CN115820702A

CN115820702A - Method for efficiently preparing abienol by catalyzing isopentenol through recombinant escherichia coli resting cells

Info

Publication number: CN115820702A
Application number: CN202211494822.0A
Authority: CN
Inventors: 杨雪鹏; 王光路; 刘兰茜; 胡仙妹; 钟桂芳; 王冰洋; 王梦圆; 李乾
Original assignee: Zhengzhou University of Light Industry
Current assignee: Zhengzhou University of Light Industry
Priority date: 2022-11-26
Filing date: 2022-11-26
Publication date: 2023-03-21

Abstract

The abienol is degraded to generate ambergris fragrant substances, can improve the fragrance quality of tobacco, and is widely applied to the perfume industry. The invention develops a novel method for preparing the abienol by catalyzing the resting cells with low cost and high efficiency. The recombinant Escherichia coli is obtained by knocking out dephosphorylation enzyme coding genes phoA, ybjG, pgpB and outer membrane lipoprotein coding gene nlp I, constitutively overexpressing fatty acid metabolism transcription regulator coding gene fadR and glycerol metabolism operon gene glpFK, overexpressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional diphosphate farnesyl synthase, geranylgeranyl diphosphate synthase, labdanum-13-en-8-ol diphosphate synthase and abienol synthase. The resting cell catalysis process can catalyze 3.0g/L of isopentenol to generate 1.80g/L of abienol within 24 hours, and the conversion rate reaches 71.15 percent, which is far higher than the level reported in the current literature and patents. The resting cells can be reused for 5-6 times, the operation is simple, the economy is good, and the method has better potential for preparing the abienol on a large scale compared with a fermentation method.

Description

Method for efficiently preparing abienol by catalyzing isopentenol through recombinant escherichia coli resting cells

Technical Field

The invention relates to a method for efficiently preparing abienol by catalyzing isopentenol through recombinant escherichia coli resting cells, and belongs to the field of bioengineering.

Background

Terpenoids are ubiquitous plant secondary metabolites and are also the most important aroma components of tobacco. Especially diterpene enol compounds in the tobacco, mainly comprising cembrenol and labdanol compounds, have important influence on the aroma quality of the tobacco; the content difference has obvious correlation with the quality characteristics of different types of tobacco, and the degradation products are all representative tobacco flavor substances. In aromatic cigarettes, the labdane is a common diterpene enolic compound, wherein cis-abienol is a unique aroma precursor in most aromatic cigarettes and partial cigars, has an important effect on the aroma characteristics of the tobaccos, is degraded to generate a substance with strong ambergris aroma, is very effective in increasing the aroma and smoking taste of the cigarettes, is harmoniously matched with the characteristic aroma of the tobaccos, can cover up offensive odor, can improve the aroma quality of the tobaccos even if being used in a trace amount, is particularly suitable for flavoring mixed cigarettes and is commonly used for cigarette extractum. Cis-abienol, as a semisynthetic precursor of amber ambergris, is widely used in the perfume industry because of its elegant fragrance, good fixative effect and influence on smoke quality. At present, the characteristic flavor precursor of the tobacco, namely the abienol, is extracted from tobacco leaves rich in the abienol by adopting an extraction method, and the content of the abienol in the tobacco leaves is low, and the abienol is limited by the acquisition of tobacco raw materials, so that the method becomes a bottleneck for restricting the large-scale application of the extraction method. In recent years, with the rapid development of synthetic biology, the microbial fermentation method has become a research hotspot for the synthesis of abienol, and documents and patents have reported that the abienol is biosynthesized by the microbial fermentation method by using glucose or glycerol as a substrate. But because the substrate glycerol or glucose is taken as the substrate to participate in a plurality of reactions of cells at the same time, the synthesis efficiency is still low although the allogenetic synthesis path and the supply of precursors of the abienol are enhanced. Li et al, by enhancing the allosynthetic Pathway and precursor supply of Abienol, fermentatively cultured the engineered strains in a 1.3L fermentor for about 100h with an Abienol yield of-634.7 mg/L (Li.et al (2019). Combinative Engineering of Mevalonate Pathway and diverse Synthases in Escherichia coli for cis-Absienol production. Journal of Agricultural and Food Chemistry,67 (23), 6523-6531.). Engineering strains were similarly obtained by Cheng et al by enhanced precursor supply, with fermentation culture for 52h Abienol yields of 220mg/L, and lower yields (Cheng.et al (2020). Zhang et al biologically ferments and synthesizes abienol with isopentenol as a substrate, ferments in a 1.3L fermenter for about 144h, converts the substrate 6.8g/L to synthesize 1375.7mg/L abienol, greatly improves the yield, but has overlong overall fermentation time and only 24.1% of substrate conversion rate (Zhang. Et al. (2022). Therefore, the yield of the abienol synthesized by the existing microbial fermentation method is still low, and the synthesis level is not ideal enough. Because the fermentation process adopts an organic relative fermentation system for extraction, the extraction product can be doped with a large amount of fat-soluble substances (such as fat-soluble components in a culture medium, fat-soluble cell contents, fat-soluble cell metabolites and the like) from the fermentation liquor except the abienol, which brings difficulty to subsequent separation, purification and application. Therefore, it is highly desirable to develop a method for synthesizing abienol with high yield, low cost and high efficiency.

The resting cell biological catalysis is widely applied to the synthesis of various high value-added chemicals, and the method utilizes a complete multi-enzyme system in cells to realize biological conversion. Compared with a fermentation method, the method has the following advantages: firstly, the resting cells have better operability and economy than the fermentation method; secondly, the resting cells have better stability, can be repeatedly used for carrying out multiple times of biotransformation, have small activity loss, and can also be catalyzed in an immobilized cell form, so that the production cost is further saved; finally, resting cells are more tolerant to substrates and products than fermentation processes. In particular, the presence of intermediary metabolites (such as isopentenyl diphosphate (IPP) and farnesyl diphosphate (FPP)) in the abienol anabolic pathway, which are highly toxic to cells, affects strain growth and is not conducive to abienol fermentative synthesis. The resting cells separate the strain culture stage from the abienol catalytic synthesis stage, so that the growth inhibition of toxic substrates and intermediate metabolites on the strains is avoided. These properties indicate that resting cell biocatalysis is more suitable for the large-scale preparation of abienol than fermentation. The invention innovatively provides a novel method for efficiently preparing abienol by resting cell biocatalysis.

Disclosure of Invention

Aiming at the problems of the existing method for synthesizing abienol by a fermentation method, such as long fermentation period, low yield, complicated separation and purification steps and the like, the invention aims to provide a preparation method by utilizing resting cells of recombinant escherichia coli.

The method has the advantages of recycling of resting cells, simple process, low production cost, high conversion rate and the like.

In order to achieve the purpose, the invention adopts the technical scheme that:

a preparation method of recombinant escherichia coli resting cells is characterized in that phosphatase encoding genes phoA, ybjG and pgpB and an outer membrane lipoprotein encoding gene nlp I in an escherichia coli host are knocked out, constitutive overexpression of a fatty acid metabolism transcription regulator encoding gene fadR is knocked out, constitutive overexpression of a glycerol metabolism operon is knocked out due to glpFK, and an escherichia coli engineering strain LSC-06 is constructed; constructing an escherichia coli engineering strain LSC-07 for co-expressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional diphosphate farnesyl synthase, geranylgeranyl diphosphate synthase, labdanum-13-ene-8-ol diphosphate synthase and abienol synthase on the basis of the escherichia coli engineering strain LSC-06; culturing the engineering Escherichia coli strain LSC-07 to obtain recombinant Escherichia coli resting cells.

The construction method of the escherichia coli engineering strain LSC-06 comprises the following steps:

(1) Knock-out of alkaline phosphatase coding gene phoA:

designing donor DNA by taking an Escherichia coli C41 (DE 3) genome as a template, and constructing a phoA gene-knocked-out Escherichia coli engineering strain LSC-01;

(2) Knockout of gene ybjG encoding undecanoate diphosphatase:

designing donor DNA by taking a genome of the escherichia coli engineering strain LSC-01 as a template, and constructing the escherichia coli engineering strain LSC-02 with the ybjG gene knocked out;

(3) Knockout of phosphatidylglycerol phosphatase coding gene pgpB;

designing donor DNA by taking an escherichia coli engineering strain LSC-02 genome as a template, and constructing an escherichia coli engineering strain LSC-03 with pgpB gene knockout;

(4) Knockout of outer membrane lipoprotein encoding gene nlp I

Designing donor DNA by taking an escherichia coli engineering strain LSC-03 genome as a template, and constructing an escherichia coli engineering strain LSC-04 with nlp I gene knockout;

(5) Constitutive overexpression of the transcriptional regulator of fatty acid metabolism encoding the gene fadR

Using Escherichia coli engineering strain LSC-04 genome as template, designing donor DNA, constructing and replacing fatty acid metabolism transcription regulator encoding gene fadR promoter as constitutive strong promoter P _tac The escherichia coli engineering strain LSC-05;

(6) Constitutive overexpression of the glycerol metabolism operon glpFK

Using Escherichia coli engineering strain LSC-05 genome as template, designing donor DNA, constructing glycerol kinase coding gene glpFK promoter as constitutive strong promoter P _tac The engineering strain LSC-06 of Escherichia coli.

The construction method of the escherichia coli engineering strain LSC-07 comprises the following steps:

(1) Constructing a recombinant expression vector pCTI containing a hydroxyethyl thiazole kinase coding gene EcThiM and isopentenyl phosphate kinase MthIPK;

(2) Constructing a recombinant expression vector pAEIG containing a difunctional farnesyl diphosphate synthase coding gene ScERG20, a isopentenyl diphosphate delta-isomerase coding gene ScIDI and a geranylgeranyl diphosphate synthase coding gene TcGGPPS;

(3) Constructing a recombinant expression vector pRCA containing a labdanum-13-alkene-8-alcohol diphosphate synthase coding gene CcCLS and an abienol synthase coding gene NtABS;

(4) And (2) jointly transferring the recombinant expression vectors pCTI, pAEIG and pRCA constructed in the steps (1) to (3) into an escherichia coli engineering strain LSC-06 according to the requirement 1 in a plasmid co-transformation mode, and constructing an escherichia coli engineering strain LSC-07 for simultaneously expressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional diphosphate farnesyl synthase, geranylgeranyl diphosphate synthase, labdanum-13-ene-8-alcohol diphosphate synthase and abienol synthase.

The recombinant escherichia coli resting cells obtained by the preparation method are used for catalyzing isopentenol to prepare abienol.

Respectively adding 1.0-5.0g/L of isopentenol, 20-200g/L of recombinant escherichia coli resting cells and 0-40g/L of glycerol into a 100mL catalytic reaction system, adding a 20mM pH 7.0PB buffer solution until the volume is 100mL, and finally adding 10-20% (v/v) of isopropyl myristate in terms of the total volume of the reaction system; catalytic reaction at 25 deg.c for 12-24 hr to synthesize abienol.

Glycerol was added to a catalytic reaction system of 100mL to a final concentration of 10-40 g/L.

Respectively adding 3.0g/L isopentenol, 100g/L recombinant escherichia coli resting cells and 20g/L glycerol into a 100mL catalytic reaction system, adding a 20mM pH 7.0PB buffer solution until the volume is 100mL, and finally adding isopropyl myristate accounting for 10% (v/v) of the total volume of the reaction system; catalyzing for 24h at 25 ℃ to synthesize the abienol.

And after the reaction is finished, the recombinant escherichia coli resting cells are centrifugally recovered and reused.

The preparation method of the recombinant escherichia coli resting cell is applied to the preparation of abienol by catalyzing isopentenol.

The invention has the beneficial effects that:

since phoA, ybjG and pgpB genes existing in the genome of an Escherichia coli host respectively encode alkaline phosphatase, undecanedioic acid diphosphase and phosphatidylglycerol phosphatase, and all have dephosphorylation activities with wide substrate spectrum, dephosphorylation reactions can be catalyzed for important intermediate metabolites GPP (geranyl diphosphate), FPP (farnesyl diphosphate) and GGPP (geranylgeranyl diphosphate) in the synthesis pathway of abienol to generate geraniol (geraniol), farnesol (farnesesol) and geranylgeraniol (geraniol), respectively. In resting cell catalyzed abienol biosynthesis, the yield of substrate converted abienol is reduced. Therefore, the invention knocks out the coding genes phoA, ybjG and pgpB of the dephosphorylation active enzyme to construct the gene knockout engineering strain.

Because the product abienol has strong lipid solubility, the gene modification is carried out on the coding gene related to the host cell membrane: knockout is carried out on an envelope lipoprotein encoding gene nlp I and a fadR promoter of a fatty acid metabolism transcription regulator encoding gene is replaced to be a constitutive strong promoter P _tac The lipid solubility of cell membranes is enhanced, and the toxic tolerance capability to substrate isoamylene alcohol and product abienol is improved; enhance the synthesis of host cell membrane outer membrane vesicles and improve the substrate of the hostAnd transmembrane transport of the product, which is beneficial to reducing the product inhibition of the catalytic reaction by the abienol.

Because ATP is consumed in the synthesis path of the abienol, the ATP synthesis capacity of resting cells can be enhanced by adding glycerol into a catalytic reaction system, and the requirement of the catalytic synthesis process of the abienol on ATP is met, so that gene modification is carried out on a key operon gene glpFK of a host glycerol metabolic pathway: the E.coli glpFK operon encodes glycerol transporter (GlpF) and glycerol kinase (GlpK). Extracellular glycerol is passively transported into the cell with the aid of the glycerol transporter GlpF and is subjected to glycerol-3-phosphate formation by the action of the glycerol kinase GlpK and further to dehydrogenation to dihydroxyacetone phosphate, which enters the glycolytic pathway and the tricarboxylic acid cycle and undergoes aerobic oxidation to produce ATP (theoretically 18.5mol ATP can be synthesized per 1mol glycerol). Therefore, the replacement of the glpFK promoter, a key operon of glycerol metabolic pathway, by a constitutive strong promoter P was chosen _tac The capacity of host for metabolizing glycerol to generate ATP is strengthened, the energy requirement of abienol synthesis on ATP is met, and the abienol synthesis efficiency is improved.

Coli host bacteria E.coliC41 (DE 3) for knocking out a plurality of enzymes with wide substrate spectrum dephosphorylation activity are firstly constructed, and escherichia coli engineering bacteria for co-expressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional diphosphate farnesyl synthase, geranylgeranyl diphosphate synthase, labdanum-13-ene-8-alcohol diphosphate synthase and abienol synthase are constructed, and fermentation is carried out to obtain resting cells for catalyzing isopentenol to prepare abienol.

The catalytic route of the invention comprises: ATP consumption by the hydroxyethyl thiazole kinase (provided by glycerol metabolism) converts the substrate isopentenol to Dimethylallyl Monophosphate (DMAP); converting DMAP to dimethylallyl Diphosphate (DMAPP) by ATP consumption by isopentenyl phosphate kinase; isomerizing DMAPP to isopentenyl diphosphate (IPP) by isopentenyl diphosphate delta-isomerase; the production of geranyl diphosphate (GPP) and farnesyl diphosphate (FPP) by the catalysis of DMAPP and IPP by bifunctional farnesyl diphosphate synthases; catalyzing the production of geranylgeranyl diphosphate (GGPP) from FPP and IPP by a geranylgeranyl diphosphate synthase; GGPP was converted to cis-Abienol (cis-Abienol) by labdan-13-en-8-ol diphosphate synthase and Abienol synthase (FIG. 1).

The invention adopts a resting cell catalysis process, can catalyze a substrate isopentenol of 3.0g/L in 24h to generate abienol of 1.80g/L, and has the conversion rate as high as 71.15 percent which is far higher than the conversion rate level reported in the current literature and patents. The resting cell culture has low requirement on nutrition, short culture time and easy preparation; compared with a fermentation method, the catalytic time is greatly shortened, and the synthesis efficiency is high; the resting cells have better tolerance capability to the toxicity of substrate isoamylene alcohol and product abienol, and the product concentration is high; therefore, compared with a fermentation method, the resting cell catalysis has better application potential in the scale preparation of the abienol.

Drawings

FIG. 1 is a schematic diagram of the resting cells of the present invention catalyzing the synthesis of abienol from isopentenol.

FIG. 2 is an agarose gel electrophoresis image showing the success of knocking out the genes phoA, ybjG, pgpB and nlp I and the success of replacing the fadR and glpFK gene promoters of E.coli host bacteria E.coli C41 (DE 3).

Wherein, A-F are agarose gel electrophoresis pictures of successful knockout of genes phoA, ybjG, pgpB and nlpI and successful replacement of fadR and glpFK gene promoters respectively.

FIG. 3 is a map of recombinant expression vectors PCTI (A), PAEIG (B), and PRCA (C).

FIG. 4 is a graph showing the effect of different glycerol concentrations on the yield of abienol synthesis.

FIG. 5 shows the effect of different resting cell concentrations on the yield of abienol synthesis.

FIG. 6 shows the effect of different substrate concentrations on the yield of abienol synthesis.

FIG. 7 shows the liquid chromatogram of the abienol standard and the sample (peak time of abienol is 18.74 min).

FIG. 8 is a graph showing the effect of repeated use of resting cells.

Detailed Description

The following examples further illustrate the embodiments of the present invention in detail. Unless otherwise stated, the instruments and equipment referred to in the examples are conventional instruments and equipment; the related reagents are all conventional reagents sold in the market; the related test methods are all conventional methods; the gene and primer synthesis is completed by Jin Weizhi; restriction enzymes, T4 DNA ligase, PCR enzymes and the like are available from Takara.

Various escherichia coli strains known in the art can be used as the starting strain of the present invention, for example, e.coli C41 (DE 3), e.coli BL21 (DE 3), e.coli C43 (DE 3), and the like. Coli C41 (DE 3) is the starting strain of escherichia coli.

Example 1 alkaline phosphatase PhoA knock-out

A pEcCas/pEcgRNA system is utilized to knock out an alkaline phosphatase coding gene phoA gene in an escherichia coli host, and a plasmid pEcgRNA-phoA is constructed, so that the corresponding gRNA is transcribed, a complex is formed with a Cas9 protein, a target gene target site is identified through base pairing and PAM, and the target DNA breakage is realized.

The specific method comprises the following steps:

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting a target sequence: TGCTGATTGGCGATGGGATGGGG (SEQ 1). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

Synthesis of oligonucleotide upstream primer PhoA-UP

(5'-TAGTTGCTGATTGGCGATGGGATG-3', SEQ) and the reverse primer phoA-DN (5'-AAACCATCCCATCGCCAATCAGCA-3', SEQ) from ddH ₂ O35. Mu. L, T4 ligase buffer 5. Mu. L, phoA-UP 5. Mu.L and phoA-DN 5. Mu.L were annealed in the reaction mixture.

The annealed double-stranded DNA (phoA-UP and phoA-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI and pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L, T4 ligase 1. Mu.L, and ddH ₂ O15. Mu.L of the mixture was ligated at 16 ℃ for 1 hour, and the ligation product was transformed into DH 5. Alpha. To select the plasmid pEcgRNA-phoA. Successfully ligated positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design: coli C41 (DE 3) genome is used as a template, upstream and downstream homology arm amplification primers are designed, and the upstream and downstream homology arms are respectively designed at about 400-500 bp. Respectively amplifying the upstream and downstream homology arms, purifying and recovering. Performing PCR reaction by using an upstream primer (PhoA-F-F) of an upstream homology arm and a downstream primer (PhoA-B-R) of a downstream homology arm, and using the recovered upstream and downstream homology arms as templates, wherein the PCR condition is 94 ℃ denaturation for 5min, and the PCR reaction is cycled for 30 times according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

PhoA-F-F:AGTTGTTATTTAAGCTTGCC(SEQ 4)

PhoA-F-R:ACTGCGCCATCTTTGGTATTTTCTGATCACCCGTTAAGCG(SEQ 5)

PhoA-B-F:CGCTTAACGGGTGATCAGAAAATACCAAAGATGGCGCAGT(SEQ 6)

PhoA-B-R:AGGCAATCACTCATGTAGGTCT(SEQ 7)

(3) The pEcgRNA-phoA plasmid and the donor DNA fragment were co-electroporated into electroporation competence of e.coli C41 (DE 3) containing the pEcCas plasmid. The cells recovered and cultured after the electrotransformation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2A) and the strains were preserved.

The positive recombinants selected above were cultured overnight in LB medium containing 10mM rhamnose and 50. Mu.g/mL kanamycin in order to eliminate the gRNA plasmid. Sucking 1. Mu.L of overnight-cultured bacterial liquid, transferring to 1mL of LB liquid medium without resistance, mixing, sucking 50. Mu.L of bacterial liquid, spreading on an LB plate containing kanamycin resistance, and culturing overnight at 37 ℃. And (3) selecting single colonies which do not grow on the spectinomycin plate and grow on the kanamycin plate by aiming at LB plates containing kanamycin and spectinomycin resistance, and preserving the strains.

The cultured colonies were inoculated into LB liquid medium containing glucose (5 g/L), cultured overnight at 37 ℃, and then approximately 10. Mu.L of the overnight-cultured broth was spread on an LB plate containing glucose (5 g/L) and sucrose (10 g/L), cultured overnight at 37 ℃, and then individual colonies were randomly picked and selected. Colonies with the plasmid pEcCas eliminated did not grow on kanamycin plates, as the spots were on LB plates with and without kanamycin. Screening to obtain the phoA gene knock-out strain LSC-01.

Example 2 Deknockout of the Undecaisovalerate diphosphatase ybjG

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting the target sequence: ATTCCCAAGCGATCACGGTACGG (SEQ 8). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

Oligonucleotides ybjG-UP (5'-TAGTATTCCCAAGCGATCACGGTA-3', SEQ) and ybjG-DN (5'-AAACTACCGTGATCGCTTGGGAAT-3', SEQ) were synthesized and synthesized from ddH ₂ O35. Mu. L, T4 ligase buffer 5. Mu. L, ybjG-UP 5. Mu.L and ybjG-DN 5. Mu.L.

The annealed double-stranded DNA (ybjG-UP and ybjG-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L and T4 ligase 1. Mu.L and ddH ₂ Ligation was performed at 16 ℃ for 1h in O15. Mu.L of the mixture, the ligation product was transformed into DH 5. Alpha. And the plasmid pEcgRNA-ybjG was selected. Successfully ligated positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design, using the genome of strain LSC-01 as template, designing the upstream and downstream homologous arm amplification primers, and designing the upstream and downstream homologous arms respectively at about 400-500 bp. And respectively amplifying the upstream and downstream homology arms, purifying and recovering. Performing PCR reaction by using an upstream primer (ybjG-F-F) of an upstream homology arm and a downstream primer (ybjG-B-R) of a downstream homology arm, and the recovered upstream and downstream homology arms as templates, wherein the PCR condition is 94 ℃ denaturation for 5min, and the PCR reaction is cycled for 30 times according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

ybjG-F-F:TATTGTTCCACCACGGCCAA(SEQ 11)

ybjG-F-R:CGGATCGGTAATGCAAAACAGAACGAGATCATCCACGGAG(SEQ 12)

ybjG-B-F:CTCCGTGGATGATCTCGTTCTGTTTTGCATTACCGATCCG(SEQ 13)

ybjG-B-R:GGTTTCTCTTTCAGCGCCAGA(SEQ 14)

(3) The pEcgRNA-ybjG plasmid and the donor DNA fragment are co-electrically transformed into an engineering strain containing pEcgAS plasmidLSC-01Is competent. The cells recovered and cultured after the electrotransformation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2B) and the strains were preserved. And (3) carrying out the specific implementation method of plasmid elimination according to the embodiment 1 to finally obtain the engineering strain LSC-02.

Example 3 deletion of the Gene encoding phosphatidylglycerol phosphatase pgpB

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting the target sequence: CTGAAACTGTCACCCAGCCCTGG (SEQ 15). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

Oligonucleotides pgpB-UP (5'-TAGTCTGAAACTGTCACCCAGCCC-3', SEQ) and pgpB-DN (5'-AAACGGGCTGGGTGACAGTTTCAG-3', SEQ 17) were synthesized and synthesized from ddH ₂ O, T4 ligase buffer, pgpB-UP and pgpB-DN.

The annealed double-stranded DNA (pgpB-UP and pgpB-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI and pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L and T4 ligase 1. Mu.L and ddH ₂ O15. Mu.L of the mixture was ligated at 16 ℃ for 1 hour, the ligation product was transformed into DH 5. Alpha. And the plasmid pEcgRNA-pgpB was selected. Positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design: with bacteriaGenome of strain LSC-02As a template, designing amplification primers of upstream and downstream homology arms, wherein the upstream and downstream homology arms are respectively designed at about 400-500 bp. And respectively amplifying the upstream and downstream homology arms, purifying and recovering. Performing PCR reaction by using an upstream primer (pgpB-F-F) of the upstream homology arm and a downstream primer (pgpB-B-R) of the downstream homology arm, and the recovered upstream and downstream homology arms as templates, wherein the PCR condition is 94 ℃ denaturation for 5min, and the PCR reaction is cycled for 30 times according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and finally extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

pgpB-F-F:GAGCTGGAAGCCACAATCGC(SEQ 18)

pgpB-F-R:TTCCGCAGGTGGTGTTAATGATCCATACGGCTACTGGCAT(SEQ 19)

pgpB-B-F:ATGCCAGTAGCCGTATGGATCATTAACACCACCTGCGGAA(SEQ 20)

pgpB-B-R:CCAGTCGCTTTATTTTACGTTC(SEQ 21)

(3) The pEcgRNA-pgpB plasmid and the donor DNA fragment were co-electroporated into the electrotransformation competence of the engineered strain LSC-02 containing the pEcCas plasmid. The cells recovered and cultured after the electrotransformation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2C) and the strains were preserved. The subsequent plasmid elimination method is referred to as example 1 to finally obtain the engineering strainLSC-03。

Example 4 knockout of outer Membrane lipoprotein encoding Gene nlp I

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting the target sequence: GCGTAAAAGTGAAGTCCTCGCGG (SEQ 22). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

Oligonucleotides nlp I-UP (5'-TAGTGCGTAAAAGTGAAGTCCTCG-3', SEQ) and nlp I-DN (5'-AAACCGAGGACTTCACTTTTACGC-3', SEQ) were synthesized and synthesized from ddH ₂ O, T4 ligase buffer, nlp I-UP and nlp I-DN.

The annealed double-stranded DNA (nlp I-UP and nlp I-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI and pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L and T4 ligase 1. Mu.L and ddH ₂ O15. Mu.L of the mixture was ligated at 16 ℃ for 1 hour, the ligation product was transformed into DH 5. Alpha. And plasmid pEcgRNA-nlp I was selected. Positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design: with bacteriaGenome of strain LSC-03As a template, designing amplification primers of upstream and downstream homology arms, wherein the upstream and downstream homology arms are respectively designed at about 400-500 bp. And respectively amplifying the upstream and downstream homology arms, purifying and recovering. Performing PCR reaction with upstream primer of upstream homology arm (nlp I-F-F) and downstream primer of downstream homology arm (nlp I-B-R), and the recovered upstream and downstream homology arms as template, wherein PCR condition is 94 deg.C denaturation for 5min, and the method comprisesThe following parameters were cycled 30 times: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and finally extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

nlpⅠ-F-F:AAATCGAAGTGGGCCGCGTCT(SEQ 25)

nlpⅠ-F-R:GCGATAATTCCAACAATGCGTCGCAACGAAACACCAGCGCAAA(SEQ 26)

nlpⅠ-B-F:TTTGCGCTGGTGTTTCGTTGCGACGCATTGTTGGAATTATCGC(SEQ 27)

nlpⅠ-B-R:TGCCAGCACCAGAATCTGT(SEQ 28)

(3) The pEcgRNA-nlp I plasmid and the donor DNA fragment are co-electrically transformed into an engineering strain containing the pEcgAS plasmidLSC-03Is competent. The cells recovered and cultured after the electrotransformation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2D) and the strains were preserved. And (3) carrying out a concrete implementation method of plasmid elimination according to the embodiment 1 to finally obtain the engineering strain LSC-04.

Example 5 replacement of the FAdR promoter of the transcriptional regulator encoding Gene for fatty acid metabolism to a constitutive Strong promoter P _tac

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting a target sequence: TATCAGCGTAGTTAGCCCTCTGG (SEQ 29). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

The oligonucleotides fadR-UP (5'-TAGTTATCAGCGTAGTTAGCCCTC-3', SEQ) and fadR-DN (5'-AAACGAGGGCTAACTACGCTGATA-3', SEQ) were synthesized and synthesized from ddH ₂ O, T4 ligase buffer, fadR-UP and fadR-DN.

The annealed double-stranded DNA (fadR-UP and fadR-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L and T4 ligase 1. Mu.L and ddH ₂ O15. Mu.L of the mixture was ligated at 16 ℃ for 1 hour, the ligation product was transformed into DH 5. Alpha. And plasmid pEcgRNA-P was selected _tac -fadR. Positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design: the genome of the strain LSC-04 is used as a template, upstream and downstream homology arm amplification primers are designed, and the upstream and downstream homology arms are respectively designed at about 400-500 bp. Respectively amplifying the upstream and downstream homology arms, purifying and recovering. Upstream primer with upstream homology arm (P) _tac -fadR-F-F) and downstream primer (P) of downstream homology arm _tac -fade-B-R), the recovered upstream and downstream homology arms are used as templates, PCR reaction is carried out, the PCR condition is 94 ℃ denaturation for 5min, and 30 cycles are carried out according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

P _tac -fadR-F-F:CTTCGATAGCCAACAGACCAC(SEQ 32)

P _tac -fadR-F-R:TAACCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCACAAAAAGAAGAAAAAGGGA(SEQ 33)

P _tac -fadR-B-F:CATCGGCTCGTATAATGTGTGGTTAGAAAGGTGTGTTTCACATATGGTCATTAAGGCGCAAA(SEQ 34)

P _tac -fadR-B-R:GATCGGCCACTTCATTAGC(SEQ 35)

(3) Coelectrotransformation of pEcgRNA-fade plasmid and donor DNA fragment to engineered strains containing pEcgAS plasmidLSC-04Is competent. The cells recovered and cultured after the electrotransformation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2E) and the strains were preserved. The subsequent plasmid elimination method is referred to as example 1 to finally obtain the engineering strainLSC-05。

Example 6 replacement of the promoter of the Glycerol kinase coding Gene glpFK to a constitutive Strong promoter P _tac

(1) Target sequences were designed using CRISPR RGEN Tools. Selecting the target sequence: CAGCATGCCTACAAGCATCGTGG (SEQ 36). The plasmid pEcgRNA was digested with BsaI, resulting in a linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

The oligonucleotides glpFK-UP (5'-TAGTCAGCATGCCTACAAGCATCG-3', SEQ) and glpFK-DN (5'-AAACCGATGCTTGTAGGCATGCTG-3', SEQ) were synthesized and synthesized from ddH ₂ O, T4 ligase buffer, glpFK-UP andannealing in a reaction mixture consisting of glpFK-DN.

The annealed double-stranded DNA (glpFK-UP and glpFK-DN) was diluted 200-fold, and 1. Mu.L of the diluted double-stranded DNA was linearized with BsaI pEcgRNA 1. Mu.L in T4 ligase buffer 2. Mu.L and T4 ligase 1. Mu.L and ddH ₂ O15. Mu.L of the mixture was ligated at 16 ℃ for 1 hour, the ligation product was transformed into DH 5. Alpha. And the plasmid pEcgRNA-P was selected _tac -glpFK. Positive clones were selected on LB plates containing 50. Mu.g/mL spectinomycin.

(2) Donor DNA design: with bacteriaGenome of strain LSC-05As a template, designing amplification primers of upstream and downstream homology arms, wherein the upstream and downstream homology arms are respectively designed at about 400-500 bp. And respectively amplifying the upstream and downstream homology arms, purifying and recovering. Upstream primer with upstream homology arm (P) _tac -glpFK-F-F) and downstream primer (P) of downstream homology arm _tac -glpFK-B-R), performing PCR reaction by using the recovered upstream and downstream homology arms as templates, wherein the PCR reaction is performed under the condition of 94 ℃ denaturation for 5min, and the PCR reaction is cycled for 30 times according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min. To obtain a donor DNA fragment. The above mentioned primers were designed as follows:

P _tac -glpFK-F-F:TCTTCGCGCTGATGCTGGG(SEQ 39)

P _tac -glpFK-F-R:TAACCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCTCGTCATAAAATGAGCGTTA(SEQ 40)

P _tac -glpFK-B-F:CATCGGCTCGTATAATGTGTGGTTAGAAAGGTGTGTTTCACATATGAGTCAAACATCAACCT(SEQ 41)

P _tac -glpFK-B-R:GCACAAAATTGATATGAGGA(SEQ 42)

(3) Coelectrotransformation of pEcgRNA-glpFK plasmids and donor DNA fragments into engineered strains containing pEcgAS plasmidsLSC-04Is competent. The cells recovered and cultured after the electroporation were plated on SOB plates containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL spectinomycin, and cultured overnight at 37 ℃. Positive recombinants were screened by colony PCR (FIG. 2F) and the strains were preserved. The subsequent plasmid elimination concrete implementation method refers to the embodiment 1, and the engineering strain is finally obtainedLSC-06。

EXAMPLE 7 construction of recombinant expression vector pCTI

In the embodiment, the hydroxyethyl thiazole kinase coding gene EcThiM is from E.coli K-12W3110; e.coli K-12W3110 genomic DNA was subjected to PCR using a pair of primers (EcThiM-F, ecThiM-R) to obtain an EcThiM fragment.

Wherein, the primer EcThiM-F:5'-ATGGATCCGCAAGTCGACCTGCTGGGTTC-3' (SEQ 43); ecThiM-R:5'-CATAAGCTTTCATGCCTGCACCTCCTGCGT-3' (SEQ 44) comprising cleavage sites BamHI and hindiii.

Isopentenyl phosphokinase coding gene MthIPK is from Methanothribacterium thermophilus str.Delta H; the MthIPK fragment was obtained by PCR of the laboratory preservation plasmid pUC57-MthIPK using a pair of primers (MthIPK-F, mthIPK-R).

Wherein, the primer MthIPK-F:5'-ATATGATTATTCTGAAACTGGGCGG-3' (SEQ 45) and MthIPK-R:5'-TCTACTCGAGTTAATGTTTGCCGGTAAT-3' (SEQ 46) comprising cleavage sites NdeI and XhoI.

The PCR conditions of the above genes are all denaturation at 94 ℃ for 5min, and the cycle is 30 times according to the following parameters: denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min. The products obtained from the PCR reaction were analyzed by 1% agarose gel electrophoresis. And after the correct size of the fragment is confirmed, recovering the target band fragment by adopting a DNA purification and recovery kit for constructing the recombinant expression vector.

Plasmid pCDuet-1 and the above-described fragments were subjected to digestion and ligation using restriction enzymes BamHI, hind III, ndeI and XhoI, and T4 DNA ligase to obtain expression vector pCTI (FIG. 3A).

EXAMPLE 8 construction of recombinant expression vector pAEIG

Bifunctional farnesyl diphosphate synthase encoding gene scorg 20 (F96C), from s.cerevisiae S288C; the S.cerevisiae S288c genomic DNA was subjected to PCR using a pair of primers (ScEGR 20-F, scEGR-R) to obtain a ScERG20 fragment.

Wherein, the primer ScEGR20-F:5'-CAGGGAATTCGGCTTCAGAAAAAGAAATTAGGA-3' (SEQ 47);

ScEGR20-R：

5’-GCTACCGCCACCGCCGCTACCGCCACCGCCTTTGCTTCTCTTGTAAACTTTG-3’(SEQ 48)，

isopentenyl diphosphate delta-isomerase-encoding gene ScIDI from s.cerevisiae S288c; the S.cerevisiae S288c genomic DNA was subjected to PCR using a pair of primers ScIDI-F, scIDI-R to obtain a ScIDI fragment.

Wherein, the primer ScIDI-F:

5’-GGCGGTGGCGGTAGCGGCGGTGGCGGTAGCATGACTGCCGACAACAAT-3’(SEQ 49)，

ScIDI-R：5’-GCGCCTTAAGTTATAGCATTCTATGAATTTGCC-3’(SEQ 50)。

the primers ScEGR20-R and ScIDI-F are provided with direction complementary sequences, and the obtained fragments ScERG20 and ScIDI are fused by a PCR mode to obtain a fragment ScERG20-ScIDI.

The fusion fragment ScERG20 (F96C) -IDI was also obtained by introducing a bifunctional farnesyl diphosphate synthase high-activity mutation (i.e., a mutation at amino acid residue 96: F → C) into the fragment ScERG20-ScIDI by means of PCR fusion. Wherein the primer ScEGR20-F:5'-CAGGGAATTCGGCTTCAGAAAAAGAAATTAGGA-3' (SEQ 51), scEGR20 (F96C) -F:5'-GTTGTTGCAGGCTTACTGCTTGGTCGCCGATG-3' (SEQ 52), scEGR20 (F96C) -R:5'-CATCGGCGACCAAGCAGTAAGCCTGCAACAAC-3' (SEQ 53) and ScIDI-R:5'-GCGCCTTAAGTTATAGCATTCTATGAATTTGCC-3' (SEQ 54), primers ScEGR20-F and ScIDI-R comprise restriction sites EcoRI and AflII.

Geranylgeranyl diphosphate synthase-encoding gene TcGGPPS, from Taxus canadensis, was subjected to PCR on laboratory conservation plasmid pUC57-TcGGPPS using a pair of primers to obtain a TcGGPPS fragment. Wherein, the primer TcGGPPS-F:5'-GCAGCATATGGCAGATCTGTTTGATTTCAATG-3' (SEQ 55); tcGGPPS-R:5'-CGAGCTCGAGTTAGTTCTGACGAAACGCAAT-3' (SEQ 56) comprising cleavage sites NdeI and XhoI.

Plasmid pACYCDuet-1 and the above fragments were digested and ligated with restriction enzymes EcoRI, aflII, ndeI, xhoI and T4 DNA ligase to obtain expression vector pAEIG (FIG. 3B).

Example 9 construction of recombinant expression vector pRCA

In this example, the gene encoding CcCLS for labdanum-13-en-8-ol diphosphate synthase, from Cistus creticus, was PCR-stored on the laboratory preservation plasmid pUC57-CcCLS using a pair of primers to obtain the CcCLS fragment.

Wherein, the primer CcCLS-F:5'-AGCGGATCCGTGTTCAGCTAGGAG-3' (SEQ 57); ccCLS-R:5'-ATGCGTCGACTTACACCACGCTCTCAAA-3' (SEQ 58) comprising cleavage sites BamHI and SalI.

The abienol synthase encoding gene NtABS is from Nicotiana tabacum, and a pair of primers is used for carrying out PCR on a laboratory preservation plasmid pUC57-NtABS to obtain an NtABS fragment.

Wherein, the primer NtABS-F:5'-ATAGAGATCTGGCTATATGCCACAGGCCCTG-3' (SEQ 59); ntABS-R:5'-ATGAGGTACCCGGAGAATACTGATTCAGGGGCTT-3' (SEQ 60) comprising cleavage sites BglII and KpnI.

Plasmid pRSFDuet-1 and the above-described fragment were digested and ligated with restriction enzymes BamHI, salI, bglII, kpnI and T4 DNA ligase to obtain expression vector pRCA (FIG. 3C).

EXAMPLE 10 construction of resting cells of recombinant engineered bacteria

The three recombinant expression vectors successfully constructed in the above examples 7-9 were simultaneously transformed into the engineered strain LSC-06. Obtaining an engineering strain LSC-07 co-expressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, labdanum-13-en-8-ol diphosphate synthase and abienol synthase.

Example 11 resting cells catalyze the preparation of abienol from isopentenol

The strain LSC-07 successfully constructed in example 10 was inoculated into 50mL of LB medium containing 50. Mu.g/mL of streptomycin, 30. Mu.g/mL of chloramphenicol, and 25. Mu.g/mL of kanamycin, and cultured overnight at 37 ℃ with shaking at 200 rpm. The culture was inoculated at 1% inoculum size into fresh 400mL TB medium containing 50. Mu.g/mL streptomycin, 30. Mu.g/mL chloramphenicol, and 25. Mu.g/mL kanamycin, cultured at 37 ℃ with shaking at 200rpm, and OD ₆₀₀ When the concentration reached 2.5 to 3.0, 0.5mM IPTG was added to the cells, the cells were induced at 25 ℃ overnight at 200rpm, 4000rpm and 4 ℃ for 10min by centrifugation, the supernatant was discarded, and the cells were washed twice with 20mM PB (pH 7.0) buffer to obtain resting cells expressing hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, labdanum-13-en-8-ol diphosphate synthase, and abienol synthase, and were used for further use.

Adding 1.0-5.0g/L isopentenol, 0-40g/L glycerol (providing resting cell ATP synthesis capability and meeting the requirement of a abienol catalytic synthesis process on ATP) and 20-200g/L resting cells (both concentrations are final concentrations) respectively into a 100mL reaction system, adding a 20mM buffer solution with pH of 7.0PB to reach a volume of 100mL, finally adding isopropyl myristate accounting for 10% (v/v) of the total volume of the reaction system to form a catalytic reaction system, and catalyzing at 25 ℃ for 12-24h to obtain abienol finally.

In order to explore the influence of various factors in a reaction system on the yield of the abienol, the concentration of glycerol, the concentration of resting cells and the concentration of isoamylene alcohol are respectively changed for testing.

By changing the concentration of glycerol (0, 10, 20, 30 and 40 g/L), the change of the yield of the abienol under different concentrations of glycerol (the final concentration of the prenol is 2.0g/L and the final concentration of the resting cells is 100 g/L) is researched, and the abienol yield is highest when the glycerol concentration is 20g/L and the abienol yield is catalyzed for 24 hours at 25 ℃ (figure 4).

By changing the resting cell concentration (20, 50, 100, 150 and 200 g/L), the influence of different resting cell concentrations on the synthesis yield of the abienol (the final concentration of the prenol is 2.0g/L and the final concentration of the glycerol is 20 g/L) is researched, and the abienol yield is highest when the resting cell concentration is 100g/L through catalysis at 25 ℃ for 24 hours, wherein the result shows that the thalli concentration on the abscissa in a graph is the final concentration of the resting cells.

By changing the concentration of the isoamylene alcohol (1.0, 2.0, 3.0, 4.0 and 5.0 g/L), the influence of different concentrations of the isoamylene alcohol on the yield of the abienol synthesis is researched (the final concentration of resting cells is 100g/L and the final concentration of glycerol is 20 g/L), and the effect of catalysis at 25 ℃ for 24 hours shows that the yield of the abienol is the highest when the concentration of the isoamylene alcohol is 3.0g/L (figure 6, the addition amount of a substrate on the abscissa in the figure is the final concentration of the isoamylene alcohol).

Experiments show that isopentenol with the final concentration of 3.0g/L, recombinant escherichia coli resting cells with the final concentration of 100g/L and glycerol with the final concentration of 20g/L are respectively added into a 100mL catalytic reaction system, a 20mM buffer solution with the pH value of 7.0PB is added until the volume is 100mL, isopropyl myristate accounting for 10% (v/v) of the total volume of the reaction system is finally added, and the optimal resting cell catalytic process is obtained after catalytic reaction is carried out for 24 hours at the temperature of 25 ℃. The results show that: the substrate isopentenol is catalyzed for 3.0g/L within 24 hours to generate 1.80g/L of abienol, and the actual conversion rate reaches 71.15 percent which is far higher than the level reported in the current literature and patents.

Actual conversion calculation method: according to the catalytic reaction of the abienol, 4mol of the isopentenol is completely converted to generate 1mol of the product of the abienol, and the theoretical value of the abienol generated by completely converting 3.0g/L of the isopentenol is 2.53g/L by calculating the molecular weight. The actual conversion rate can be obtained by the actual detection value/theoretical value.

HPLC analysis: the reaction was carried out at 25 ℃ and 200rpm for 24h, and samples were taken. Abienol has UV absorption at 237nm, and is analyzed by high performance liquid chromatography UV detector (FIG. 7).

The HPLC analysis conditions were as follows: the chromatographic column is C18; the flow rate is 0.8mL/min; the column temperature is 30 ℃; the detector is an ultraviolet detector; the amount of sample was 5. Mu.L. The detection result is as follows: the reaction time is 24 hours, and the content of the abienol is 1.80g/L.

As can be seen from the HPLC detection results shown in FIG. 7: the peak time of the catalytic synthesis product sample obtained in the experiment is consistent with that of the abienol standard product (both are 18.74 min), which indicates that the catalytic synthesis product is abienol.

Example 12 reuse of resting cells

After the catalytic reaction of the resting cells is finished, the resting cells in the reaction system still retain most of the catalytic activity, so that the reusability of the resting cells is verified.

And (4) recovering the resting cells after the reaction system is centrifuged, and repeatedly applying the resting cells to a new round of catalytic reaction. Reaction conditions are as follows: in a 100mL catalytic reaction system, isopentenol with the final concentration of 3.0g/L, recombinant Escherichia coli resting cells with the final concentration of 100g/L and glycerol with the final concentration of 20g/L are respectively added, a 20mM buffer solution with the pH value of 7.0PB is added until the volume is 100mL, finally, isopropyl myristate accounting for 10% (v/v) of the total volume of the reaction system is added, and the continuous catalytic reaction is carried out for 24 hours at the temperature of 25 ℃. The repeated use efficiency of the resting cells is shown in figure 8, and the experimental result shows that the actual conversion rate of the substrate isopentenol into the abienol in the first 6 repeated processes of the resting cells reaches over 50 percent, which indicates that the same batch of resting cells can be repeatedly used for 5-6 times.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and it is intended that the present invention cover the modifications, equivalents and improvements of the embodiments within the spirit and scope of the present invention as defined by the appended claims.

Claims

1. A preparation method of recombinant escherichia coli resting cells is characterized in that phosphatase coding genes phoA, ybjG and pgpB and outer membrane lipoprotein coding genes nlp I in an escherichia coli host are knocked out, constitutive overexpression of a fatty acid metabolism transcription regulator coding gene fadR is achieved, constitutive overexpression of a glycerol metabolism operon is achieved due to glpFK, and an escherichia coli engineering strain LSC-06 is constructed; constructing an escherichia coli engineering strain LSC-07 for co-expressing hydroxyethyl thiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate delta-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, labdanum-13-ene-8-ol diphosphate synthase and abienol synthase on the basis of the escherichia coli engineering strain LSC-06; and culturing the engineering Escherichia coli strain LSC-07 to obtain recombinant Escherichia coli resting cells.

2. The method for preparing the escherichia coli engineered strain LSC-06 of claim 1, wherein the escherichia coli engineered strain LSC-06 is constructed by:

(1) Knock-out of alkaline phosphatase coding gene phoA:

(2) Knock-out of gene ybjG encoding undecaprate bisphosphatase:

(3) Knockout of phosphatidylglycerol phosphatase coding gene pgpB;

(4) Knockout of outer membrane lipoprotein encoding gene nlp I

Taking genome of engineering strain LSC-04 of escherichia coli as a template, designing donor DNA, constructing and replacing fadR promoter of gene coding for fatty acid metabolism transcription regulator as constitutive strong promoter P _tac The escherichia coli engineering strain LSC-05;

(6) Constitutive overexpression of the glycerol metabolism operon glpFK

3. The method for preparing the recombinant strain of escherichia coli according to claim 1, wherein the engineered escherichia coli LSC-07 is constructed by:

4. A method for preparing abienol by catalyzing isopentenol by using the recombinant Escherichia coli resting cells obtained by the preparation method of any one of claims 1 to 3.

5. The method of claim 4, wherein in 100mL of the catalytic reaction system, isopentenol is added at a final concentration of 1.0-5.0g/L, recombinant escherichia coli resting cells are added at a final concentration of 20-200g/L, glycerol is added at a final concentration of 0-40g/L, a 20mM pH 7.0pb buffer solution is added to a volume of 100mL, and finally isopropyl myristate is added at a concentration of 10-20% (v/v) based on the total volume of the reaction system; catalytic reaction at 25 deg.c for 12-24 hr to synthesize abienol.

6. The method of claim 5, wherein glycerol is added to a final concentration of 10-40g/L in 100mL of catalytic reaction system.

7. The method of claim 5, wherein 3.0g/L prenol, 100g/L resting cells of recombinant Escherichia coli, 20g/L glycerol, 2 mM buffer pH 7.0PB to 100mL in volume, and isopropyl myristate in an amount of 10% (v/v) based on the total volume of the reaction system are added to 100mL of the catalytic reaction system; catalyzing for 24h at 25 ℃ to synthesize the abienol.

8. The method of claim 5, wherein the recombinant resting E.coli cells are recovered by centrifugation and reused after the reaction is completed.

9. The use of the method of claim 5 for preparing resting cells of recombinant E.coli in the catalysis of prenol to abienol.