CN109628421A

CN109628421A - It is a kind of it is special synthesis furanone glucoside glycosyl transferase and its application

Info

Publication number: CN109628421A
Application number: CN201910025135.6A
Authority: CN
Inventors: 宋传奎; 陈永先
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2019-01-11
Filing date: 2019-01-11
Publication date: 2019-04-16
Anticipated expiration: 2039-01-11
Also published as: CN109628421B

Abstract

The invention discloses a kind of glycosyl transferase of special synthesis furanone glucoside and its applications, and the amino acid sequence of glycosyl transferase is as shown in SEQ ID No.1.The gene UGT10 of glycosyl transferase shown in SEQ ID No.1 is encoded, nucleotide sequence is as shown in SEQ ID No.2.The present invention utilizes the albumen of UGT10 coding, the generation of catalysis furanone and its derivative glucoside that can be specifical and efficient.A kind of specifical and efficient biological synthesis method is provided for the production of furanone and its derivative glucoside.

Description

It is a kind of it is special synthesis furanone glucoside glycosyl transferase and its application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of glycosyl transferase of special synthesis furanone glucoside And its application.

Background technique

Furanone (- 3 (2H)-furanone of 4- hydroxyl -2,5- dimethyl, Furaneol, DMHF), also known as pineapple ketone or strawberry Ketone.It is a kind of very important fragrance, has the strong caramel odour that bakes, and characteristic perfume is fruity, burnt odor, caramel and spinach Trailing plants sample fragrance.Since first identified goes out furanone to nineteen sixty-five J.O.Rodin et al. in the ether extraction liquid of pineapple juice, by In its low fragrance threshold value, the fragrance of pleasant and significant flavouring effect, causes and close the great interest of winner, more win wind The favor of taste research workers.Furanone is the extremely wide natural safe fragrance of purposes, be widely used in food, beverage, tobacco, The industries such as health care product.Furanone has irreplaceable status in the spices and essence industry of China, is that a kind of excellent sweet taste is fragrant Material and fumet manufacture NAB National Association 0f Broadcasters (FEMA NO.3134) for U.S.'s flavorant and European Council (COE NO.536) are common The safe edible fragrance of approval.

Furanone is also important aroma substance in plant simultaneously, be strawberry, grape, tea flavor in important composition portion Point.Studies have shown that furanone is one kind of most critical in 15 kinds of fragrance active materials for really contribute to strawberry flavor.Meanwhile And the constituent of the important fragrance of grape wine is made in certain grape varieties.In addition, furanone is also some fragrance of tealeaves Important composition ingredient.In recent years some researches show that, furanone be jasmine tea, in oolong tea fragrant and sweet and tea curing stem generate it is special Fragrant and sweet and camerlsed important composition ingredient in sign property flavor.

Studies have shown that furanone is formed in plant with the glycosylation that a unknown glycosyl transferase is catalyzed Glucosides, be stable in the presence of in plant.Compared to Free aroma substance, fragrance glycosidic nature is more stable, water-soluble stronger, and has There are many important biological functions, have huge commercial value in cosmetics, food and course of drug development.Fragrance glucosides Mainly catalyzed and synthesized by UGT by glycosylation.Glycosylation is mostly important one of the modification reaction of Secondary Metabolism of Plant, Adjust plant metabolism balance, release exotic toxin toxicity, maintain plant normal growth development etc. plays a significant role, The fragrance component of plant can also be improved by metabolic engineering approach simultaneously.

Currently, the synthesis of fragrance glucosides, which mainly passes through two kinds of means of chemistry and biology, realizes that biosynthesis is due to using enzyme Or engineering bacteria is converted at normal temperature, no pollution to the environment, and loci selectivity is stronger, product is single, does not need outer The use of source catalyst securely and reliably has very big potentiality in functional food.But a variety of fragrance glucosides biologies close at present At method it is also immature, wherein the correlative study of furanone glucosides is seldom.The relevant glycosyl transferase of reported furanone Cannot it is specifical and efficient catalysis furanone glucosides generation, majority using substrate it is extensive, synthesis furanone glucosides ability it is weak.

Summary of the invention

The technical problems to be solved by the invention are as follows: how a kind of synthesis furanone and its derivative glucoside are provided Glycosyl transferase and encoding gene solve the biosynthesis problem of furanone and its derivative glucoside.

The technical solution of the present invention is as follows:

A kind of glycosyl transferase synthesizing furanone and its derivative glucoside, amino acid sequence such as SEQ ID Shown in No.1.

A kind of gene UGT10, nucleotide sequence such as SEQ ID encoding glycosyl transferase shown in SEQ ID No.1 Shown in No.2.

Expression vector, it includes nucleotide sequences shown in SEQ ID No.2.

Gene UGT10 shown in glycosyl transferase shown in SEQ ID No.1 or SEQ ID No.2 in synthesis furanone and Application on its derivative glucoside.

A method of synthesis furanone and its derivative glucoside include the following steps:

(1) it using tea tree cDNA as template, is arranged with nucleotides sequence shown in SEQ ID No.3 and SEQ ID No.4 as primer PCR is carried out, gene UGT10 shown in SEQ ID No.2 is obtained；

(2) the gene UGT10 for obtaining step (1) carries out prokaryotic expression；

(3) it isolates and purifies to obtain amino acid sequence glucosyltransferase as shown in SEQ ID No.1；

(4) it using furanone or furanone derivatives as substrate, is catalyzed with glycosyl transferase shown in SEQ ID No.1 Reaction, obtains furanone glucoside or furanone derivatives glucoside.

Further, the furanone derivatives are -3 (2H)-furanone of 2- ethyl -4- hydroxy-5-methyl base or monomethyl Furanone.

Further, it is catalyzed the condition of reaction are as follows: 25 DEG C -35 DEG C of temperature, pH value 6.5-10.

Preferably, it is catalyzed the condition of reaction are as follows: 30 DEG C of temperature, pH value 8.5.

Compared with prior art, the invention has the following advantages:

The present invention utilizes the albumen of UGT10 coding, catalysis furanone and its derivative glucoside that can be specifical and efficient Generation.A kind of specifical and efficient biological synthesis method is provided for the production of furanone and its derivative glucoside.

Detailed description of the invention

Fig. 1: the screening of fragrance substrate；

Fig. 2: the enzyme-activity data of differential responses time；

Fig. 3: the enzyme-activity data of different pH；

Fig. 4: different temperatures enzyme-activity data；

Fig. 5: for furanone and its acquisition flow chart of derivative glucoside.

Specific embodiment

1, UGT10 gene

In tea tree genome, it was found that the albumen of the relevant gene of a glycosyl transferase, gene coding can be special The opposite sex utilizes furanone and its derivative, generates furanone and its derivative glucoside, is UGT10 by the unnamed gene, should The CDS sequence of gene is as shown in SEQ ID No.2.

2, the clone of UGT10 gene

It by SnapGene Viewer software Design primers is mould with the cDNA of tea tree according to the CDS of above-mentioned UGT10 Plate clones target gene with high fidelity enzyme, carries out glue recycling by commercialized kit later, obtain single purpose base Cause.

The acquisition of cDNA template: after the fresh leaf liquid nitrogen processing of tealeaves is ground, Plant RNA reagent box is extracted with commercialization and is mentioned It takes, carries out reverse transcription with commercialization reverse transcription reagent box later, obtain cDNA.

The primer sequence of UGT10 gene:

UGT10F:GGATCTGGTTCCGCGTGGATCCATGGAGACACCAAACAGAGC (SEQ ID No.3)

UGT10R:GCTCGAGTCGACCCGGGTTAGGATCGCACTAATTCAGCTAC (SEQ ID No.4)

Reaction system:

Response procedures:

3, the building of recombinant plasmid pGEX4T1-UGT10

Complete pGEX4T1 carrier is subjected to double digestion as needed, to obtain linear carrier, passes through commercialization later Kit glue recycle carrier, obtain linear carrier after purification.With ligase by single target gene and linear carrier into Row connection, construction recombination plasmid pGEX4T1-UGT10 are transformed into Trans1-T1 competent cell later and are incubated overnight, and select It takes positive bacterial plaque to be transferred in LB culture medium, after bacterium colony PCR verifying, gives bacterium solution to general biological Co., Ltd and complete sequencing Work.

4, the prokaryotic expression of UGT10 gene and purifying

It successful expression vector pGEX4T1-UGT10 will be constructed is transformed into BL21 competent cell and be incubated overnight, select It takes positive bacterial plaque to be transferred in LB culture medium to be incubated overnight for 37 DEG C, be expanded culture under the conditions of 37 DEG C, until OD600=0.6- Until 0.8.After being cooled to 16-18 DEG C, the IPTG of the 1M overnight induction in 16 DEG C of culturing room is added.Bacterium is collected by centrifugation within second day Fall, ultrasonication, according to the glycosyl transferase of the optimization in document method purifying protein (Song C, Hong X, Zhao S, et al.Glucosylation of 4-Hydroxy-2,5-Dimethyl-3(2H)-Furanone,the Key Strawberry Flavor Compound in Strawberry Fruit[J].Plant Physiol.2016,171(1): 139-151；Song C,Ring L,Hoffmann T,et al.Acylphloroglucinol Biosynthesis in Strawberry Fruit[J].Plant Physiol.2015,169(3):1656-1670；Song C,Gu L,Liu J,et al.Functional Characterization and Substrate Promiscuity of UGT71Glycosyltransferases from Strawberry(Fragaria×ananassa)[J].Plantand Cell Physiology.2015,56 (12)), and carry out SDS-PAGE detection.The amino acid sequence of the albumen such as SEQ ID Shown in No.1.

5, fragrance substrate screens

Successful albumen will be purified and carry out the screening of fragrance substrate, determination of activity refers to the method (Song of this laboratory optimization C,Ring L,Hoffmann T,et al.Acylphloroglucinol Biosynthesis in Strawberry Fruit [J].Plant Physiol.2015,169(3):1656-1670；Song C,Gu L,Liu J,et al.Functional Characterization and Substrate Promiscuity of UGT71Glycosyltransferases from Strawberry (Fragaria × ananassa) [J] .Plant and Cell Physiology.2015,56 (12)), measurement The production quantity of UDP, so that it is determined that the production quantity of measurement glucosides.

The reaction system of fragrance substrate screening:

The control systems of fragrance substrate screening:

Tris-HCl pH=7.5 (50mM) 4.6ul

DTT(50mM) 0.2ul

UDPG(2.5mM) 0.2ul

Fragrance substrate used has: furanone, -3 (2H)-furanone of 2- ethyl -4- hydroxy-5-methyl base, monomethyl furans Ketone, eugenol, vanillic acid, benzaldehyde cyanohydrin, salicylic acid, oxidation aromatic alcohol, 1- naphthols, fanesol, nerol, sorbic acid etc..

It was found that the albumen of UGT10 coding can be with specific catalytic furanone, -3 (2H)-furan of 2- ethyl -4- hydroxy-5-methyl base It mutters ketone, monomethyl furans ketogenesis furanone glucoside, -3 (2H)-furanone glucoside of 2- ethyl -4- hydroxy-5-methyl base With monomethyl furanone glucoside.Relative activity is as shown in Figure 1.

6, product is identified

Reaction product in reaction system is extracted with ethyl acetate, supernatant is molten by being carried out after concentration with methanol Solution is directly analyzed with LC-MS/MS after lysate filtering.Using full wavelength scanner, sample volume volume is 2ul, and flow velocity is 1.0mL/min, mobile phase be water and methanol, identification method reference laboratory optimization method (Song C, Hong X, Zhao S, et al.Glucosylation of 4-Hydroxy-2,5-Dimethyl-3(2H)-Furanone,the Key Strawberry Flavor Compound in Strawberry Fruit[J].Plant Physiol.2016,171(1): 139-151)。

7, the external enzyme kinetic analysis of UGT10

Study UGT10 gene coding albumen with furanone vitro reactions at differential responses time, temperature, pH, enzyme activity Difference, the optimum condition that optimization is most reacted.Under optimum condition, changes concentration of substrate, do enzyme kinetics experiment, thus To the Km and Vm of enzyme.Optimize differential responses time, temperature, the reaction system of pH are as follows:

The differential responses time, difference pH, different temperatures enzyme-activity data see Fig. 2, Fig. 3 and Fig. 4 respectively.

According to optimum temperature (30 DEG C), optimum pH (8.5), reaction time 10min acquires enzyme kinetics parameter

1 enzyme kinetics parameter of table

8, the synthesis of furanone and its derivative glucosides

By above description and data can be seen that UGT10 coding albumen can be specifical and efficient catalysis furanone And its generation of derivative glucosides.The acquisition flow chart of furanone and its derivative glucoside is shown in Fig. 5.

Sequence table

<110>Agricultural University Of Anhui

<120>a kind of glycosyl transferase of special synthesis furanone glucoside and its application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 458

<212> PRT

<213>tea tree (Camellia sinensis)

<400> 1

Met Glu Thr Pro Asn Arg Ala Tyr Lys Ala His Val Leu Val Leu Pro

1 5 10 15

Tyr Pro Ala Gln Gly His Ile Asn Pro Met Leu Gln Phe Ser Lys Arg

20 25 30

Leu Val Ala Arg Gly Val Lys Ala Thr Leu Ala Asn Ser Val Tyr Ile

35 40 45

Ser Lys Ser Met His Lys Asp Gln Ile Ser Thr Ile Asp Thr Asp Thr

50 55 60

Phe Ser Asp Gly His Asp Asp Gly Gly Tyr Asp Asn Ala Glu Asn Pro

65 70 75 80

Glu Ala Tyr Leu Thr Lys Leu Arg Asp Val Gly Ser Arg Thr Leu Ala

85 90 95

Ser Leu Ile Glu Lys Leu Asn Gly Leu Gly Arg Pro Val Asp Ala Leu

100 105 110

Ile Tyr Asp Gly Phe Leu Pro Trp Ala Leu Asp Val Ala Lys Glu Leu

115 120 125

Gly Ile Leu Gly Val Val Phe Phe Thr Gln Thr Cys Ala Val Asn Ser

130 135 140

Ile Tyr Tyr His Val His Glu Gly Leu Leu Ser Leu Pro Leu Ser Pro

145 150 155 160

Asp Ser Thr Ile Leu Leu Pro Gly Leu Pro Pro Leu Glu Ser Cys Glu

165 170 175

Thr Pro Ser Phe Val Tyr Ala Tyr Gly Leu His Pro Ser Phe Tyr Asp

180 185 190

Leu Leu Val Asn Gln Phe Ser Asn Val Asp Lys Ala Asp Trp Val Leu

195 200 205

Phe Asn Thr Phe Tyr Glu Leu Glu Lys Glu Val Val Asp Trp Met Ser

210 215 220

Lys Leu Trp Arg Val Arg Thr Ile Gly Pro Thr Leu Pro Ser Met Tyr

225 230 235 240

Leu Asp Gln Lys Leu Lys Asp Asp Ile Asp Tyr Gly Ile Asn Leu Phe

245 250 255

Lys Pro His Ser Thr Val Cys Met Asn Trp Leu Asn Ala Lys Pro Ser

260 265 270

Ser Ser Val Val Tyr Val Ser Phe Gly Ser Met Ala Gln Phe Glu Pro

275 280 285

Glu Gln Met Glu Glu Ile Ala Trp Gly Leu Asn Gln Ser Asn Tyr Asn

290 295 300

Phe Leu Trp Val Val Arg Ala Thr Glu Glu Ala Lys Leu Pro Asn Asn

305 310 315 320

Phe Ile Asn Asp Thr Ala Glu Lys Gly Leu Val Val Thr Trp Ser Pro

325 330 335

Gln Leu Glu Val Leu Ala His Glu Ser Ile Gly Cys Phe Val Thr His

340 345 350

Cys Gly Phe Asn Ser Val Leu Glu Ala Leu Ser Leu Gly Val Pro Met

355 360 365

Val Gly Val Pro Tyr Trp Ser Asp Gln Ala Thr Asn Ala Lys Phe Val

370 375 380

Glu Asp Val Trp Gly Ile Gly Ile Arg Ala Lys Met Asp Asp Lys Gly

385 390 395 400

Ile Val Arg Arg Glu Val Leu Glu Ala Cys Met Lys Glu Val Phe Glu

405 410 415

Gly Lys Lys Lys Asn Glu Val Lys Met Asn Ala Met Lys Trp Lys Lys

420 425 430

Leu Ala Lys Glu Ala Leu Gly Asp Gly Gly Ser Ser Asp Lys Asn Ile

435 440 445

Asp Glu Phe Val Ala Glu Leu Val Arg Ser

450 455

<210> 2

<211> 1377

<212> DNA

<213>tea tree (Camellia sinensis)

<400> 2

atggagacac caaacagagc ctacaaagcc catgttctag tcctacccta ccctgcccaa 60

gggcacatca acccaatgct tcaattctcc aagcgcttgg tagctagagg tgtcaaggcc 120

actcttgcca acagtgttta tatctccaag tccatgcaca aggaccaaat cagcaccatc 180

gacactgaca cgttttccga cggacacgac gatggcggct acgacaacgc cgaaaatccc 240

gaagcctatc tgaccaaatt acgcgacgtt ggatcgcgga ctctggccag tctcatcgag 300

aaactcaatg ggcttggccg accagtcgat gccctaattt atgatgggtt tttgccttgg 360

gctcttgatg ttgccaagga gttaggaata cttggagttg tgtttttcac tcagacttgt 420

gctgtcaata gcatatatta tcatgtgcac gagggtcttc tttcactccc actttcacca 480

gattcaacta ttttgttgcc tggattgcca ccacttgagt cctgtgaaac gccatcgttt 540

gtgtatgctt atgggttgca tccaagtttc tatgacttgt tggtgaatca attcagtaac 600

gttgataaag cagattgggt cctttttaat actttctacg aattggagaa agaggtggta 660

gattggatgt caaaactatg gcgggtgaga acaataggcc caacacttcc atccatgtac 720

ttagatcaga aactcaaaga tgacatagat tatggcatca atctcttcaa gcctcactcc 780

actgtgtgca tgaactggct aaatgccaag ccaagcagct ctgtcgttta cgtatccttt 840

ggcagcatgg cccaatttga acccgaacaa atggaagaaa tagcatgggg cttaaaccaa 900

agcaattaca acttcttgtg ggtcgtgagg gcaaccgaag aagccaagct accaaacaac 960

ttcatcaatg acacagccga gaagggcttg gtggtgacat ggagtccaca gctagaggtg 1020

ttggcacacg agtcaatagg ttgctttgtc acgcattgtg ggttcaactc tgttcttgag 1080

gcactgagct tgggtgtgcc aatggttggt gttccatatt ggtcggacca agctacgaat 1140

gctaagtttg tggaggatgt ttggggtata ggaattaggg ctaagatgga tgataagggt 1200

attgtcagga gggaagtgtt ggaggcttgc atgaaggagg tgtttgaagg aaaaaagaaa 1260

aatgaagtta agatgaatgc aatgaaatgg aaaaaattgg cgaaagaggc gcttggtgat 1320

ggtgggagtt cagacaagaa catcgatgaa ttcgtagctg aattagtgcg atcctaa 1377

<210> 3

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ggatctggtt ccgcgtggat ccatggagac accaaacaga gc 42

<210> 4

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gctcgagtcg acccgggtta ggatcgcact aattcagcta c 41

Claims

1. the glycosyl transferase of a kind of synthesis furanone and its derivative glucoside, amino acid sequence such as SEQ ID No.1 It is shown.

2. the gene UGT10, nucleotide sequence such as SEQ ID of glycosyl transferase shown in a kind of coding SEQ ID No.1 Shown in No.2.

3. expression vector, it includes nucleotide sequences shown in SEQ ID No.2.

Gene UGT10 shown in glycosyl transferase shown in 4.SEQ ID No.1 or SEQ ID No.2 in synthesis furanone and its Application on derivative glucoside.

5. a kind of method of synthesis furanone and its derivative glucoside, which comprises the steps of:

It (1) is that primer carries out with the column of nucleotides sequence shown in SEQ ID No.3 and SEQ ID No.4 using tea tree cDNA as template PCR obtains gene UGT10 shown in SEQ ID No.2；

(2) the gene UGT10 for obtaining step (1) carries out prokaryotic expression；

(4) using furanone or furanone derivatives as substrate, be catalyzed with glycosyl transferase shown in SEQ ID No.1 anti- It answers, obtains furanone glucoside or furanone derivatives glucoside.

6. the method for a kind of synthesis furanone according to claim 5 and its derivative glucoside, which is characterized in that institute Stating furanone derivatives is -3 (2H)-furanone of 2- ethyl -4- hydroxy-5-methyl base or monomethyl furanone.

7. the method for a kind of synthesis furanone according to claim 5 and its derivative glucoside, which is characterized in that urge Change the condition of reaction are as follows: 25 DEG C -35 DEG C of temperature, pH value 6.5-10.

8. the method for a kind of synthesis furanone according to claim 7 and its derivative glucoside, which is characterized in that urge Change the condition of reaction are as follows: 30 DEG C of temperature, pH value 8.5.