CN109661474A (en)
CA (1) CA3027423A1 (en)
SG (1) SG11201811048UA (en)
WO (1) WO2018013723A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113950527A (en) * 2019-06-03 2022-01-18 吴迪 Method for creating a cDNA sequencing library
CN114302643A (en) * 2019-06-14 2022-04-08 伯乐实验室有限公司 System and method for automated single cell processing and analysis
WO2022121742A1 (en) * 2020-12-07 2022-06-16 中国科学院脑科学与智能技术卓越创新中心 Single cell transcriptome sequencing method

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2010232439C1 (en) 2009-04-02 2017-07-13 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
SG10201605049QA (en) 2011-05-20 2016-07-28 Fluidigm Corp Nucleic acid encoding reactions
US10466160B2 (en) 2011-08-01 2019-11-05 Celsee Diagnostics, Inc. System and method for retrieving and analyzing particles
EP2739587B1 (en) 2011-08-01 2020-05-27 Denovo Sciences Cell capture system
US9404864B2 (en) 2013-03-13 2016-08-02 Denovo Sciences, Inc. System for imaging captured cells
US9606102B2 (en) 2013-01-26 2017-03-28 Denovo Sciences, Inc. System and method for capturing and analyzing cells
US9707562B2 (en) 2013-03-13 2017-07-18 Denovo Sciences, Inc. System for capturing and analyzing cells
US10391490B2 (en) 2013-05-31 2019-08-27 Celsee Diagnostics, Inc. System and method for isolating and analyzing cells
US9856535B2 (en) 2013-05-31 2018-01-02 Denovo Sciences, Inc. System for isolating cells
EP3390658B1 (en) 2015-12-16 2022-08-03 Standard BioTools Inc. High-level multiplex amplification
US10391493B2 (en) 2017-08-29 2019-08-27 Celsee Diagnostics, Inc. System and method for isolating and analyzing cells
CN114302966A (en) * 2019-03-12 2022-04-08 通用测序技术公司 Method for capturing single cell in cell and application thereof
US10633693B1 (en) 2019-04-16 2020-04-28 Celsee Diagnostics, Inc. System and method for leakage control in a particle capture system
US11273439B2 (en) 2019-05-07 2022-03-15 Bio-Rad Laboratories, Inc. System and method for target material retrieval from microwells
CN114072490A (en) 2019-05-07 2022-02-18 伯乐实验室有限公司 System and method for automated single cell processing
WO2021030716A1 (en) * 2019-08-14 2021-02-18 iRepertoire, Inc. Probe-capture method for tcr alpha and beta chain vdj-recovery from oligo-dt reverse transcribed rna
US11504719B2 (en) 2020-03-12 2022-11-22 Bio-Rad Laboratories, Inc. System and method for receiving and delivering a fluid for sample processing
EP4133102A1 (en) * 2020-04-07 2023-02-15 Vaccim Device and method for determining, from a sample previously collected from an individual, that at least one target antibody has been or is present in said individual
KR20230021697A (en) * 2020-06-09 2023-02-14 심센 다이아그노스틱스 에이비 Determination of lymphocyte clonality

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060040283A1 (en) * 2001-04-11 2006-02-23 The Gov. Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services Methods of manipulating nucleic acids
US20100273219A1 (en) * 2009-04-02 2010-10-28 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
US20140308669A1 (en) * 2011-01-24 2014-10-16 Epic Science, Inc. Methods for obtaining single cells and applications of single cell omics
CN104619862A (en) * 2012-06-15 2015-05-13 得克萨斯系统大学董事会 High throughput sequencing of multiple transcripts of a single cell
WO2016044227A1 (en) * 2014-09-15 2016-03-24 Abvitro, Inc. High-throughput nucleotide library sequencing

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2861761A1 (en) * 2012-06-15 2015-04-22 Adaptive Biotechnologies Corporation Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set
WO2016100977A1 (en) * 2014-12-19 2016-06-23 The Broad Institute Inc. Methods for profiling the t-cel- receptor repertoire

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060040283A1 (en) * 2001-04-11 2006-02-23 The Gov. Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services Methods of manipulating nucleic acids
US20100273219A1 (en) * 2009-04-02 2010-10-28 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
US20140308669A1 (en) * 2011-01-24 2014-10-16 Epic Science, Inc. Methods for obtaining single cells and applications of single cell omics
CN104619862A (en) * 2012-06-15 2015-05-13 得克萨斯系统大学董事会 High throughput sequencing of multiple transcripts of a single cell
WO2016044227A1 (en) * 2014-09-15 2016-03-24 Abvitro, Inc. High-throughput nucleotide library sequencing

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ARNOLD HAN等: "Linking T-cell receptor sequence to functional phenotype at the single-cell level", 《NAT BIOTECHNOL》 *
ELLIOT R. THOMSEN等: "Fixed single-cell transcriptomic characterization of human radial glial diversity", 《NAT METHODS》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113950527A (en) * 2019-06-03 2022-01-18 吴迪 Method for creating a cDNA sequencing library
CN114302643A (en) * 2019-06-14 2022-04-08 伯乐实验室有限公司 System and method for automated single cell processing and analysis
CN114302643B (en) * 2019-06-14 2024-02-27 伯乐实验室有限公司 Systems and methods for automated single cell processing and analysis
WO2022121742A1 (en) * 2020-12-07 2022-06-16 中国科学院脑科学与智能技术卓越创新中心 Single cell transcriptome sequencing method

Also Published As

Publication number Publication date
CA3027423A1 (en) 2018-01-18
WO2018013723A1 (en) 2018-01-18
EP3485043A4 (en) 2020-03-25
WO2018013723A9 (en) 2019-03-28
EP3485043A1 (en) 2019-05-22
SG11201811048UA (en) 2019-01-30

Similar Documents

Publication Publication Date Title
CN109661474A (en) Unicellular transcript sequencing
US10954560B2 (en) Single-cell nucleic acids for high-throughput studies
CN108368503A (en) Method for controlled dn A fragmentations
CN110050067A (en) Generate the method for the double stranded DNA through expanding and composition and kit for the method
CN108350499A (en) Can transformation marker composition, method and combine its process
US8785130B2 (en) Use of markers including nucleotide sequence based codes to monitor methods of detection and identification of genetic material
CN107075509A (en) Determined by the haplotype group for digitizing transposons
CN105339503A (en) Transposition into native chromatin for personal epigenomics
Lehoux et al. Defined oligonucleotide tag pools and PCR screening in signature-tagged mutagenesis of essential genes from bacteria
CN110199022A (en) Prepare the method for nucleic acid library and composition and kit for implementing the method
CN110869515B (en) Sequencing method for genome rearrangement detection
CN108603224A (en) High level multiplexing amplification
CN107075566A (en) For preparing the isothermal method of nucleic acid and compositions related
CN115176026A (en) Method for sequencing RNA oligonucleotides
US20220333170A1 (en) Method and apparatus for simultaneous targeted sequencing of dna, rna and protein
CN112654714A (en) Primer oligonucleotides for sequencing
US20200392589A1 (en) Methods and systems for proteomic profiling and characterization
Duftner et al. Efficacy of RNA amplification is dependent on sequence characteristics: implications for gene expression profiling using a cDNA microarray
US20200325522A1 (en) Method and systems to characterize tumors and identify tumor heterogeneity
JP5110423B2 (en) Microbe identification method, primer used in the method, and identification kit
AU2339199A (en) Methods for identifying therapeutic targets
CN114921533A (en) Methods and adaptors for characterising a target polynucleotide
Pace et al. Phylogenetic Analysis of Marine Picoplankton Using rRNA Sequences
JP2005218301A (en) Method for base sequencing of nucleic acid
WO2005010184A1 (en) Method of detecting mutation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination