CN109628421B

CN109628421B - Glycosyl transferase for specifically synthesizing furanone glucoside and application thereof

Info

Publication number: CN109628421B
Application number: CN201910025135.6A
Authority: CN
Inventors: 宋传奎; 陈永先
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2019-01-11
Filing date: 2019-01-11
Publication date: 2022-11-01
Anticipated expiration: 2039-01-11
Also published as: CN109628421A

Abstract

The invention discloses glycosyltransferase for specifically synthesizing furanone glucoside and application thereof, wherein the amino acid sequence of the glycosyltransferase is shown as SEQ ID No. 1. The nucleotide sequence of the gene UGT10 for coding the glycosyltransferase shown in SEQ ID No.1 is shown in SEQ ID No. 2. The invention utilizes UGT10 coded protein to specifically and efficiently catalyze the generation of furanone and the derivative glucoside thereof. Provides a specific and efficient biosynthesis method for the production of furanone and glucoside which is a derivative of the furanone.

Description

Glycosyl transferase for specifically synthesizing furanone glucoside and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to glycosyltransferase for specifically synthesizing furanone glucoside and application thereof.

Background

Furanone (4-hydroxy-2,5-dimethyl-3 (2H) -furanone, furaneol, DMHF), also known as bromelain or strawberry ketone. It is a very important aroma, has a strong roasting caramel aroma, and is characterized by fruity, burnt, caramel and pineapple-like aroma. Since furanones were first identified in ether extracts of pineapple juice by j.o.rodin et al in 1965, due to their low aroma threshold, pleasant aroma and significant flavoring effect, great interest was generated in synthesizers and more favored by flavor researchers. The furanone is a natural safe spice with wide application, and is widely applied to the industries of food, beverage, tobacco, health-care products and the like. Furanones have an irreplaceable position in the Chinese perfumery industry, are excellent sweet flavors and aromas, and are safe flavors commonly accepted by the American Association of flavorants manufacturers (FEMA No. 3134) and the European council (COE No. 536).

Furanone is also an important aromatic substance in plants, and is an important component in the flavors of strawberries, grapes and tea. Research has shown that furanone is the most critical of the 15 aroma actives that actually contribute to strawberry flavor. Meanwhile, the grape wine is also an important aroma component for preparing the grape wine from certain grape varieties. In addition, furanone is also an important component of some aroma of tea. In recent years, research shows that furanone is an important component of sweet aroma in jasmine tea and oolong tea and sweet aroma and caramel aroma in characteristic flavor generated by baking tea leaves and stems.

Research shows that in plants, furanone exists stably in plants in a glucoside formed by an unknown glycosyltransferase catalyzed glycosylation reaction. Compared with free aroma substances, the aroma glycoside has more stable property and stronger water solubility, has multiple important biological functions, and has great commercial value in the fields of cosmetics, foods and drug development. The aroma glycoside is mainly synthesized from UGT through glycosylation catalysis. Glycosidation is one of the most important modification reactions of plant secondary metabolism, has important effects in regulating plant cell metabolic balance, removing exogenous toxin toxicity, maintaining normal growth and development of plants, and can improve fragrance components of plants through metabolic engineering.

At present, the synthesis of the aroma glucoside is mainly realized by two means of chemistry and biology, and the biosynthesis has no pollution to the environment due to the use of enzyme or engineering bacteria for conversion at normal temperature, has strong selectivity to a para-position, single product, no need of an external catalyst, safety and reliability, and has great potential in functional foods. However, the biosynthesis method of various aroma glycoside is not mature at present, and related research on furanone glycoside is few. The reported glycosyltransferase related to furanone cannot specifically and efficiently catalyze the generation of furanone glucoside, most of the glycosyltransferase can widely utilize substrates, and the furanone glucoside synthesis capability is weak.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: how to provide glycosyltransferase and coding gene for synthesizing furanone and derivatives thereof glucoside, and solve the problem of biosynthesis of the furanone and the derivatives thereof glucoside.

The technical scheme of the invention is as follows:

a glycosyl transferase for synthesizing furanone and its derivative glucoside has amino acid sequence shown in SEQ ID No. 1.

The nucleotide sequence of the gene UGT10 for coding the glycosyltransferase shown in SEQ ID No.1 is shown in SEQ ID No. 2.

An expression vector comprising the nucleotide sequence shown as SEQ ID No. 2.

Application of glycosyltransferase shown in SEQ ID No.1 or gene UGT10 shown in SEQ ID No.2 in synthesis of furanone and its derivative glucoside.

A method for synthesizing furanone and glucoside of derivatives thereof comprises the following steps:

(1) Carrying out PCR by taking tea tree cDNA as a template and taking nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 as primers to obtain a gene UGT10 shown in SEQ ID No. 2;

(2) Prokaryotic expression is carried out on the gene UGT10 obtained in the step (1);

(3) Separating and purifying to obtain glucosyltransferase with amino acid sequence shown as SEQ ID No. 1;

(4) Using furanone or furanone derivative as a substrate, and carrying out catalytic reaction by using glycosyltransferase shown in SEQ ID No.1 to obtain furanone glucoside or furanone derivative glucoside.

Further, the furanone derivative is 2-ethyl-4-hydroxy-5-methyl-3 (2H) -furanone or monomethyl furanone.

Further, the conditions of the catalytic reaction are as follows: the temperature is 25-35 ℃, and the pH value is 6.5-10.

Preferably, the conditions of the catalytic reaction are: the temperature is 30 ℃ and the pH value is 8.5.

Compared with the prior art, the invention has the following beneficial effects:

the invention utilizes UGT10 coded protein to specifically and efficiently catalyze the generation of furanone and the derivative glucoside thereof. Provides a specific and efficient biosynthesis method for the production of furanone and glucoside which is a derivative of the furanone.

Drawings

FIG. 1: screening aroma substrates;

FIG. 2: enzyme activity data of different reaction times;

FIG. 3: enzyme activity data at different pH values;

FIG. 4: enzyme activity data at different temperatures;

FIG. 5: is a flow chart for obtaining furanone and derivative glucoside thereof.

Detailed Description

1. UGT10 gene

A gene related to glycosyltransferase is found in the genome of tea trees, the protein coded by the gene can specifically utilize furanone and derivatives thereof to generate furanone and derivatives thereof, glucoside of the furanone and derivatives thereof is named UGT10, and the CDS sequence of the gene is shown in SEQ ID No. 2.

2. Cloning of UGT10 Gene

A primer is designed through SnapGene Viewer software according to the CDS of UGT10, cDNA of tea trees is used as a template, a target gene is cloned through high-fidelity enzyme, and then glue recovery is carried out through a commercialized kit to obtain a single target gene.

Obtaining a cDNA template: fresh tea leaves are treated and ground by liquid nitrogen, extracted by a commercial plant RNA extraction kit, and then subjected to reverse transcription by a commercial reverse transcription kit to obtain cDNA.

Primer sequence of UGT10 gene:

UGT10F：GGATCTGGTTCCGCGTGGATCCATGGAGACACCAAACAGAGC(SEQ ID No.3)

UGT10R：GCTCGAGTCGACCCGGGTTAGGATCGCACTAATTCAGCTAC(SEQ ID No.4)

reaction system:

reaction procedure:

3. construction of recombinant plasmid pGEX4T1-UGT10

And carrying out double enzyme digestion on the complete pGEX4T1 vector as required to obtain a linear vector, and then recovering the vector through a commercialized kit gel to obtain a purified linear vector. Connecting a single target gene with a linear vector by using ligase to construct a recombinant plasmid pGEX4T1-UGT10, then converting the recombinant plasmid into Trans1-T1 competent cells for overnight culture, selecting positive bacterial plaques to transfer into an LB (lysogeny broth) culture medium, and after colony PCR (polymerase chain reaction) verification, sending a bacterial liquid to a general biology limited company to complete sequencing work.

4. Prokaryotic expression and purification of UGT10 gene

And transforming the successfully constructed expression vector pGEX4T1-UGT10 into BL21 competent cells for overnight culture, selecting positive bacterial plaques, transferring the positive bacterial plaques into an LB culture medium for overnight culture at 37 ℃, and carrying out expanded culture at 37 ℃ until OD600= 0.6-0.8. After cooling to 16-18 ℃ 1M IPTG was added and induced overnight in a 16 ℃ incubator. The following day colonies were collected by centrifugation, sonicated, and the protein purified according to literature optimized glycosyltransferases (Song C, hong X, zoho S, et al. Glycosylation of 4-Hydroxy-2,5-Dimethyl-3 (2H) -Furanone, key Strawberry Flavor company in Strawberry Fruit [ J ]. Plant Physiol.171 (1): 139-151 Song C, ring L, hoffmann T, et al. Acylphtaluron biosyntheses in Strawberry Fruit J. Plant Physiol.2015,169 (3): 1656-1670 Song C, gu L, liu J, functional. Culture modification J. And protein detection [ SDS ] and protein J.) (protein of protein family; SDS, protein family J.). The amino acid sequence of the protein is shown as SEQ ID No. 1.

5. Aroma substrate screening

The purified proteins were subjected to aroma Substrate screening and activity measurements were determined by reference to the laboratory optimized method (Song C, ring L, hoffmann T, et al, acylphthalafloroxicol Biosynthesis in Strawberry Fruit [ J ]. Plant physiology.2015, 169 (3): 1656-1670.

Reaction system for screening aroma substrates:

control system for aroma substrate screening:

Tris-HCl pH＝7.5(50mM)4.6ul

DTT(50mM) 0.2ul

UDPG(2.5mM) 0.2ul

the aroma substrates used were: furanone, 2-ethyl-4-hydroxy-5-methyl-3 (2H) -furanone, monomethyl furanone, eugenol, vanillic acid, mandelonitrile, salicylic acid, oxidized aromatic alcohol, 1-naphthol, farnesol, nerol, sorbic acid, and the like.

UGT10 encodes proteins that are found to specifically catalyze furanones, 2-ethyl-4-hydroxy-5-methyl-3 (2H) -furanones, monomethyl furanones to furanone glucosides, 2-ethyl-4-hydroxy-5-methyl-3 (2H) -furanone glucosides, and monomethyl furanone glucosides. The relative activity is shown in FIG. 1.

6. Product identification

Extracting the reaction product in the reaction system by using ethyl acetate, concentrating the supernatant, dissolving the supernatant by using methanol, filtering the dissolved solution, and directly analyzing by using LC-MS/MS. Full wavelength scanning is used, the sample volume is 2ul, the flow rate is 1.0mL/min, the mobile phase is water and methanol, and the identification method refers to the laboratory optimization method (Song C, hong X, ZHao S, et al. Glycosylation of 4-Hydroxy-2,5-Dimethyl-3 (2H) -furan, the Key Strawberry liquid company in Strawberry front [ J ]. Plant physiol.2016,171 (1): 139-151).

7. UGT10 in vitro enzyme kinetic assay

The difference of enzyme activity of the protein coded by UGT10 gene and furanone in vitro reaction under different reaction time, temperature and pH is researched, and the most reactive optimal condition is optimized. Under the optimal conditions, the substrate concentration is changed, and enzyme kinetic experiments are carried out, so that Km and Vm of the enzyme are obtained. The reaction system for optimizing different reaction time, temperature and pH is as follows:

the enzyme activity data of different reaction time, different pH and different temperature are shown in FIG. 2, FIG. 3 and FIG. 4 respectively.

According to the optimum temperature (30 ℃), the optimum pH value (8.5) and the reaction time of 10min, the enzyme kinetic parameters are obtained

TABLE 1 enzyme kinetic parameters

8. Synthesis of furanone and its derivative glycoside

As can be seen from the above description and data, the protein encoded by UGT10 can specifically and efficiently catalyze the generation of furanone and derivatives of furanone glycoside. Scheme for obtaining furanone and its derivative glucoside is shown in FIG. 5.

Sequence listing

<110> agriculture university in Anhui

<120> glycosyltransferase for specifically synthesizing furanone glucoside and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 458

<212> PRT

<213> tea plant (Camellia sinensis)

<400> 1

Met Glu Thr Pro Asn Arg Ala Tyr Lys Ala His Val Leu Val Leu Pro

1 5 10 15

Tyr Pro Ala Gln Gly His Ile Asn Pro Met Leu Gln Phe Ser Lys Arg

20 25 30

Leu Val Ala Arg Gly Val Lys Ala Thr Leu Ala Asn Ser Val Tyr Ile

35 40 45

Ser Lys Ser Met His Lys Asp Gln Ile Ser Thr Ile Asp Thr Asp Thr

50 55 60

Phe Ser Asp Gly His Asp Asp Gly Gly Tyr Asp Asn Ala Glu Asn Pro

65 70 75 80

Glu Ala Tyr Leu Thr Lys Leu Arg Asp Val Gly Ser Arg Thr Leu Ala

85 90 95

Ser Leu Ile Glu Lys Leu Asn Gly Leu Gly Arg Pro Val Asp Ala Leu

100 105 110

Ile Tyr Asp Gly Phe Leu Pro Trp Ala Leu Asp Val Ala Lys Glu Leu

115 120 125

Gly Ile Leu Gly Val Val Phe Phe Thr Gln Thr Cys Ala Val Asn Ser

130 135 140

Ile Tyr Tyr His Val His Glu Gly Leu Leu Ser Leu Pro Leu Ser Pro

145 150 155 160

Asp Ser Thr Ile Leu Leu Pro Gly Leu Pro Pro Leu Glu Ser Cys Glu

165 170 175

Thr Pro Ser Phe Val Tyr Ala Tyr Gly Leu His Pro Ser Phe Tyr Asp

180 185 190

Leu Leu Val Asn Gln Phe Ser Asn Val Asp Lys Ala Asp Trp Val Leu

195 200 205

Phe Asn Thr Phe Tyr Glu Leu Glu Lys Glu Val Val Asp Trp Met Ser

210 215 220

Lys Leu Trp Arg Val Arg Thr Ile Gly Pro Thr Leu Pro Ser Met Tyr

225 230 235 240

Leu Asp Gln Lys Leu Lys Asp Asp Ile Asp Tyr Gly Ile Asn Leu Phe

245 250 255

Lys Pro His Ser Thr Val Cys Met Asn Trp Leu Asn Ala Lys Pro Ser

260 265 270

Ser Ser Val Val Tyr Val Ser Phe Gly Ser Met Ala Gln Phe Glu Pro

275 280 285

Glu Gln Met Glu Glu Ile Ala Trp Gly Leu Asn Gln Ser Asn Tyr Asn

290 295 300

Phe Leu Trp Val Val Arg Ala Thr Glu Glu Ala Lys Leu Pro Asn Asn

305 310 315 320

Phe Ile Asn Asp Thr Ala Glu Lys Gly Leu Val Val Thr Trp Ser Pro

325 330 335

Gln Leu Glu Val Leu Ala His Glu Ser Ile Gly Cys Phe Val Thr His

340 345 350

Cys Gly Phe Asn Ser Val Leu Glu Ala Leu Ser Leu Gly Val Pro Met

355 360 365

Val Gly Val Pro Tyr Trp Ser Asp Gln Ala Thr Asn Ala Lys Phe Val

370 375 380

Glu Asp Val Trp Gly Ile Gly Ile Arg Ala Lys Met Asp Asp Lys Gly

385 390 395 400

Ile Val Arg Arg Glu Val Leu Glu Ala Cys Met Lys Glu Val Phe Glu

405 410 415

Gly Lys Lys Lys Asn Glu Val Lys Met Asn Ala Met Lys Trp Lys Lys

420 425 430

Leu Ala Lys Glu Ala Leu Gly Asp Gly Gly Ser Ser Asp Lys Asn Ile

435 440 445

Asp Glu Phe Val Ala Glu Leu Val Arg Ser

450 455

<210> 2

<211> 1377

<212> DNA

<213> tea plant (Camellia sinensis)

<400> 2

atggagacac caaacagagc ctacaaagcc catgttctag tcctacccta ccctgcccaa 60

gggcacatca acccaatgct tcaattctcc aagcgcttgg tagctagagg tgtcaaggcc 120

actcttgcca acagtgttta tatctccaag tccatgcaca aggaccaaat cagcaccatc 180

gacactgaca cgttttccga cggacacgac gatggcggct acgacaacgc cgaaaatccc 240

gaagcctatc tgaccaaatt acgcgacgtt ggatcgcgga ctctggccag tctcatcgag 300

aaactcaatg ggcttggccg accagtcgat gccctaattt atgatgggtt tttgccttgg 360

gctcttgatg ttgccaagga gttaggaata cttggagttg tgtttttcac tcagacttgt 420

gctgtcaata gcatatatta tcatgtgcac gagggtcttc tttcactccc actttcacca 480

gattcaacta ttttgttgcc tggattgcca ccacttgagt cctgtgaaac gccatcgttt 540

gtgtatgctt atgggttgca tccaagtttc tatgacttgt tggtgaatca attcagtaac 600

gttgataaag cagattgggt cctttttaat actttctacg aattggagaa agaggtggta 660

gattggatgt caaaactatg gcgggtgaga acaataggcc caacacttcc atccatgtac 720

ttagatcaga aactcaaaga tgacatagat tatggcatca atctcttcaa gcctcactcc 780

actgtgtgca tgaactggct aaatgccaag ccaagcagct ctgtcgttta cgtatccttt 840

ggcagcatgg cccaatttga acccgaacaa atggaagaaa tagcatgggg cttaaaccaa 900

agcaattaca acttcttgtg ggtcgtgagg gcaaccgaag aagccaagct accaaacaac 960

ttcatcaatg acacagccga gaagggcttg gtggtgacat ggagtccaca gctagaggtg 1020

ttggcacacg agtcaatagg ttgctttgtc acgcattgtg ggttcaactc tgttcttgag 1080

gcactgagct tgggtgtgcc aatggttggt gttccatatt ggtcggacca agctacgaat 1140

gctaagtttg tggaggatgt ttggggtata ggaattaggg ctaagatgga tgataagggt 1200

attgtcagga gggaagtgtt ggaggcttgc atgaaggagg tgtttgaagg aaaaaagaaa 1260

aatgaagtta agatgaatgc aatgaaatgg aaaaaattgg cgaaagaggc gcttggtgat 1320

ggtgggagtt cagacaagaa catcgatgaa ttcgtagctg aattagtgcg atcctaa 1377

<210> 3

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggatctggtt ccgcgtggat ccatggagac accaaacaga gc 42

<210> 4

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctcgagtcg acccgggtta ggatcgcact aattcagcta c 41

Claims

1. A glycosyl transferase for synthesizing furanone and its derivative glucoside has amino acid sequence shown in SEQ ID No. 1.

2. The nucleotide sequence of the gene UGT10 for coding the glycosyltransferase shown in SEQ ID No.1 is shown in SEQ ID No. 2.

3. An expression vector comprising the nucleotide sequence shown as SEQ ID No. 2.

5. A method for synthesizing furanone or a derivative glucoside thereof is characterized by comprising the following steps:

(4) Using furanone or furanone derivative as a substrate, and performing catalytic reaction by using glycosyltransferase shown in SEQ ID No.1 to obtain furanone glucoside or furanone derivative glucoside.

6. The method of claim 5, wherein the furanone derivative is 2-ethyl-4-hydroxy-5-methyl-3 (2H) -furanone or monomethyl furanone.

7. The method for synthesizing furanone or its derivative glucoside according to claim 5, wherein the conditions of catalytic reaction are as follows: the temperature is 25-35 ℃, and the pH value is 6.5-10.

8. The method for synthesizing furanone and glucoside derivatives thereof according to claim 7, wherein the conditions of the catalytic reaction are as follows: the temperature is 30 ℃ and the pH value is 8.5.